The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	0	12524	4897642		Klosneuvirus(50.0%)	10	NA	NA
WP_045910731.1|2156_3266_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032654255.1|3355_3835_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017383366.1|3785_4118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017383365.1|4600_5740_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_017383364.1|5739_6189_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_045910732.1|6188_8387_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_045910733.1|8431_9898_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_015572345.1|9916_11293_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	1.1e-26
WP_032103270.1|11604_12048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045910740.1|12233_12524_-	hypothetical protein	NA	S4TRP0	Salmonella_phage	34.8	3.4e-07
>prophage 2
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	31274	31940	4897642		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_015572355.1|31274_31940_+	HAD-IA family hydrolase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	33.2	1.6e-15
>prophage 3
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	37819	43420	4897642	tRNA	Bacillus_phage(50.0%)	5	NA	NA
WP_032669504.1|37819_38593_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	1.0e-26
WP_047727013.1|38615_39515_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_045910879.1|39763_41125_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.0	3.6e-200
WP_015572364.1|41297_42020_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.4	3.2e-30
WP_015572365.1|42016_43420_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.9	2.5e-31
>prophage 4
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	58444	67752	4897642		Catovirus(25.0%)	7	NA	NA
WP_000130320.1|58444_59086_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
WP_017383269.1|59177_59759_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	1.4e-33
WP_047727523.1|59782_61633_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_015572372.1|61723_63307_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	8.2e-39
WP_003862079.1|64000_65137_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_003862078.1|65143_65587_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_015572374.1|65589_67752_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	29.8	3.2e-17
>prophage 5
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	72959	75049	4897642		Synechococcus_phage(50.0%)	2	NA	NA
WP_149912179.1|72959_74081_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	66.3	9.0e-133
WP_015572377.1|74083_75049_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.6	1.4e-86
>prophage 6
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	78299	79670	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_045910868.1|78299_79670_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.2	4.4e-33
>prophage 7
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	85199	87653	4897642		Klebsiella_phage(50.0%)	2	NA	NA
WP_045910866.1|85199_86591_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	34.3	3.7e-19
WP_045910865.1|86765_87653_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	3.6e-44
>prophage 8
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	92820	101523	4897642		Organic_Lake_phycodnavirus(14.29%)	8	NA	NA
WP_045910860.1|92820_93660_+	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	31.8	1.6e-12
WP_023303973.1|93774_95181_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.0e-37
WP_045910859.1|95270_96356_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.5	1.1e-98
WP_045910858.1|96356_97238_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	4.0e-104
WP_045910857.1|97477_98644_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	3.1e-112
WP_045910856.1|98693_99698_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-33
WP_045910855.1|99891_100872_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_017693103.1|100911_101523_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
>prophage 9
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	107033	107933	4897642		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000886595.1|107033_107933_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 10
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	113480	114647	4897642		Stx2-converting_phage(100.0%)	1	NA	NA
WP_045910850.1|113480_114647_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	85.8	4.1e-197
>prophage 11
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	123675	131469	4897642		Leptospira_phage(50.0%)	4	NA	NA
WP_045910848.1|123675_126738_-	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	20.5	8.4e-24
WP_080032339.1|126737_127733_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023303952.1|128296_128728_+	universal stress protein	NA	NA	NA	NA	NA
WP_058686886.1|128775_131469_+	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.6	2.4e-70
>prophage 12
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	148092	149394	4897642		Burkholderia_virus(100.0%)	1	NA	NA
WP_017693129.1|148092_149394_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.5	1.9e-62
>prophage 13
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	155761	158542	4897642		Lactobacillus_phage(100.0%)	1	NA	NA
WP_047727519.1|155761_158542_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	29.6	4.4e-64
>prophage 14
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	162948	171071	4897642		Burkholderia_phage(40.0%)	8	NA	NA
WP_045910804.1|162948_164115_-	porin	NA	Q1MVN1	Enterobacteria_phage	58.1	2.7e-116
WP_033486933.1|164399_165101_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.2	1.4e-06
WP_087924350.1|165144_166578_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.9	7.3e-103
WP_045910802.1|166558_167050_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	1.3e-32
WP_015572432.1|167021_167936_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_017383336.1|168114_169026_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_003859574.1|169103_169286_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_047727517.1|169370_171071_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	32.8	8.0e-16
>prophage 15
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	195468	196221	4897642		Bacillus_virus(100.0%)	1	NA	NA
WP_003859634.1|195468_196221_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.4	2.2e-26
>prophage 16
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	201582	286644	4897642	coat,plate,portal,integrase,protease,tail,holin	Salmonella_phage(16.28%)	90	201413:201472	243481:243613
201413:201472	attL	AAGGGATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGCTACC	NA	NA	NA	NA
WP_045338570.1|201582_202596_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	68.8	7.4e-134
WP_045324799.1|202595_202823_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	42.9	1.8e-08
WP_045338567.1|202876_203119_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	50.0	4.2e-11
WP_064499037.1|203105_205007_-	hypothetical protein	NA	S4TNL0	Salmonella_phage	35.2	1.1e-26
WP_045340157.1|205229_205502_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	43.0	1.6e-14
WP_045340153.1|206448_206940_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	55.0	1.4e-16
WP_032619472.1|207012_207282_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	38.7	2.2e-08
WP_032620290.1|207281_207734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045340151.1|207756_208674_+	hypothetical protein	NA	U5P0A0	Shigella_phage	39.7	3.2e-51
WP_048217849.1|208676_209417_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	73.1	1.0e-100
WP_048217851.1|209433_210090_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	27.7	3.8e-14
WP_045340313.1|210285_210519_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	48.3	1.8e-11
WP_059513930.1|210911_211304_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	75.4	6.5e-46
WP_032619477.1|211489_211813_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.8	7.0e-30
WP_045340242.1|212298_212595_+	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	59.1	2.6e-23
WP_072050714.1|212587_214288_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	50.9	2.7e-149
WP_048217858.1|214280_214637_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	57.6	7.7e-38
WP_045893788.1|214633_215239_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.7	3.2e-76
WP_149912182.1|215233_215458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651287.1|216072_216261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570936.1|216354_216741_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_072050717.1|216727_217009_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	5.7e-20
WP_045340223.1|217008_217638_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	6.0e-102
WP_045340227.1|217645_217915_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	83.1	3.1e-31
WP_045340221.1|217871_218051_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	81.4	1.7e-14
WP_126313523.1|219083_219362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619489.1|219665_220169_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
WP_023299859.1|222288_222504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619491.1|222512_224033_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.3e-153
WP_045340202.1|224022_226101_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	51.8	1.5e-197
WP_023303462.1|226167_226503_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	43.6	4.4e-11
WP_045340204.1|226502_226859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126313522.1|226860_227523_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	3.2e-21
WP_045344185.1|227531_228086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126313521.1|228078_228702_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	1.2e-06
WP_149912183.1|228740_230210_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	45.6	3.0e-75
WP_023299868.1|230206_230713_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_023299869.1|230764_231052_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_052708360.1|233253_233724_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.3	3.2e-15
WP_045899456.1|233698_233914_+|tail	tail protein	tail	R9TR63	Vibrio_phage	52.9	6.7e-13
WP_064499028.1|233916_235035_+	late control protein D	NA	R9TNM7	Vibrio_phage	33.4	4.1e-37
WP_045325028.1|235073_235427_+|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.9	3.8e-21
WP_058686487.1|235410_236325_+|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	45.3	1.4e-59
WP_045345258.1|236317_236869_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	3.3e-27
WP_045342274.1|239434_239857_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	48.2	3.1e-25
WP_032634114.1|240488_240899_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	50.4	1.9e-35
WP_004157630.1|240920_241076_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
WP_032619509.1|241382_242657_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_032619510.1|242653_243187_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_045910791.1|243791_244718_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
243481:243613	attR	AAGGGATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGCTACCATGGGAAAAAGCAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCGAAAGGTGGTTTTTTTGTGCCTG	NA	NA	NA	NA
WP_045910790.1|244723_245194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045348815.1|245359_246076_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.1e-11
WP_003859662.1|246072_246948_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_045910789.1|246944_248219_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003859667.1|248230_249145_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_045910788.1|249213_250335_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058686888.1|250746_251415_+	YecA family protein	NA	NA	NA	NA	NA
WP_045910787.1|251731_252943_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_003859673.1|253134_253371_+	YecH family protein	NA	NA	NA	NA	NA
WP_003859676.1|253407_253905_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_045910786.1|254105_254444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859680.1|254689_255328_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_045910785.1|255370_256789_-	MFS transporter	NA	NA	NA	NA	NA
WP_003859682.1|257004_257088_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_003859683.1|257194_257446_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_032654011.1|257526_258870_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_045911142.1|259446_259950_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_045911254.1|260452_261010_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_017384422.1|261326_262316_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003859688.1|262387_263902_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.7	3.1e-11
WP_003859689.1|263916_264897_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_023303910.1|265050_265854_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_015570257.1|265828_267253_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_017384418.1|267268_267697_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_006811111.1|268484_268844_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003859695.1|268846_269425_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003859696.1|269548_270436_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_047727515.1|270432_271362_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_017384416.1|271366_273376_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_039270525.1|273395_273899_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017384415.1|273995_275255_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_015570264.1|275682_276255_+	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_045341286.1|276262_276811_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_039270529.1|276827_277589_+	molecular chaperone	NA	NA	NA	NA	NA
WP_047727514.1|277564_279949_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_039270532.1|279945_280908_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023303904.1|280993_282661_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	5.8e-11
WP_017693235.1|282705_284307_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	77.3	2.2e-07
WP_017384409.1|284326_285193_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000763862.1|286254_286644_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
>prophage 17
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	294083	351723	4897642	terminase,capsid,portal,head,tRNA,protease,tail,holin	Enterobacteria_phage(36.17%)	67	NA	NA
WP_058686889.1|294083_295817_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.8	2.6e-86
WP_045911149.1|296055_296616_+	VOC family protein	NA	NA	NA	NA	NA
WP_032669628.1|296694_297438_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023303898.1|297699_298671_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003859735.1|298667_299411_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
WP_003859737.1|299451_299847_-	membrane protein	NA	NA	NA	NA	NA
WP_063945241.1|299898_300672_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.9	1.0e-58
WP_149912184.1|300650_301964_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	85.3	1.8e-220
WP_029591919.1|302019_302265_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	86.8	1.9e-35
WP_149912185.1|302257_302698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149912186.1|302685_303429_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	94.3	7.8e-133
WP_045339080.1|303474_304302_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.7	2.9e-112
WP_045339075.1|304298_304493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045339073.1|304492_304900_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	52.2	2.3e-25
WP_072159686.1|304896_305118_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.1e-18
WP_149912187.1|305089_305500_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	80.2	2.3e-46
WP_016240231.1|305480_305684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023337032.1|306298_306499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023337033.1|306912_307620_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	72.9	7.5e-93
WP_032645228.1|307735_307954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075606946.1|307979_308276_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_149912188.1|308272_309184_+	GntR family transcriptional regulator	NA	Q8W642	Enterobacteria_phage	62.9	2.2e-92
WP_050861630.1|310076_311456_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	67.9	8.4e-173
WP_149912189.1|311483_312320_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	78.5	3.5e-121
WP_045285669.1|312431_313352_-	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	74.8	2.7e-58
WP_033146314.1|313496_313901_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_000220248.1|313897_314179_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_149912190.1|314175_314805_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	94.3	4.6e-110
WP_149912191.1|314812_315082_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	79.8	4.9e-29
WP_058663103.1|315038_315233_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	85.7	4.8e-18
WP_058663104.1|315265_315553_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	63.2	7.3e-31
WP_149912192.1|315791_316256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063979121.1|317352_318810_+	hypothetical protein	NA	K7PKP3	Enterobacterial_phage	94.6	8.3e-280
WP_071925305.1|318816_319326_+	hypothetical protein	NA	K7PJS8	Enterobacterial_phage	53.8	2.5e-45
WP_149912193.1|319306_319897_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	79.6	5.7e-94
WP_149912194.1|319893_320238_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	2.3e-47
WP_045911167.1|320365_320830_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_081252437.1|320783_322526_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.2	3.1e-140
WP_149912195.1|322525_323830_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	88.7	6.4e-223
WP_149912196.1|323843_324692_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.4	9.2e-138
WP_023296252.1|324701_325913_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_149912197.1|325955_326282_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	81.5	9.8e-48
WP_032659088.1|326290_326629_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	2.5e-38
WP_149912198.1|326625_327075_+	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
WP_045357647.1|327071_327419_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	98.3	2.9e-58
WP_149912199.1|327478_327922_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.1	8.6e-71
WP_149912200.1|327930_328314_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	94.4	1.5e-63
WP_006809154.1|328322_328601_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	97.8	1.2e-43
WP_071785226.1|328652_328946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149912201.1|329004_332307_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	83.6	0.0e+00
WP_149912202.1|332309_332648_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	58.9	1.6e-37
WP_063921740.1|332644_333403_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	4.3e-94
WP_006809148.1|334114_334702_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.9	3.6e-48
WP_149912203.1|334754_338636_+	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	60.5	0.0e+00
WP_149912204.1|338637_339603_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	2.8e-58
WP_149912205.1|341060_341327_-	DinI-like family protein	NA	K7PKM2	Enterobacterial_phage	90.9	9.8e-38
WP_045911180.1|341691_342258_-	hydrolase	NA	NA	NA	NA	NA
WP_045911181.1|342520_344293_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_023296808.1|344294_344738_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003859747.1|344765_345506_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003859749.1|345540_346062_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003859751.1|346142_346757_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003859753.1|346765_347776_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
WP_015570280.1|347828_348614_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_017384350.1|348610_349366_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	3.0e-15
WP_026080689.1|349443_350388_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003859762.1|350403_351723_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 18
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	355638	357114	4897642		Cyanophage(100.0%)	1	NA	NA
WP_003859771.1|355638_357114_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
>prophage 19
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	365496	365727	4897642		Pectobacterium_phage(100.0%)	1	NA	NA
WP_003859784.1|365496_365727_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
>prophage 20
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	368978	369623	4897642		Escherichia_phage(100.0%)	1	NA	NA
WP_017384338.1|368978_369623_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.3	5.6e-55
>prophage 21
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	376841	378890	4897642		Moraxella_phage(100.0%)	1	NA	NA
WP_015570296.1|376841_378890_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
>prophage 22
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	384155	384365	4897642		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|384155_384365_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 23
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	391799	393359	4897642		Moraxella_phage(100.0%)	1	NA	NA
WP_006810992.1|391799_393359_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	6.0e-42
>prophage 24
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	397217	404460	4897642	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_032671649.1|397217_398552_-	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	42.3	2.9e-45
WP_003859925.1|398613_398796_+	YoaH family protein	NA	NA	NA	NA	NA
WP_045911200.1|398801_399146_-	RidA family protein	NA	NA	NA	NA	NA
WP_023303884.1|399279_401190_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.0	6.1e-89
WP_045615407.1|401256_401952_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_023303883.1|401989_402571_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_017693264.1|402774_404460_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
>prophage 25
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	443003	443993	4897642		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032103580.1|443003_443993_+	hypothetical protein	NA	A0A2H4J6N0	uncultured_Caudovirales_phage	29.4	5.1e-31
>prophage 26
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	452396	460837	4897642		Salicola_phage(33.33%)	5	NA	NA
WP_058686913.1|452396_455012_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.4	8.4e-81
WP_033486833.1|455036_456470_+	protein kinase	NA	M1HKB5	Acanthocystis_turfacea_Chlorella_virus	27.0	6.1e-09
WP_017384289.1|456495_457962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072210256.1|457958_458720_+	Accessory protein	NA	NA	NA	NA	NA
WP_149912207.1|458917_460837_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.8	7.6e-47
>prophage 27
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	475209	477961	4897642		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_023296766.1|475209_476889_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	3.0e-23
WP_003856663.1|477013_477961_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 28
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	481063	486784	4897642		Pseudomonas_phage(33.33%)	7	NA	NA
WP_149912208.1|481063_482146_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_045911247.1|482145_482976_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_023296762.1|482972_483365_+	SirB family protein	NA	NA	NA	NA	NA
WP_006810913.1|483368_484178_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003856671.1|484214_485069_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.5	4.4e-47
WP_003856672.1|485184_486285_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_003856674.1|486553_486784_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	45.3	1.0e-06
>prophage 29
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	493977	494766	4897642		Bacillus_virus(100.0%)	1	NA	NA
WP_015570359.1|493977_494766_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	1.3e-29
>prophage 30
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	511102	520962	4897642		Escherichia_phage(25.0%)	11	NA	NA
WP_017384243.1|511102_512638_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	1.7e-20
WP_022651366.1|512634_513345_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_015570365.1|513344_514022_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_015570366.1|514608_515451_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	49.3	2.7e-12
WP_023303849.1|515492_515957_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017384239.1|516070_516973_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_003856721.1|517062_518076_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_003856723.1|518275_519181_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	2.6e-58
WP_003856724.1|519383_519797_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_123906382.1|520117_520306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003856726.1|520347_520962_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.7	1.7e-56
>prophage 31
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	529180	532077	4897642		Planktothrix_phage(33.33%)	3	NA	NA
WP_017384234.1|529180_530194_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.8e-15
WP_017384233.1|530190_531195_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.2	1.2e-14
WP_003856745.1|531240_532077_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	39.8	6.1e-09
>prophage 32
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	546341	549299	4897642		Acinetobacter_phage(100.0%)	2	NA	NA
WP_045911822.1|546341_547700_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.0	5.0e-37
WP_017384223.1|547703_549299_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	7.2e-51
>prophage 33
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	554495	560991	4897642		uncultured_Caudovirales_phage(57.14%)	9	NA	NA
WP_000847113.1|554495_555197_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.4	5.9e-90
WP_006810860.1|555286_555607_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	7.0e-22
WP_006810859.1|555653_556943_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.3	4.4e-168
WP_006810858.1|556958_557384_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	6.8e-49
WP_001273865.1|557551_558109_-	recombinase family protein	NA	Q2A092	Sodalis_phage	42.5	2.1e-26
WP_006810857.1|558245_558662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006810855.1|559024_560254_-	hypothetical protein	NA	A0A1W6DWU6	Sphingobium_phage	24.7	4.0e-09
WP_006810854.1|560374_560560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006810853.1|560556_560991_-	hypothetical protein	NA	B5BTV7	Ralstonia_phage	58.1	1.2e-05
>prophage 34
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	565709	570039	4897642	protease	Bodo_saltans_virus(50.0%)	3	NA	NA
WP_023296716.1|565709_566756_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	3.6e-19
WP_040117736.1|566791_567043_-	YciN family protein	NA	NA	NA	NA	NA
WP_149912211.1|567441_570039_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	34.0	6.0e-87
>prophage 35
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	574963	575554	4897642		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003856813.1|574963_575554_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.3e-42
>prophage 36
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	584211	586146	4897642		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_149912212.1|584211_586146_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.2	1.1e-05
>prophage 37
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	590368	591361	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_003856840.1|590368_591361_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	2.3e-07
>prophage 38
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	608456	609539	4897642		Indivirus(100.0%)	1	NA	NA
WP_045911807.1|608456_609539_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.3	4.0e-13
>prophage 39
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	626981	629627	4897642		Salicola_phage(100.0%)	1	NA	NA
WP_047727494.1|626981_629627_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.9	1.4e-80
>prophage 40
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	638590	638854	4897642		Rhizobium_phage(100.0%)	1	NA	NA
WP_045911794.1|638590_638854_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	54.0	4.0e-07
>prophage 41
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	656518	664046	4897642	tRNA,integrase	Escherichia_phage(40.0%)	9	645910:645925	673794:673809
645910:645925	attL	TTGAAATCGACATTGT	NA	NA	NA	NA
WP_080276444.1|656518_657649_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	2.6e-10
WP_017382256.1|657739_658723_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_100160517.1|658661_658859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017382257.1|659208_660582_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.9	2.1e-51
WP_001186974.1|660625_661561_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.9	2.2e-140
WP_071524108.1|661610_661811_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.8e-20
WP_000790642.1|662229_662427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045911784.1|662429_662852_+	GFA family protein	NA	NA	NA	NA	NA
WP_045911783.1|662885_664046_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.0	1.2e-116
673794:673809	attR	ACAATGTCGATTTCAA	NA	NA	NA	NA
>prophage 42
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	676678	677437	4897642		Mycobacterium_phage(100.0%)	1	NA	NA
WP_045911778.1|676678_677437_+	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	34.0	3.0e-07
>prophage 43
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	690024	692142	4897642		Salmonella_phage(100.0%)	1	NA	NA
WP_047727062.1|690024_692142_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.5	1.6e-135
>prophage 44
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	696839	697379	4897642		Leuconostoc_phage(100.0%)	1	NA	NA
WP_045911772.1|696839_697379_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	34.7	1.5e-13
>prophage 45
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	703326	710409	4897642		Bacillus_virus(33.33%)	8	NA	NA
WP_045334928.1|703326_704100_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	8.4e-21
WP_045911768.1|704109_704997_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006810732.1|705038_705656_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003857012.1|705693_705924_+	tautomerase PptA	NA	NA	NA	NA	NA
WP_015570461.1|706110_707112_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.9	3.9e-55
WP_045911767.1|707205_707853_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000612740.1|707845_708145_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045911766.1|708306_710409_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.3	3.7e-63
>prophage 46
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	715484	717029	4897642		Escherichia_phage(100.0%)	1	NA	NA
WP_017382296.1|715484_717029_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 47
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	723121	725731	4897642		Mycobacterium_phage(50.0%)	2	NA	NA
WP_045911762.1|723121_724612_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.7	5.7e-34
WP_017382300.1|724657_725731_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	70.9	1.7e-149
>prophage 48
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	736789	739706	4897642		Tupanvirus(100.0%)	2	NA	NA
WP_006810706.1|736789_737800_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	2.3e-26
WP_045911758.1|737996_739706_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.3	7.5e-38
>prophage 49
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	746500	749152	4897642		Planktothrix_phage(66.67%)	3	NA	NA
WP_032648374.1|746500_747250_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	2.4e-17
WP_015570491.1|747246_748173_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	5.3e-14
WP_045911757.1|748165_749152_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.4e-17
>prophage 50
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	761226	765324	4897642		Bacillus_phage(50.0%)	3	NA	NA
WP_045911750.1|761226_762633_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.6	5.6e-15
WP_017382325.1|762661_763678_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_047727085.1|763773_765324_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.1e-09
>prophage 51
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	775103	775988	4897642		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_017382335.1|775103_775988_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.1	2.2e-81
>prophage 52
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	798376	804029	4897642		Bacillus_phage(50.0%)	3	NA	NA
WP_017693422.1|798376_799672_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	8.8e-15
WP_032634395.1|800452_801448_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_047727094.1|801821_804029_-	peptidase domain-containing ABC transporter	NA	F2Y165	Organic_Lake_phycodnavirus	29.8	1.5e-14
>prophage 53
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	811045	812011	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_023296617.1|811045_812011_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.3	3.4e-11
>prophage 54
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	822105	822486	4897642		Streptococcus_phage(100.0%)	1	NA	NA
WP_001303241.1|822105_822486_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	33.3	2.1e-09
>prophage 55
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	825820	827326	4897642		Staphylococcus_phage(50.0%)	2	NA	NA
WP_045911726.1|825820_826519_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	5.2e-14
WP_015570541.1|826528_827326_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	1.2e-11
>prophage 56
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	831467	837159	4897642		uncultured_virus(50.0%)	6	NA	NA
WP_015570545.1|831467_832571_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.4	4.7e-102
WP_017383989.1|832727_833138_-	rhodanese	NA	NA	NA	NA	NA
WP_045911725.1|833211_834210_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_015570547.1|834358_834721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015570548.1|834964_835198_+	DUF2554 family protein	NA	NA	NA	NA	NA
WP_015570549.1|835194_837159_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.6	1.2e-23
>prophage 57
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	843499	844729	4897642		Brevibacillus_phage(100.0%)	1	NA	NA
WP_045906708.1|843499_844729_+	peptidase T	NA	A0A0K2CPK3	Brevibacillus_phage	39.1	2.1e-05
>prophage 58
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	852830	854336	4897642		Pandoravirus(100.0%)	1	NA	NA
WP_045911723.1|852830_854336_-	carboxylesterase/lipase family protein	NA	S4VZJ7	Pandoravirus	31.2	3.1e-35
>prophage 59
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	858765	859884	4897642		Synechococcus_phage(100.0%)	1	NA	NA
WP_045911722.1|858765_859884_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	2.8e-33
>prophage 60
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	867578	869744	4897642		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_040117621.1|867578_869744_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.4	6.8e-20
>prophage 61
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	890114	892511	4897642		Escherichia_phage(100.0%)	3	NA	NA
WP_015570569.1|890114_890858_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.5	3.9e-15
WP_032669925.1|890871_891939_+	oxidoreductase	NA	NA	NA	NA	NA
WP_015570570.1|891980_892511_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.0	3.5e-18
>prophage 62
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	899453	905687	4897642		Bacillus_phage(33.33%)	4	NA	NA
WP_045911713.1|899453_900113_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	48.9	1.3e-27
WP_045911712.1|900198_904101_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	5.0e-53
WP_015570577.1|904304_904910_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_015570578.1|905000_905687_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.1	1.5e-08
>prophage 63
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	911371	912592	4897642		Orpheovirus(100.0%)	1	NA	NA
WP_045141532.1|911371_912592_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	31.6	2.4e-38
>prophage 64
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	916986	918963	4897642		Tetraselmis_virus(100.0%)	1	NA	NA
WP_017693471.1|916986_918963_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.1	1.1e-157
>prophage 65
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	945925	946915	4897642		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_047727107.1|945925_946915_+	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	44.8	3.6e-69
>prophage 66
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	953196	953436	4897642		Enterobacterial_phage(100.0%)	1	NA	NA
WP_003857390.1|953196_953436_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	5.0e-33
>prophage 67
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	959679	965846	4897642		Klosneuvirus(25.0%)	6	NA	NA
WP_149912218.1|959679_961713_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.0	1.3e-20
WP_022647991.1|961856_962603_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_003857403.1|962693_963380_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058686978.1|963415_963847_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	35.0	1.5e-16
WP_003857405.1|964134_964338_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
WP_015570612.1|964382_965846_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.7	1.7e-46
>prophage 68
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	971531	982555	4897642		Escherichia_phage(57.14%)	13	NA	NA
WP_017384541.1|971531_972746_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	30.0	2.5e-48
WP_003857412.1|972857_973184_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	7.1e-22
WP_006808856.1|973334_973673_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_003857416.1|973672_974233_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017384542.1|974250_974961_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_080340108.1|975049_975853_+	glycosyltransferase family 25 protein	NA	A0A0P0YNC5	Yellowstone_lake_phycodnavirus	23.2	1.1e-07
WP_045911696.1|975970_976276_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_058686979.1|976406_978845_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	9.8e-217
WP_017384545.1|978855_979473_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.0e-74
WP_045911688.1|979474_980329_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.8	3.8e-22
WP_017384548.1|981098_981410_+	YebG family protein	NA	NA	NA	NA	NA
WP_045911687.1|981524_981839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015570622.1|981877_982555_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	2.1e-76
>prophage 69
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	989434	990583	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_003857446.1|989434_990583_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	32.6	8.3e-25
>prophage 70
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1004426	1005692	4897642		Salmonella_phage(100.0%)	1	NA	NA
WP_032609083.1|1004426_1005692_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.5	2.6e-205
>prophage 71
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1010172	1018977	4897642		Megavirus(33.33%)	6	NA	NA
WP_045911681.1|1010172_1012449_+	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A2P1EIE5	Megavirus	26.6	6.5e-05
WP_045911680.1|1012535_1014965_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_003857514.1|1015311_1015731_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.3	6.7e-33
WP_003857516.1|1016056_1016257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045142525.1|1016303_1017170_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_017384568.1|1017315_1018977_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.9	6.4e-10
>prophage 72
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1025340	1025856	4897642		Streptococcus_phage(100.0%)	1	NA	NA
WP_015570643.1|1025340_1025856_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	56.9	3.2e-24
>prophage 73
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1037444	1040755	4897642		Phage_258-320(33.33%)	4	NA	NA
WP_015570651.1|1037444_1037864_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	38.9	3.7e-15
WP_017384577.1|1038251_1038470_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	68.7	1.5e-20
WP_017384578.1|1038947_1039175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303638.1|1039456_1040755_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.5	8.0e-16
>prophage 74
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1065741	1067016	4897642	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_017384594.1|1065741_1067016_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	43.0	5.5e-86
>prophage 75
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1070312	1071677	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_045911665.1|1070312_1071677_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.6	3.1e-18
>prophage 76
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1075451	1075970	4897642		Salmonella_phage(100.0%)	1	NA	NA
WP_023303563.1|1075451_1075970_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.1	1.4e-48
>prophage 77
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1082827	1093986	4897642		Bacillus_phage(16.67%)	10	NA	NA
WP_023296388.1|1082827_1083586_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.7	9.4e-17
WP_023296387.1|1083707_1084289_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	8.1e-45
WP_017384607.1|1084326_1085493_-	MFS transporter	NA	NA	NA	NA	NA
WP_003857632.1|1085654_1085744_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_003857634.1|1086041_1087067_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.2	1.3e-32
WP_003857638.1|1087084_1087996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384609.1|1089604_1090753_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.8	4.6e-84
WP_017384610.1|1090784_1091426_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.8	3.0e-24
WP_017384611.1|1091651_1093025_+	MdtK family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_026080712.1|1093515_1093986_-	Hsp20 family protein	NA	A0A1D7SNF0	Cyanophage	31.8	4.5e-09
>prophage 78
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1101644	1102460	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_032103702.1|1101644_1102460_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	5.7e-36
>prophage 79
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1105671	1108464	4897642		Bacillus_virus(50.0%)	2	NA	NA
WP_015570701.1|1105671_1106694_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.7	9.3e-28
WP_017693563.1|1107093_1108464_+	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JHY1	Lactococcus_phage	37.4	6.4e-48
>prophage 80
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1113570	1120581	4897642		environmental_halophage(25.0%)	7	NA	NA
WP_017693567.1|1113570_1114791_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.9	2.2e-92
WP_045911654.1|1114787_1116059_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003857736.1|1116033_1116780_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.3	3.3e-06
WP_045911653.1|1116789_1118280_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_045911652.1|1118288_1118657_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	41.3	2.9e-16
WP_072026014.1|1118645_1118912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570709.1|1119852_1120581_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.8	2.8e-50
>prophage 81
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1142758	1147503	4897642		Hokovirus(50.0%)	3	NA	NA
WP_045911642.1|1142758_1145137_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	2.7e-171
WP_017384644.1|1145472_1146306_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_015570722.1|1146456_1147503_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.1	8.0e-83
>prophage 82
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1152823	1157402	4897642		Brazilian_cedratvirus(25.0%)	5	NA	NA
WP_015570728.1|1152823_1153603_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.1e-12
WP_045911640.1|1153599_1155042_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.6	6.7e-56
WP_032619829.1|1155103_1155817_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_015570730.1|1156109_1156574_-	hypothetical protein	NA	A0A1V0DZX6	Clostridioides_phage	36.7	2.3e-13
WP_015570731.1|1156646_1157402_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A285PWH2	Cedratvirus	29.2	1.1e-09
>prophage 83
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1161776	1166241	4897642	tRNA	Bodo_saltans_virus(33.33%)	6	NA	NA
WP_003857809.1|1161776_1162760_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	43.2	9.9e-35
WP_120242031.1|1162869_1162938_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1163064_1163421_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1163471_1163669_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_023616141.1|1163766_1164309_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	2.8e-15
WP_003857814.1|1164312_1166241_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	3.9e-128
>prophage 84
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1172357	1178064	4897642		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_017384658.1|1172357_1173119_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	8.5e-18
WP_015570742.1|1173214_1173805_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_015570743.1|1173932_1175324_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_071524159.1|1175372_1175627_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_032653274.1|1175814_1178064_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.0	4.9e-138
>prophage 85
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1184236	1185064	4897642		Bacillus_virus(100.0%)	1	NA	NA
WP_003857837.1|1184236_1185064_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	1.1e-71
>prophage 86
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1192394	1193615	4897642		Klosneuvirus(100.0%)	1	NA	NA
WP_045911635.1|1192394_1193615_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.0e-25
>prophage 87
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1198222	1198843	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_015570760.1|1198222_1198843_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.4	1.7e-08
>prophage 88
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1203785	1205708	4897642		Streptococcus_phage(100.0%)	1	NA	NA
WP_017384681.1|1203785_1205708_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.5	5.3e-40
>prophage 89
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1210536	1212652	4897642		Tupanvirus(50.0%)	2	NA	NA
WP_045338914.1|1210536_1211178_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	35.8	1.2e-17
WP_045911631.1|1211398_1212652_+	glycoside hydrolase family 18 protein	NA	W5VKF1	Buzura_suppressaria_nuclear_polyhedrosis_virus	29.2	9.1e-25
>prophage 90
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1218996	1239274	4897642	head,protease,tail,capsid	Enterobacteria_phage(40.0%)	21	NA	NA
WP_149912223.1|1218996_1220280_+	DUF444 family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
WP_149912224.1|1220537_1220858_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.6	8.5e-28
WP_149912225.1|1220857_1221097_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	73.4	6.3e-28
WP_149912226.1|1222551_1223517_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.3	4.3e-59
WP_149912227.1|1223518_1227355_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	62.5	0.0e+00
WP_058686917.1|1227946_1228132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149912228.1|1228178_1228778_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	51.5	7.8e-51
WP_149912229.1|1228777_1229488_-	peptidase P60	NA	F1C573	Cronobacter_phage	69.4	1.9e-96
WP_149912230.1|1229490_1230249_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.3e-95
WP_149912231.1|1230245_1230584_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	60.7	3.6e-37
WP_149912232.1|1230586_1234078_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	86.8	0.0e+00
WP_032665364.1|1234124_1234460_-	membrane protein	NA	S4TR42	Salmonella_phage	93.7	4.0e-52
WP_149912233.1|1234515_1234794_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	94.6	6.9e-42
WP_059444879.1|1234802_1235186_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	92.9	1.3e-62
WP_149912234.1|1235194_1235638_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	5.0e-71
WP_149912235.1|1235697_1236045_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	78.9	1.7e-45
WP_149912236.1|1236041_1236491_-	HK97 gp10 family phage protein	NA	K7PH04	Enterobacteria_phage	97.3	6.5e-74
WP_149912237.1|1236487_1236826_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	8.6e-39
WP_149912238.1|1236834_1237161_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	88.0	9.5e-51
WP_023296252.1|1237204_1238416_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_045342764.1|1238425_1239274_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.4	1.0e-136
>prophage 91
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1242287	1260091	4897642	terminase,holin	Enterobacterial_phage(48.28%)	33	NA	NA
WP_045911167.1|1242287_1242752_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_045332798.1|1242878_1243223_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	3.0e-47
WP_149912239.1|1243219_1243798_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	70.2	4.0e-76
WP_149912240.1|1243791_1244544_-	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.0	1.9e-14
WP_149912241.1|1244431_1245889_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	93.6	4.6e-278
WP_047727455.1|1246032_1246296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047727457.1|1246329_1246512_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	84.1	2.1e-15
WP_149912242.1|1246468_1246738_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	79.8	3.4e-30
WP_048208887.1|1246734_1247046_-	hypothetical protein	NA	A0A289ZTW9	Serratia_phage	47.0	1.7e-12
WP_149912243.1|1247047_1247680_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.0	4.6e-102
WP_045338888.1|1247679_1247961_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	9.7e-44
WP_063161552.1|1247947_1248343_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	97.7	1.3e-62
WP_048208891.1|1248498_1249077_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.3	2.1e-45
WP_063863787.1|1249089_1250079_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.7	4.3e-179
WP_022650833.1|1250075_1250465_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.1	9.2e-69
WP_149912244.1|1250461_1250782_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	75.5	2.1e-42
WP_022650831.1|1250778_1251006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149912245.1|1251002_1251662_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.3	1.0e-99
WP_149912246.1|1251661_1252156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149912247.1|1252152_1253079_-	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	54.5	1.9e-67
WP_071882636.1|1253041_1253248_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	4.5e-14
WP_023305901.1|1253488_1253959_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.3	1.8e-74
WP_023305900.1|1254000_1254219_-	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	60.3	4.9e-11
WP_023305899.1|1254317_1255037_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	62.1	1.5e-77
WP_149912248.1|1255176_1255458_+	hypothetical protein	NA	K7PGV8	Enterobacterial_phage	82.8	8.9e-05
WP_023315865.1|1255568_1255748_-	hypothetical protein	NA	S5FM78	Shigella_phage	54.2	2.4e-11
WP_149912249.1|1256080_1256494_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	85.4	8.1e-55
WP_149912250.1|1256493_1257321_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	86.7	8.7e-125
WP_149912251.1|1257745_1258108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052946566.1|1258104_1258497_+	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	45.2	1.2e-20
WP_149912252.1|1258498_1258921_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	84.3	7.2e-67
WP_149912253.1|1258917_1259742_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	41.4	5.2e-29
WP_047717706.1|1259821_1260091_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	6.9e-31
>prophage 92
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1270817	1276029	4897642		Bacillus_virus(50.0%)	8	NA	NA
WP_045911627.1|1270817_1271846_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	1.5e-12
WP_015570793.1|1271891_1271990_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|1271990_1272065_+	protein YoaJ	NA	NA	NA	NA	NA
WP_003857896.1|1272118_1272367_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_071524166.1|1272736_1272829_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_045911626.1|1272953_1274453_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_015570796.1|1274457_1274703_-	YmjA family protein	NA	NA	NA	NA	NA
WP_003857898.1|1274778_1276029_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
>prophage 93
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1279111	1280482	4897642		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_017693620.1|1279111_1280482_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	1.1e-108
>prophage 94
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1286952	1297035	4897642		Bacillus_virus(20.0%)	10	NA	NA
WP_023303481.1|1286952_1288071_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.1	6.4e-30
WP_015570804.1|1288054_1288912_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	24.8	4.6e-12
WP_015570805.1|1288908_1289700_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_015570806.1|1289696_1290731_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_006809226.1|1290765_1291587_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.6	9.5e-23
WP_045911622.1|1291601_1292513_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_017384711.1|1292567_1293812_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_015570809.1|1293811_1294513_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.3	4.4e-37
WP_017384712.1|1294505_1295705_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_045911621.1|1295961_1297035_+	acyltransferase family protein	NA	A0A142KBN9	Gordonia_phage	26.5	5.1e-08
>prophage 95
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1302237	1302495	4897642		Erwinia_phage(100.0%)	1	NA	NA
WP_006809234.1|1302237_1302495_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	5.6e-06
>prophage 96
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1314778	1316382	4897642		Dinoroseobacter_phage(50.0%)	2	NA	NA
WP_149912256.1|1314778_1315744_-	DNA polymerase III subunit delta'	NA	A0A1V0DYC6	Dinoroseobacter_phage	32.3	2.1e-05
WP_003857946.1|1315740_1316382_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	39.6	1.8e-29
>prophage 97
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1319659	1320785	4897642		Ralstonia_phage(50.0%)	2	NA	NA
WP_003857954.1|1319659_1319896_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	3.4e-10
WP_003857956.1|1320050_1320785_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	6.5e-15
>prophage 98
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1335025	1335979	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_017384732.1|1335025_1335979_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A160LKR7	Bacillus_phage	38.0	2.8e-10
>prophage 99
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1351121	1351367	4897642		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003858011.1|1351121_1351367_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	4.5e-13
>prophage 100
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1355972	1356899	4897642		Morganella_phage(100.0%)	1	NA	NA
WP_045911608.1|1355972_1356899_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	4.0e-54
>prophage 101
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1364560	1365097	4897642		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_015570849.1|1364560_1365097_-	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	43.1	5.4e-27
>prophage 102
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1369248	1370082	4897642		Pelagibacter_phage(100.0%)	1	NA	NA
WP_003858055.1|1369248_1370082_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.9	2.3e-40
>prophage 103
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1378453	1379521	4897642		Erwinia_phage(100.0%)	1	NA	NA
WP_023303413.1|1378453_1379521_-	phosphate starvation-inducible protein PhoH	NA	A0A1B2ICF6	Erwinia_phage	68.9	6.2e-91
>prophage 104
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1395902	1399056	4897642		Enterobacteria_phage(100.0%)	4	NA	NA
WP_040117474.1|1395902_1396394_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	83.3	9.3e-42
WP_047727484.1|1396415_1397738_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	88.8	1.4e-209
WP_045911597.1|1397848_1398769_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001273664.1|1398885_1399056_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 105
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1402350	1403100	4897642		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_045333950.1|1402350_1403100_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.4	1.1e-20
>prophage 106
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1408727	1413368	4897642	protease	uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_045911591.1|1408727_1409759_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	23.2	3.8e-13
WP_015570887.1|1409755_1410517_+	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	28.6	2.5e-09
WP_045911589.1|1410809_1412438_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071524161.1|1412524_1412710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858127.1|1412708_1413368_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	2.0e-47
>prophage 107
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1417600	1419655	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_045911586.1|1417600_1419655_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.8	6.7e-17
>prophage 108
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1432144	1437381	4897642		Tupanvirus(50.0%)	3	NA	NA
WP_045911583.1|1432144_1434052_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	3.3e-50
WP_026080728.1|1434064_1436173_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_017384813.1|1436271_1437381_+	MOSC domain-containing protein	NA	A0A0E3FP00	Synechococcus_phage	35.1	5.4e-05
>prophage 109
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1442816	1450991	4897642	tRNA	Bacillus_virus(20.0%)	5	NA	NA
WP_032653150.1|1442816_1443587_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	5.8e-30
WP_023296264.1|1443687_1446300_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.8	2.0e-18
WP_058686991.1|1446554_1447757_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.9	7.6e-45
WP_015570955.1|1447925_1449326_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	37.3	1.9e-79
WP_072203341.1|1449935_1450991_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	50.7	9.5e-92
>prophage 110
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1474304	1475582	4897642	transposase	Lysinibacillus_phage(100.0%)	1	NA	NA
WP_022960607.1|1474304_1475582_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.6	3.6e-85
>prophage 111
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1481753	1485365	4897642		Halomonas_phage(50.0%)	7	NA	NA
WP_039589798.1|1481753_1482392_-	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	39.6	4.3e-31
WP_071557984.1|1482388_1482631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039388929.1|1482645_1483503_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_039391709.1|1483529_1483811_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039388930.1|1483894_1484674_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_126533991.1|1484729_1484915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039388932.1|1485017_1485365_-	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	46.8	4.1e-20
>prophage 112
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1489496	1493379	4897642		Staphylococcus_phage(33.33%)	4	NA	NA
WP_039589803.1|1489496_1489982_-	DUF2321 domain-containing protein	NA	U3PDZ3	Staphylococcus_phage	35.8	1.7e-24
WP_039388937.1|1490157_1490367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039388938.1|1490429_1492490_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.5	1.4e-19
WP_039388939.1|1492554_1493379_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.2	1.2e-46
>prophage 113
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1497176	1498241	4897642		Salmonella_phage(100.0%)	1	NA	NA
WP_039388943.1|1497176_1498241_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	40.4	7.2e-23
>prophage 114
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1515422	1519972	4897642		Bacillus_phage(100.0%)	3	NA	NA
WP_003858227.1|1515422_1517171_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	6.7e-58
WP_045329580.1|1517207_1519472_-	ComEC family protein	NA	NA	NA	NA	NA
WP_003858233.1|1519684_1519972_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
>prophage 115
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1524149	1525238	4897642		Streptococcus_phage(100.0%)	1	NA	NA
WP_045911579.1|1524149_1525238_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	7.0e-82
>prophage 116
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1529293	1558249	4897642	tRNA,protease	Tetraselmis_virus(14.29%)	22	NA	NA
WP_015570975.1|1529293_1531576_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.1e-161
WP_003858250.1|1531779_1532520_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.1	1.4e-20
WP_017384833.1|1532556_1533078_-	membrane protein	NA	NA	NA	NA	NA
WP_003858254.1|1533200_1534349_-	MFS transporter	NA	NA	NA	NA	NA
WP_072210276.1|1534389_1534572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017693703.1|1534623_1535487_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_017384835.1|1535488_1536106_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	4.0e-74
WP_038415775.1|1536116_1538561_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.5	3.1e-218
WP_003858266.1|1538772_1540065_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	4.7e-93
WP_023296220.1|1540157_1541501_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	4.3e-81
WP_017384837.1|1541510_1542125_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_032647886.1|1542251_1545920_-	hypothetical protein	NA	S5VNE3	Mycobacterium_phage	49.2	2.6e-88
WP_000228469.1|1546055_1546550_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_003858303.1|1547093_1548062_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.7	7.9e-61
WP_015570980.1|1548176_1549943_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	2.1e-11
WP_045343696.1|1549942_1551664_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.8	2.7e-19
WP_023296218.1|1551709_1552414_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|1552698_1552917_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_006809407.1|1553121_1555401_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.4e-164
WP_006174393.1|1555428_1555749_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	4.5e-13
WP_006809408.1|1556016_1556238_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_015570984.1|1556308_1558249_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	3.8e-38
>prophage 117
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1575875	1578578	4897642		Orgyia_leucostigma_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_045911409.1|1575875_1578578_-	PKD domain-containing protein	NA	B0FDP2	Orgyia_leucostigma_nucleopolyhedrovirus	60.9	3.8e-193
>prophage 118
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1594921	1595650	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_045911415.1|1594921_1595650_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.8e-28
>prophage 119
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1598778	1610192	4897642		Bacillus_phage(33.33%)	12	NA	NA
WP_045341375.1|1598778_1600248_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	2.4e-24
WP_022650690.1|1600231_1600939_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.4e-35
WP_017693730.1|1601252_1602383_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.2	3.2e-29
WP_085929694.1|1602423_1602921_-	YbjO family protein	NA	NA	NA	NA	NA
WP_003858378.1|1602963_1603809_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_017693731.1|1603805_1604759_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_017693732.1|1604768_1605902_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	6.5e-30
WP_071524164.1|1607322_1607511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858385.1|1607507_1607984_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_017693733.1|1608047_1608950_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.2	6.3e-36
WP_015571015.1|1609014_1609737_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_006809455.1|1609922_1610192_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	7.9e-27
>prophage 120
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1613981	1616468	4897642		Marinitoga_camini_virus(50.0%)	2	NA	NA
WP_047726856.1|1613981_1615658_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	64.6	1.9e-78
WP_032653083.1|1616036_1616468_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.0	7.6e-48
>prophage 121
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1622065	1624116	4897642		Escherichia_phage(50.0%)	2	NA	NA
WP_045347361.1|1622065_1622824_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	26.5	1.4e-12
WP_023296184.1|1622910_1624116_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.5	3.1e-99
>prophage 122
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1631601	1633473	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_023296179.1|1631601_1633473_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.6	5.9e-12
>prophage 123
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1636731	1640858	4897642		Synechococcus_phage(50.0%)	3	NA	NA
WP_017693747.1|1636731_1637394_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	32.7	2.2e-25
WP_032671261.1|1637521_1638421_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_047726853.1|1638425_1640858_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	49.1	1.0e-08
>prophage 124
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1648368	1649964	4897642		Tupanvirus(100.0%)	1	NA	NA
WP_023296172.1|1648368_1649964_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.4	7.2e-59
>prophage 125
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1653253	1658128	4897642		Pandoravirus(50.0%)	2	NA	NA
WP_045911429.1|1653253_1654630_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	4.2e-23
WP_023296167.1|1656187_1658128_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	37.2	1.7e-33
>prophage 126
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1679122	1684262	4897642		Enterobacteria_phage(33.33%)	7	NA	NA
WP_003858450.1|1679122_1679641_-	outer membrane protein OmpX	NA	K7PJP9	Enterobacteria_phage	31.4	3.2e-16
WP_017384917.1|1679995_1680883_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100801.1|1681181_1681685_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.4	9.3e-05
WP_071524165.1|1681865_1681994_-	reductase	NA	NA	NA	NA	NA
WP_003858455.1|1682046_1682790_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_045911437.1|1682883_1683543_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_023296158.1|1683539_1684262_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	4.7e-34
>prophage 127
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1687792	1688446	4897642		Enterobacteria_phage(50.0%)	2	NA	NA
WP_003858470.1|1687792_1688056_+	DUF1471 domain-containing protein	NA	A0A142IIN6	Enterobacteria_phage	43.8	1.3e-05
WP_045911439.1|1688179_1688446_+	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	50.6	4.9e-13
>prophage 128
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1695682	1699340	4897642		Bacillus_phage(50.0%)	2	NA	NA
WP_017693770.1|1695682_1697860_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	1.5e-43
WP_017693771.1|1697957_1699340_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	3.7e-51
>prophage 129
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1712606	1713515	4897642		Streptococcus_phage(100.0%)	1	NA	NA
WP_017384936.1|1712606_1713515_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.3	1.0e-25
>prophage 130
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1720738	1724175	4897642		Klosneuvirus(50.0%)	3	NA	NA
WP_047727119.1|1720738_1722046_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.8	1.6e-19
WP_003858531.1|1722093_1722570_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_045911444.1|1722654_1724175_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	2.8e-84
>prophage 131
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1732442	1738970	4897642		Planktothrix_phage(33.33%)	6	NA	NA
WP_017694124.1|1732442_1733501_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.3	1.1e-18
WP_003858545.1|1733500_1734193_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003858549.1|1735143_1735296_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_015571099.1|1735423_1736212_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_017694125.1|1736279_1737752_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	2.3e-11
WP_003858554.1|1737953_1738970_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
>prophage 132
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1743294	1746771	4897642		Edwardsiella_phage(33.33%)	4	NA	NA
WP_003858564.1|1743294_1744347_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.3	5.2e-82
WP_003858566.1|1744651_1745011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040117388.1|1745110_1746055_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
WP_058687004.1|1746051_1746771_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	28.4	2.1e-18
>prophage 133
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1775558	1776350	4897642		Kaumoebavirus(100.0%)	1	NA	NA
WP_015571114.1|1775558_1776350_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.1	5.2e-10
>prophage 134
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1779446	1785811	4897642		Hokovirus(50.0%)	5	NA	NA
WP_023296128.1|1779446_1780859_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	1.8e-61
WP_003858637.1|1781457_1781664_-	YbfA family protein	NA	NA	NA	NA	NA
WP_063438744.1|1781975_1782065_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_045910638.1|1782064_1783744_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_032652983.1|1783762_1785811_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.6	4.2e-27
>prophage 135
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1789083	1789761	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_003858643.1|1789083_1789761_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	29.7	2.0e-26
>prophage 136
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1796447	1797221	4897642		Mycobacterium_phage(100.0%)	1	NA	NA
WP_045910642.1|1796447_1797221_+	esterase	NA	E0YQD5	Mycobacterium_phage	34.0	6.4e-05
>prophage 137
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1801421	1805209	4897642	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_045910643.1|1801421_1803089_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.9	0.0e+00
WP_017382457.1|1803259_1805209_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.4e-08
>prophage 138
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1809817	1811482	4897642		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_045910644.1|1809817_1811482_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	38.8	2.3e-84
>prophage 139
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1815396	1816443	4897642		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003858674.1|1815396_1816443_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.4e-48
>prophage 140
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1822270	1827393	4897642	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_045910646.1|1822270_1822996_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	3.2e-30
WP_045910647.1|1823115_1824057_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_003858689.1|1824113_1824596_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_023303296.1|1824810_1827393_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.0	4.9e-182
>prophage 141
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1833784	1836242	4897642		Synechococcus_phage(50.0%)	2	NA	NA
WP_058687006.1|1833784_1834891_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
WP_003858714.1|1835030_1836242_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.4	2.0e-101
>prophage 142
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1841031	1841844	4897642		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_017382474.1|1841031_1841415_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.6	1.4e-24
WP_002439184.1|1841634_1841844_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
>prophage 143
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1861951	1868260	4897642		Morganella_phage(25.0%)	6	NA	NA
WP_006809652.1|1861951_1862380_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	36.4	4.0e-17
WP_017382489.1|1862439_1864005_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	5.4e-43
WP_014882974.1|1864193_1864757_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_032671321.1|1865378_1866299_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032671322.1|1866425_1867649_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	1.0e-60
WP_032671323.1|1867633_1868260_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	49.3	4.2e-55
>prophage 144
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1871799	1872066	4897642		Vibrio_phage(100.0%)	1	NA	NA
WP_032652939.1|1871799_1872066_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	62.7	9.5e-17
>prophage 145
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1877895	1881685	4897642		Staphylococcus_phage(50.0%)	4	NA	NA
WP_045910662.1|1877895_1879398_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	6.4e-17
WP_045910663.1|1879557_1880646_+	oxidoreductase	NA	NA	NA	NA	NA
WP_045910664.1|1881003_1881306_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032670385.1|1881280_1881685_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	8.8e-06
>prophage 146
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1893570	1898305	4897642		Klosneuvirus(50.0%)	2	NA	NA
WP_032652926.1|1893570_1894365_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.6	8.3e-08
WP_045328981.1|1894447_1898305_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.7	1.2e-59
>prophage 147
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	1904508	2010608	4897642	coat,terminase,integrase,tail,holin	Escherichia_phage(46.38%)	122	1959967:1960013	2010622:2010668
WP_017382524.1|1904508_1905315_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	8.7e-13
WP_045910671.1|1905317_1906229_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032670406.1|1906432_1906717_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032670408.1|1906713_1907106_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_045344553.1|1907245_1909279_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.6	3.4e-21
WP_017382531.1|1909407_1909995_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_045910672.1|1910008_1911481_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023296081.1|1911494_1913159_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	8.8e-60
WP_032103078.1|1913252_1913951_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045910674.1|1914150_1915719_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023303249.1|1915817_1916831_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023296077.1|1916830_1917664_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023303248.1|1917656_1918493_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	8.2e-14
WP_045910675.1|1918479_1919184_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	4.0e-22
WP_045349884.1|1919863_1920634_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_023296074.1|1920654_1922334_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_028012263.1|1922347_1923127_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_003858850.1|1923232_1924114_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080262539.1|1924377_1924524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045910676.1|1924550_1925006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045910677.1|1925247_1926030_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_045910678.1|1926368_1926680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045910679.1|1926676_1927096_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045910680.1|1927148_1928039_-	oxidoreductase	NA	NA	NA	NA	NA
WP_015571201.1|1928144_1929266_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_149912258.1|1929195_1932351_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_045910682.1|1932360_1933425_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_045910683.1|1933531_1936240_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.4	1.1e-67
WP_003858875.1|1936728_1936977_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_045910684.1|1936962_1938531_-	DUF3327 domain-containing protein	NA	NA	NA	NA	NA
WP_045910685.1|1938654_1940799_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_149912259.1|1940848_1941190_-	RamA family antibiotic efflux transcriptional regulator	NA	NA	NA	NA	NA
WP_045910686.1|1941222_1942326_-	RomA family MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003858882.1|1942517_1943108_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003858883.1|1943097_1943466_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_003858884.1|1943586_1944240_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_015571209.1|1944276_1944564_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	38.1	9.0e-05
WP_017382553.1|1944544_1944874_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017382554.1|1945013_1945883_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015571211.1|1945990_1947427_+	MFS transporter	NA	NA	NA	NA	NA
WP_015571212.1|1947494_1948739_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_015571213.1|1948739_1949711_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.4	3.5e-24
WP_045910687.1|1949786_1950929_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_045910688.1|1950921_1951947_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_015571216.1|1951962_1953198_-	MFS transporter	NA	NA	NA	NA	NA
WP_017382559.1|1953492_1954881_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_045910689.1|1957083_1959267_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_015571217.1|1959467_1959743_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
1959967:1960013	attL	AATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_045324550.1|1960354_1961026_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.8	1.3e-81
WP_032666022.1|1961092_1961500_-	cell envelope integrity/translocation protein TolA	NA	NA	NA	NA	NA
WP_126501134.1|1961642_1962911_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	2.6e-229
WP_126501133.1|1962910_1963234_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.9	2.8e-23
WP_022650864.1|1963233_1963473_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	72.2	9.1e-27
WP_149912260.1|1963555_1964869_-|tail	phage tail protein	tail	A0A220NRP2	Escherichia_phage	59.4	1.3e-130
WP_149912261.1|1964928_1965894_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.9	2.2e-58
WP_149912262.1|1965895_1969795_-	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	76.6	0.0e+00
WP_047642171.1|1969850_1970444_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	88.4	3.8e-90
WP_149912263.1|1970431_1971163_-	C40 family peptidase	NA	G8C7R2	Escherichia_phage	96.7	5.3e-150
WP_149912264.1|1971175_1971949_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	96.5	3.2e-145
WP_023295181.1|1971945_1972296_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	91.4	4.0e-55
WP_149912265.1|1972359_1972767_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	53.0	1.8e-35
WP_149912266.1|1972843_1975897_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	78.5	0.0e+00
WP_022651625.1|1975896_1976184_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	9.3e-18
WP_016042143.1|1976201_1976540_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	100.0	1.9e-57
WP_149912325.1|1976605_1977268_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	59.1	8.1e-41
WP_149912267.1|1977540_1978473_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	98.7	3.0e-166
WP_126501506.1|1978519_1978966_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	88.6	4.8e-69
WP_126501504.1|1978955_1979555_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	86.9	1.9e-97
WP_149912268.1|1979557_1979911_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	88.8	1.8e-50
WP_111995326.1|1979912_1980395_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	96.2	1.1e-84
WP_044596248.1|1980397_1980643_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	58.0	1.3e-15
WP_126501500.1|1980682_1981819_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	92.3	2.4e-194
WP_149912269.1|1981835_1982588_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	97.6	1.5e-131
WP_022651635.1|1982695_1982905_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	48.5	1.0e-13
WP_149912270.1|1982908_1984015_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	89.4	4.1e-186
WP_048218134.1|1984016_1985420_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	95.5	4.0e-255
WP_048218138.1|1985424_1986996_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	96.0	0.0e+00
WP_149912271.1|1986992_1987556_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	75.5	9.6e-59
WP_126501490.1|1987588_1987807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058691318.1|1987897_1988491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137041944.1|1988666_1988918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724946.1|1989095_1989293_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	90.7	1.6e-16
WP_137041943.1|1989249_1989522_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	63.6	1.8e-18
WP_137041942.1|1989518_1990061_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	68.7	4.3e-72
WP_137041941.1|1990063_1990339_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	4.4e-09
WP_001514183.1|1990335_1990737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040117303.1|1991167_1991410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047359641.1|1991599_1992289_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	3.8e-57
WP_096216938.1|1992285_1992402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063933426.1|1992398_1993031_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	54.2	1.6e-54
WP_149912272.1|1993023_1993194_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	91.1	9.0e-21
WP_061856552.1|1993193_1993649_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	1.4e-60
WP_063619183.1|1993835_1994117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149912326.1|1994162_1994360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149912273.1|1994469_1995366_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	36.7	9.4e-24
WP_149912274.1|1995362_1995860_-	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	52.7	5.5e-34
WP_063863798.1|1995856_1996042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149912327.1|1996038_1996461_-	ead/Ea22-like family protein	NA	A0A0N6WGF1	Salmonella_phage	68.2	1.4e-46
WP_149912275.1|1996505_1996850_-	transcriptional regulator	NA	G8C7U7	Escherichia_phage	85.0	3.2e-49
WP_063436876.1|1996851_1997541_-	phage replication protein	NA	G8C7U6	Escherichia_phage	95.6	5.0e-126
WP_032665736.1|1997537_1998401_-	hypothetical protein	NA	G8C7U5	Escherichia_phage	98.3	5.6e-159
WP_049012403.1|1998400_1999093_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_149912276.1|1999178_1999721_-	regulator	NA	M9NZI6	Enterobacteria_phage	91.7	1.6e-87
WP_006809779.1|1999751_1999967_-	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	81.7	2.8e-27
WP_149912277.1|2000070_2000712_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	76.3	6.8e-93
WP_045325426.1|2000805_2001567_+	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	46.3	1.1e-09
WP_023313997.1|2001704_2001902_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	93.8	9.2e-25
WP_063840717.1|2002608_2002797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032645601.1|2002869_2003307_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	99.3	9.4e-78
WP_058687044.1|2003465_2003705_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	45.6	2.3e-06
WP_001752704.1|2003856_2004063_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_058687045.1|2004139_2005108_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	86.0	3.0e-68
WP_058687046.1|2005115_2005400_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	86.2	3.4e-44
WP_058687047.1|2005409_2006327_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	89.8	1.9e-157
WP_058687048.1|2006323_2006944_+	helix-turn-helix domain-containing protein	NA	A0A2I7QLC5	Vibrio_phage	40.3	6.3e-27
WP_058687049.1|2006936_2007623_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.4	7.7e-119
WP_149912278.1|2007619_2008048_+	regulator	NA	G8C7S8	Escherichia_phage	94.4	2.2e-71
WP_058687051.1|2008044_2008197_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	42.3	3.6e-05
WP_045911093.1|2008672_2008894_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	48.3	1.5e-07
WP_045911094.1|2008895_2009126_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	81.6	7.2e-29
WP_072049830.1|2009232_2009568_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045337202.1|2009444_2010608_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.2	1.8e-229
2010622:2010668	attR	AATGGCACGCCCTGTAGGATTCGAACCTACGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 148
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2020215	2021082	4897642		Enterococcus_phage(100.0%)	1	NA	NA
WP_006809817.1|2020215_2021082_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.5	5.0e-30
>prophage 149
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2024853	2026239	4897642	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_017383232.1|2024853_2026239_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.5e-44
>prophage 150
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2034507	2035194	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_017383226.1|2034507_2035194_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.4e-32
>prophage 151
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2038326	2038998	4897642		Bacillus_virus(100.0%)	1	NA	NA
WP_015571235.1|2038326_2038998_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.3	2.7e-23
>prophage 152
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2042028	2044527	4897642		uncultured_virus(100.0%)	1	NA	NA
WP_023303209.1|2042028_2044527_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.3	4.5e-108
>prophage 153
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2054499	2060044	4897642		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_015571245.1|2054499_2056374_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	7.8e-113
WP_006809843.1|2056484_2057090_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003858972.1|2057089_2057422_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_045911100.1|2057475_2059404_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	42.9	7.9e-44
WP_000127359.1|2059492_2060044_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	1.6e-29
>prophage 154
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2066813	2073868	4897642		Leptospira_phage(50.0%)	6	NA	NA
WP_015571248.1|2066813_2069960_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.1	4.4e-52
WP_006809850.1|2070471_2070846_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_015571250.1|2070873_2071092_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_015571251.1|2071300_2071852_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_023296041.1|2071968_2072436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045911102.1|2072407_2073868_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.8	2.6e-15
>prophage 155
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2078116	2082380	4897642		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_045911105.1|2078116_2081206_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	65.9	0.0e+00
WP_015571260.1|2081309_2082380_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	53.4	5.8e-89
>prophage 156
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2089529	2093058	4897642		Bacillus_phage(100.0%)	2	NA	NA
WP_015571266.1|2089529_2091311_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	5.8e-41
WP_023303195.1|2091303_2093058_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	1.8e-47
>prophage 157
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2097435	2098131	4897642		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_045327595.1|2097435_2098131_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.9	5.5e-88
>prophage 158
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2101302	2106350	4897642	protease	Sodalis_phage(25.0%)	4	NA	NA
WP_002444653.1|2101302_2101575_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
WP_014882775.1|2101785_2104140_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	7.2e-225
WP_015571275.1|2104324_2105599_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.1	6.0e-133
WP_006809880.1|2105726_2106350_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.2e-64
>prophage 159
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2120325	2121825	4897642		Staphylococcus_phage(100.0%)	1	NA	NA
WP_017383184.1|2120325_2121825_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	2.8e-20
>prophage 160
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2142467	2144129	4897642		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003859098.1|2142467_2142938_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	1.0e-29
WP_045911114.1|2143025_2144129_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	2.9e-51
>prophage 161
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2147709	2152049	4897642	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_149912281.1|2147709_2148681_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.2	1.1e-46
WP_017383164.1|2148691_2150539_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003859109.1|2150566_2150899_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_015571303.1|2150921_2152049_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.2e-89
>prophage 162
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2163867	2172422	4897642		Bacillus_phage(60.0%)	6	NA	NA
WP_017383159.1|2163867_2165163_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	5.0e-26
WP_003859122.1|2165184_2165874_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	9.7e-37
WP_045911119.1|2166061_2167267_+	exonuclease subunit SbcD	NA	A0A076G8Y3	Bacillus_phage	26.7	1.5e-08
WP_045911120.1|2167263_2170395_+	exonuclease subunit SbcC	NA	M1U9H5	Synechococcus_phage	27.7	3.9e-08
WP_045911121.1|2170478_2171384_-	fructokinase	NA	NA	NA	NA	NA
WP_006809928.1|2171507_2172422_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.7	5.7e-101
>prophage 163
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2176029	2177133	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_047727237.1|2176029_2177133_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	31.4	1.4e-16
>prophage 164
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2185046	2186207	4897642		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003859164.1|2185046_2186207_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.9	6.7e-06
>prophage 165
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2194707	2195475	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_015571326.1|2194707_2195475_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	37.5	2.8e-24
>prophage 166
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2200370	2202155	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_045911127.1|2200370_2202155_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	5.3e-18
>prophage 167
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2212650	2223056	4897642	integrase	Enterobacteria_phage(66.67%)	12	2197059:2197072	2221226:2221239
2197059:2197072	attL	ATCGCCGCCAGCGC	NA	NA	NA	NA
WP_058687060.1|2212650_2214414_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	43.6	5.6e-105
WP_047955081.1|2214410_2214725_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047955080.1|2214734_2214938_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	53.2	4.9e-13
WP_047955079.1|2214934_2215150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021312336.1|2215146_2216022_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071843324.1|2216014_2216260_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_032441478.1|2216731_2216929_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_047955077.1|2217096_2217693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047955076.1|2217761_2218976_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.4	8.3e-132
WP_017383130.1|2219329_2220583_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	6.2e-98
WP_015571369.1|2220594_2221698_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.0e-59
2221226:2221239	attR	ATCGCCGCCAGCGC	NA	NA	NA	NA
WP_017383128.1|2222003_2223056_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 168
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2236257	2236836	4897642		Caulobacter_phage(100.0%)	1	NA	NA
WP_003863232.1|2236257_2236836_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.4	1.5e-14
>prophage 169
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2240707	2244912	4897642		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_006810012.1|2240707_2241448_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	5.0e-39
WP_003863238.1|2241503_2241971_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.4	4.0e-50
WP_017383714.1|2241971_2242688_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032102816.1|2242720_2243479_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_032671409.1|2243547_2244912_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	9.9e-09
>prophage 170
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2248968	2249772	4897642		Indivirus(100.0%)	1	NA	NA
WP_045911136.1|2248968_2249772_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
>prophage 171
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2256320	2257352	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_047726905.1|2256320_2257352_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	7.2e-36
>prophage 172
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2269317	2273435	4897642		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_058686826.1|2269317_2272800_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	1.0e-206
WP_045911039.1|2272838_2273435_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.3	5.1e-26
>prophage 173
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2282261	2283020	4897642		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003856176.1|2282261_2283020_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.0	1.4e-25
>prophage 174
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2294395	2295829	4897642	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_023303104.1|2294395_2295829_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	2.5e-26
>prophage 175
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2299764	2300109	4897642		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_003856230.1|2299764_2300109_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 176
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2306015	2306813	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_045911033.1|2306015_2306813_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	25.9	1.0e-13
>prophage 177
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2317129	2323903	4897642	tRNA	Bodo_saltans_virus(50.0%)	6	NA	NA
WP_045911031.1|2317129_2319559_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	29.2	4.5e-36
WP_003856249.1|2319632_2320187_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_045911030.1|2320176_2320881_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155232.1|2321057_2321513_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_017694493.1|2321572_2322463_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_085929686.1|2322478_2323903_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.5	1.6e-25
>prophage 178
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2336555	2343096	4897642		Anomala_cuprea_entomopoxvirus(33.33%)	4	NA	NA
WP_045911023.1|2336555_2337482_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.3	6.9e-22
WP_003856301.1|2337589_2338252_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_003856303.1|2338316_2338853_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.3e-17
WP_045911021.1|2341536_2343096_-	multicopper oxidase CueO	NA	L8AYM3	Mamastrovirus	57.8	1.2e-18
>prophage 179
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2351316	2352741	4897642		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003856313.1|2351316_2352741_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	3.5e-41
>prophage 180
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2363678	2364242	4897642		Sphingobium_phage(100.0%)	1	NA	NA
WP_017694507.1|2363678_2364242_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.5	2.6e-11
>prophage 181
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2368434	2369478	4897642		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_045911012.1|2368434_2369478_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	4.1e-103
>prophage 182
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2410339	2411038	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_017694525.1|2410339_2411038_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	35.2	1.8e-22
>prophage 183
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2430326	2431694	4897642		Pseudomonas_phage(50.0%)	2	NA	NA
WP_015572649.1|2430326_2431175_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	42.3	4.9e-06
WP_003856431.1|2431214_2431694_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	2.6e-28
>prophage 184
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2441245	2442394	4897642		Halovirus(100.0%)	1	NA	NA
WP_023295905.1|2441245_2442394_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	3.1e-48
>prophage 185
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2452818	2466647	4897642	tRNA	Tupanvirus(20.0%)	12	NA	NA
WP_032670587.1|2452818_2455635_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	26.1	3.8e-79
WP_003856456.1|2455680_2456607_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_106105165.1|2456614_2456707_-	DUF2575 family protein	NA	NA	NA	NA	NA
WP_003856458.1|2456935_2457199_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017694543.1|2457257_2458157_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_017383817.1|2458216_2459392_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	8.1e-84
WP_014830600.1|2459564_2460710_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.0	4.1e-24
WP_006810169.1|2460797_2462711_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.3	4.9e-147
WP_003856474.1|2463007_2463574_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_045141628.1|2463550_2464873_-	MFS transporter	NA	NA	NA	NA	NA
WP_003856479.1|2464995_2465583_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_003856481.1|2465693_2466647_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	5.7e-11
>prophage 186
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2480050	2487336	4897642		Bacillus_phage(33.33%)	5	NA	NA
WP_017694548.1|2480050_2481988_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	3.6e-12
WP_006810191.1|2482214_2483882_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.1e-41
WP_015572618.1|2484010_2484910_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045911292.1|2485018_2486020_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015572616.1|2486103_2487336_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.1	1.3e-87
>prophage 187
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2493827	2495150	4897642		Geobacillus_virus(100.0%)	1	NA	NA
WP_017383831.1|2493827_2495150_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	4.0e-79
>prophage 188
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2500610	2503408	4897642		Salmonella_phage(50.0%)	3	NA	NA
WP_003856556.1|2500610_2500772_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
WP_015572610.1|2500897_2501515_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_006810210.1|2501818_2503408_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	26.0	5.3e-30
>prophage 189
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2507145	2508210	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_017694554.1|2507145_2508210_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.9	3.4e-20
>prophage 190
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2515477	2516757	4897642		Salmonella_phage(50.0%)	2	NA	NA
WP_003856579.1|2515477_2516023_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	56.4	4.4e-24
WP_003856580.1|2516019_2516757_+	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	48.1	7.1e-62
>prophage 191
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2520580	2522245	4897642		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_017383845.1|2520580_2522245_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	3.3e-14
>prophage 192
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2560081	2567545	4897642	protease	Bacillus_virus(50.0%)	4	NA	NA
WP_015572566.1|2560081_2560684_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	G3M9Z8	Bacillus_virus	39.8	4.2e-28
WP_017383871.1|2560772_2561159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017383872.1|2561338_2561956_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_045911308.1|2561959_2567545_-	AAA family ATPase	NA	Q67624	IC4_retrovirus	32.4	1.0e-06
>prophage 193
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2573330	2574152	4897642		Mycobacterium_phage(100.0%)	1	NA	NA
WP_015572558.1|2573330_2574152_+	alpha/beta hydrolase	NA	A0A076YKN0	Mycobacterium_phage	27.8	7.3e-15
>prophage 194
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2579564	2590092	4897642	integrase	Enterobacteria_phage(66.67%)	13	2582110:2582124	2592290:2592304
WP_047726782.1|2579564_2581898_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.0	0.0e+00
WP_047726780.1|2581912_2582233_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
2582110:2582124	attL	TTTCCAGCGCGTCGA	NA	NA	NA	NA
WP_021553806.1|2582229_2582457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047726778.1|2582453_2583005_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	3.6e-34
WP_128754874.1|2583617_2583821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059452810.1|2583805_2584549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570058.1|2584551_2584770_+	Ogr/Delta-like zinc finger	NA	Q7M294	Enterobacteria_phage	68.2	1.3e-16
WP_063843840.1|2584798_2585362_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	67.6	2.7e-61
WP_059452808.1|2585367_2585511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032667159.1|2586341_2587619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128754875.1|2587621_2588005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050595453.1|2588014_2588665_-	site-specific DNA-methyltransferase	NA	H9ABR1	Halogeometricum_pleomorphic_virus	28.8	1.5e-18
WP_032667162.1|2588829_2590092_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.8	5.3e-73
2592290:2592304	attR	TTTCCAGCGCGTCGA	NA	NA	NA	NA
>prophage 195
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2607712	2617877	4897642		Paramecium_bursaria_Chlorella_virus(25.0%)	6	NA	NA
WP_003863368.1|2607712_2608645_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	1.3e-52
WP_003863370.1|2608657_2609119_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_003863373.1|2609192_2609579_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_045911377.1|2609716_2611165_+	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.1	1.9e-21
WP_047726888.1|2613834_2616543_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	24.6	1.1e-35
WP_017383908.1|2616929_2617877_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.5	7.9e-13
>prophage 196
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2627805	2630514	4897642		Vibrio_phage(50.0%)	2	NA	NA
WP_015572514.1|2627805_2629944_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.7	6.3e-268
WP_023302982.1|2630049_2630514_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	56.4	9.4e-52
>prophage 197
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2643944	2644943	4897642		Klosneuvirus(100.0%)	1	NA	NA
WP_003856070.1|2643944_2644943_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.0	3.7e-69
>prophage 198
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2648665	2652068	4897642		Organic_Lake_phycodnavirus(50.0%)	3	NA	NA
WP_017383923.1|2648665_2650168_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	2.0e-10
WP_017383924.1|2650271_2651228_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_006810347.1|2651537_2652068_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	1.6e-55
>prophage 199
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2675247	2676897	4897642		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003856047.1|2675247_2676897_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	1.7e-10
>prophage 200
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2692903	2694835	4897642		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_017694672.1|2692903_2694835_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.6e-10
>prophage 201
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2698809	2711788	4897642	tRNA,protease	Lactococcus_phage(20.0%)	11	NA	NA
WP_023295804.1|2698809_2701251_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.2	8.4e-67
WP_003855998.1|2701289_2701715_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_003855997.1|2701907_2703206_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	6.4e-66
WP_003855996.1|2703309_2703507_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_003855994.1|2703578_2704583_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_003855992.1|2704585_2705845_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_003855991.1|2705901_2707182_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003855990.1|2707256_2707568_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_017694676.1|2707653_2708604_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_045357335.1|2708596_2710441_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.4	6.4e-59
WP_015572465.1|2710450_2711788_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.3e-17
>prophage 202
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2715704	2716250	4897642		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_045911892.1|2715704_2716250_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	2.0e-29
>prophage 203
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2723532	2724510	4897642		Tupanvirus(100.0%)	1	NA	NA
WP_015572459.1|2723532_2724510_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.8	7.6e-27
>prophage 204
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2730455	2730986	4897642		Morganella_phage(100.0%)	1	NA	NA
WP_045911896.1|2730455_2730986_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	49.7	9.1e-43
>prophage 205
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2737276	2739256	4897642		Vibrio_phage(50.0%)	2	NA	NA
WP_015572446.1|2737276_2738923_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.3	1.2e-189
WP_003855929.1|2738962_2739256_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
>prophage 206
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2756103	2757606	4897642		Burkholderia_virus(100.0%)	1	NA	NA
WP_015570231.1|2756103_2757606_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.7	7.7e-55
>prophage 207
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2764119	2764908	4897642		Pithovirus(100.0%)	1	NA	NA
WP_003860210.1|2764119_2764908_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.7	5.9e-14
>prophage 208
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2770564	2772158	4897642		Bacillus_virus(50.0%)	2	NA	NA
WP_039271996.1|2770564_2771320_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.4	1.2e-16
WP_017382651.1|2771477_2772158_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.3	1.4e-08
>prophage 209
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2778248	2779781	4897642		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_045911457.1|2778248_2779781_+	D-allose ABC transporter ATP-binding protein AlsA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	9.1e-11
>prophage 210
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2784729	2786244	4897642		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_017382641.1|2784729_2786244_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.0	7.2e-08
>prophage 211
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2790892	2800520	4897642	transposase	Bacillus_phage(25.0%)	7	NA	NA
WP_015570202.1|2790892_2791624_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	2.1e-26
WP_080024796.1|2791880_2794028_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	3.6e-29
WP_085949440.1|2794325_2795694_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_023295770.1|2795795_2795948_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_047726979.1|2796069_2796744_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_015570199.1|2796824_2798138_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_045907627.1|2798561_2800520_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.1	2.3e-91
>prophage 212
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2806587	2807937	4897642		Moraxella_phage(100.0%)	1	NA	NA
WP_023295766.1|2806587_2807937_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	8.8e-159
>prophage 213
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2814170	2817775	4897642		Enterobacteria_phage(50.0%)	2	NA	NA
WP_006177466.1|2814170_2814701_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	97.2	1.5e-53
WP_003860287.1|2814952_2817775_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	0.0e+00
>prophage 214
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2820948	2823457	4897642		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_023295763.1|2820948_2822028_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.3	4.0e-29
WP_003860298.1|2822044_2823457_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	8.2e-200
>prophage 215
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2830517	2831126	4897642		Lactococcus_phage(100.0%)	1	NA	NA
WP_003860318.1|2830517_2831126_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	2.7e-14
>prophage 216
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2838222	2839332	4897642		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003860329.1|2838222_2839332_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 217
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2856413	2860097	4897642		Dickeya_phage(100.0%)	1	NA	NA
WP_017694724.1|2856413_2860097_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	91.8	2.2e-26
>prophage 218
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2872685	2878098	4897642		Prochlorococcus_phage(33.33%)	6	NA	NA
WP_045911891.1|2872685_2874275_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.4	1.1e-67
WP_015569963.1|2874290_2875583_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_045911890.1|2875631_2876324_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002445246.1|2876335_2876608_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
WP_003862310.1|2876794_2877385_-	YjaG family protein	NA	NA	NA	NA	NA
WP_003862312.1|2877426_2878098_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.1	1.3e-22
>prophage 219
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2886517	2897309	4897642		Bacillus_phage(33.33%)	5	NA	NA
WP_045911886.1|2886517_2888059_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	2.4e-11
WP_010425948.1|2888239_2888548_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003862327.1|2888547_2888865_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_017384083.1|2888980_2893204_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	4.5e-68
WP_015569976.1|2893280_2897309_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	3.6e-22
>prophage 220
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2901298	2906347	4897642		Tupanvirus(25.0%)	4	NA	NA
WP_014885484.1|2901298_2902483_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	1.5e-13
WP_015569977.1|2903360_2904311_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
WP_017383568.1|2904353_2905367_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	4.3e-17
WP_015569978.1|2905363_2906347_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	7.4e-14
>prophage 221
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2923479	2927956	4897642		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_149912289.1|2923479_2924454_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	27.7	9.5e-22
WP_003860775.1|2924512_2924725_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_017383576.1|2924969_2925680_-	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_003860776.1|2926010_2926298_+	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_045911853.1|2926336_2927956_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	25.5	3.1e-25
>prophage 222
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2931891	2932662	4897642		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015569997.1|2931891_2932662_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	1.9e-25
>prophage 223
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2947524	2949354	4897642		Catovirus(100.0%)	1	NA	NA
WP_017694743.1|2947524_2949354_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	7.4e-84
>prophage 224
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2956582	2957485	4897642		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015570006.1|2956582_2957485_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	2.0e-18
>prophage 225
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2974073	2978272	4897642		uncultured_marine_virus(33.33%)	4	NA	NA
WP_045910944.1|2974073_2975204_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	32.9	6.7e-19
WP_032646798.1|2975208_2975886_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_015570020.1|2975882_2977145_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	26.4	1.5e-22
WP_006812390.1|2977141_2978272_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.2	1.4e-27
>prophage 226
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2982335	2994261	4897642		Indivirus(20.0%)	12	NA	NA
WP_006812392.1|2982335_2982665_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
WP_006812393.1|2982809_2984078_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.7e-42
WP_047727038.1|2984083_2985568_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_015570023.1|2985619_2987644_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	5.8e-114
WP_006812396.1|2987729_2988011_+	peptidylprolyl isomerase PpiC	NA	NA	NA	NA	NA
WP_022646641.1|2988065_2988887_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006812398.1|2988962_2989982_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014168079.1|2989981_2990449_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_003860837.1|2990480_2990732_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	1.1e-14
WP_017383604.1|2990743_2991175_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_017383605.1|2991423_2992968_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_149912290.1|2992977_2994261_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
>prophage 227
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	2998377	3001758	4897642		Vibrio_phage(33.33%)	3	NA	NA
WP_017383610.1|2998377_2999406_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
WP_006812405.1|2999415_3000612_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.1	1.6e-34
WP_003860858.1|3000825_3001758_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	3.8e-36
>prophage 228
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3010263	3017862	4897642		Catovirus(20.0%)	10	NA	NA
WP_015570038.1|3010263_3011253_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	27.3	7.2e-09
WP_003860874.1|3011319_3012594_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_045910950.1|3012593_3013364_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015570040.1|3013367_3013847_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.9	4.1e-26
WP_003860879.1|3013849_3014659_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.6	1.2e-25
WP_003024094.1|3014731_3014899_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002436699.1|3014921_3015158_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_006812419.1|3015375_3016041_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_045910951.1|3016211_3017426_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.3	2.5e-40
WP_010426426.1|3017406_3017862_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	9.5e-49
>prophage 229
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3030324	3035333	4897642		uncultured_virus(33.33%)	4	NA	NA
WP_045910954.1|3030324_3031995_-	NAD-dependent DNA ligase LigB	NA	A0A218MKC8	uncultured_virus	23.3	4.8e-21
WP_006177710.1|3032245_3032869_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	9.7e-20
WP_000135058.1|3032923_3033199_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003860921.1|3033218_3035333_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 230
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3039543	3040935	4897642		environmental_Halophage(100.0%)	1	NA	NA
WP_015570053.1|3039543_3040935_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	2.3e-69
>prophage 231
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3048587	3049616	4897642		Wolbachia_phage(100.0%)	1	NA	NA
WP_072052497.1|3048587_3049616_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	44.6	2.7e-75
>prophage 232
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3061112	3065287	4897642		Morganella_phage(33.33%)	5	NA	NA
WP_015570073.1|3061112_3061637_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	58.9	9.9e-50
WP_017383646.1|3061754_3062480_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	43.2	1.4e-41
WP_017383647.1|3062579_3062990_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_032646730.1|3063092_3064052_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_023302851.1|3064198_3065287_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	61.9	6.7e-125
>prophage 233
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3069166	3071263	4897642		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_017383654.1|3069166_3071263_-	peptidase domain-containing ABC transporter	NA	F2Y1V5	Organic_Lake_phycodnavirus	23.9	3.9e-12
>prophage 234
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3097652	3098810	4897642		Salmonella_phage(100.0%)	1	NA	NA
WP_032646699.1|3097652_3098810_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.6	5.6e-29
>prophage 235
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3109857	3110862	4897642		Tupanvirus(100.0%)	1	NA	NA
WP_023302828.1|3109857_3110862_-	alpha/beta hydrolase	NA	A0A2K9KZN8	Tupanvirus	28.4	2.6e-06
>prophage 236
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3116370	3118059	4897642		Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_047727023.1|3116370_3118059_-	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.8	2.2e-58
>prophage 237
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3122158	3123343	4897642		Salmonella_phage(100.0%)	1	NA	NA
WP_015570118.1|3122158_3123343_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.6	2.8e-15
>prophage 238
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3132258	3133234	4897642		Synechococcus_phage(50.0%)	2	NA	NA
WP_015570126.1|3132258_3132687_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	2.5e-14
WP_006177605.1|3132823_3133234_-	heat shock chaperone IbpA	NA	A0A218MKI2	uncultured_virus	39.2	3.2e-19
>prophage 239
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3136613	3137762	4897642		Oenococcus_phage(100.0%)	1	NA	NA
WP_017694024.1|3136613_3137762_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.1	9.4e-53
>prophage 240
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3143184	3150573	4897642		Bacillus_virus(33.33%)	7	NA	NA
WP_058687100.1|3143184_3145596_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.2	5.3e-114
WP_000060091.1|3145624_3146698_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_015570134.1|3146697_3147798_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.5e-52
WP_017383700.1|3147802_3149197_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|3149835_3149976_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_006808764.1|3149992_3150352_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3150315_3150573_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 241
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3157443	3167952	4897642		Moraxella_phage(20.0%)	9	NA	NA
WP_017383704.1|3157443_3158781_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	5.6e-65
WP_045911554.1|3158946_3159612_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_003861153.1|3159656_3160382_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003861154.1|3160408_3161182_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
WP_003861156.1|3161229_3162120_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_015570141.1|3162119_3163079_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_017383706.1|3163207_3164248_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.7	1.7e-48
WP_023298944.1|3164525_3166355_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.7	6.2e-131
WP_045911553.1|3166581_3167952_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A1V0SFS6	Hokovirus	31.6	2.1e-19
>prophage 242
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3179734	3180727	4897642		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003862385.1|3179734_3180727_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	3.5e-48
>prophage 243
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3183891	3191829	4897642		Enterobacteria_phage(50.0%)	7	NA	NA
WP_006808744.1|3183891_3185760_+	low affinity potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	29.7	1.7e-64
WP_045911552.1|3185974_3186394_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_045911551.1|3186401_3187907_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.7	1.7e-17
WP_003862395.1|3187911_3188877_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_003862397.1|3188904_3189795_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.7	3.3e-05
WP_045911550.1|3189903_3190833_+	ribokinase	NA	NA	NA	NA	NA
WP_017694038.1|3190836_3191829_+	ribose operon transcriptional repressor RbsR	NA	C6ZCU4	Enterobacteria_phage	33.7	2.8e-37
>prophage 244
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3203966	3206759	4897642		Enterococcus_phage(100.0%)	1	NA	NA
WP_045911387.1|3203966_3206759_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	29.3	3.6e-45
>prophage 245
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3210679	3213153	4897642		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_003861919.1|3210679_3212092_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	1.1e-05
WP_003861923.1|3212103_3213153_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	3.4e-09
>prophage 246
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3224858	3227636	4897642		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003861941.1|3224858_3225749_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	94.6	2.1e-63
WP_026080563.1|3225904_3226801_+	sugar kinase	NA	NA	NA	NA	NA
WP_003861944.1|3226835_3227636_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	7.1e-23
>prophage 247
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3254251	3255754	4897642		Bacillus_virus(100.0%)	1	NA	NA
WP_015569928.1|3254251_3255754_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.1e-11
>prophage 248
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3263957	3267440	4897642		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_045911398.1|3263957_3264578_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	1.7e-64
WP_017382697.1|3264644_3265328_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_015569937.1|3265371_3266745_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_003862004.1|3266741_3267440_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	2.4e-06
>prophage 249
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3279269	3284239	4897642		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_015569943.1|3279269_3280115_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.7	7.5e-15
WP_003862031.1|3280514_3280754_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_033487969.1|3281340_3281826_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_149912296.1|3281918_3282845_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_015569947.1|3282907_3284239_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	29.5	1.9e-44
>prophage 250
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3311532	3313383	4897642		Acinetobacter_phage(100.0%)	1	NA	NA
WP_045911406.1|3311532_3313383_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	28.4	1.0e-11
>prophage 251
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3323466	3325113	4897642		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_023304625.1|3323466_3325113_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	31.9	4.5e-64
>prophage 252
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3350787	3356073	4897642		Acinetobacter_phage(66.67%)	5	NA	NA
WP_045911843.1|3350787_3352626_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.5	4.0e-13
WP_045911842.1|3352629_3353514_-	ROK family protein	NA	NA	NA	NA	NA
WP_045911841.1|3353680_3355219_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_071788668.1|3355468_3355654_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	55.9	4.0e-14
WP_023295606.1|3355668_3356073_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	36.6	1.4e-19
>prophage 253
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3377069	3378611	4897642		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015572746.1|3377069_3378611_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.8e-15
>prophage 254
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3382936	3383932	4897642		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_045911885.1|3382936_3383932_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.6	2.4e-12
>prophage 255
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3392640	3393255	4897642		Streptococcus_phage(100.0%)	1	NA	NA
WP_047726943.1|3392640_3393255_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.5	2.4e-18
>prophage 256
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3439369	3441412	4897642		Indivirus(100.0%)	1	NA	NA
WP_045910930.1|3439369_3441412_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	5.2e-46
>prophage 257
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3456593	3459922	4897642		Bacillus_phage(66.67%)	4	NA	NA
WP_000647571.1|3456593_3456944_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|3457091_3457523_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555736.1|3457767_3459249_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000697968.1|3459241_3459922_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
>prophage 258
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3469808	3470546	4897642		Listeria_phage(100.0%)	1	NA	NA
WP_000287501.1|3469808_3470546_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
>prophage 259
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3476316	3479823	4897642		Bacillus_phage(50.0%)	3	NA	NA
WP_001211180.1|3476316_3477717_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_000723069.1|3477934_3478369_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_149912301.1|3478797_3479823_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.4	2.7e-75
>prophage 260
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3483291	3487395	4897642		Tupanvirus(66.67%)	3	NA	NA
WP_045910924.1|3483291_3484431_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.1	1.5e-26
WP_017384101.1|3484432_3485416_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.3	3.4e-35
WP_045910923.1|3485412_3487395_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.2	9.6e-21
>prophage 261
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3506593	3507671	4897642		Vibrio_phage(50.0%)	2	NA	NA
WP_003861274.1|3506593_3507259_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	3.3e-58
WP_000130627.1|3507428_3507671_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	80.6	6.0e-10
>prophage 262
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3510794	3513672	4897642		Streptococcus_phage(50.0%)	2	NA	NA
WP_045910911.1|3510794_3512969_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.3	9.9e-120
WP_003861515.1|3513045_3513672_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	63.7	2.9e-32
>prophage 263
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3516702	3520926	4897642		Staphylococcus_phage(33.33%)	4	NA	NA
WP_006812284.1|3516702_3517368_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.8e-14
WP_017384126.1|3517360_3518416_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000159624.1|3518666_3519524_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	9.2e-45
WP_045910909.1|3519660_3520926_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.4	4.9e-26
>prophage 264
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3526548	3528028	4897642		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_003861544.1|3526548_3527313_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	2.8e-13
WP_015571469.1|3527314_3528028_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	5.0e-12
>prophage 265
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3531480	3533288	4897642		Planktothrix_phage(50.0%)	2	NA	NA
WP_045910908.1|3531480_3532551_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	7.5e-20
WP_045910907.1|3532547_3533288_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.5	2.4e-09
>prophage 266
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3550542	3552990	4897642		Dickeya_phage(100.0%)	1	NA	NA
WP_032103634.1|3550542_3552990_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.2e-33
>prophage 267
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3556097	3556856	4897642		Escherichia_phage(100.0%)	1	NA	NA
WP_032655365.1|3556097_3556856_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	2.2e-21
>prophage 268
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3560194	3562588	4897642		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_047726930.1|3560194_3562588_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	1.8e-13
>prophage 269
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3567763	3568546	4897642		Mycobacterium_phage(100.0%)	1	NA	NA
WP_017693858.1|3567763_3568546_+	pimeloyl-ACP methyl ester esterase BioH	NA	G9VYU4	Mycobacterium_phage	32.7	2.6e-06
>prophage 270
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3574784	3578555	4897642		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3574784_3575504_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_003861615.1|3575500_3576847_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	2.5e-12
WP_015571439.1|3576938_3578555_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.7	5.4e-139
>prophage 271
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3595323	3596136	4897642		Vibrio_phage(100.0%)	1	NA	NA
WP_015571432.1|3595323_3596136_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.2	4.6e-70
>prophage 272
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3608312	3610400	4897642		environmental_Halophage(100.0%)	1	NA	NA
WP_006812214.1|3608312_3610400_-	membrane protein	NA	H9YQA8	environmental_Halophage	84.8	2.0e-64
>prophage 273
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3618828	3624242	4897642		Salmonella_phage(50.0%)	5	NA	NA
WP_000222846.1|3618828_3619788_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	93.5	1.7e-55
WP_045910890.1|3619790_3620408_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_017693877.1|3620407_3621304_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_033488045.1|3621389_3622322_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045910889.1|3622337_3624242_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.5	1.0e-75
>prophage 274
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3632049	3635418	4897642		Streptococcus_phage(50.0%)	2	NA	NA
WP_006812195.1|3632049_3634164_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.3	2.3e-57
WP_017693880.1|3634233_3635418_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	9.8e-13
>prophage 275
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3655304	3659629	4897642	tRNA	Prochlorococcus_phage(33.33%)	6	NA	NA
WP_017693884.1|3655304_3656252_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.5	8.4e-07
WP_015571402.1|3656276_3656786_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	4.4e-18
WP_045911900.1|3656913_3658038_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460665.1|3658009_3658483_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017383725.1|3658509_3659064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017693886.1|3659056_3659629_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	26.2	3.8e-10
>prophage 276
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3673023	3675108	4897642		Bacillus_virus(100.0%)	1	NA	NA
WP_045911922.1|3673023_3675108_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.8	7.0e-22
>prophage 277
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3688364	3689408	4897642		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3688364_3689408_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 278
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3708262	3709630	4897642	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015572006.1|3708262_3709630_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.4	6.6e-21
>prophage 279
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3713593	3717595	4897642	protease	Pseudomonas_phage(50.0%)	4	NA	NA
WP_026080566.1|3713593_3714091_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.6	3.8e-27
WP_017382717.1|3714193_3714976_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_045911917.1|3715098_3715992_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_032655258.1|3716104_3717595_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	21.5	1.9e-08
>prophage 280
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3728408	3733728	4897642		Staphylococcus_phage(33.33%)	4	NA	NA
WP_096152317.1|3728408_3729350_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.4	2.3e-17
WP_023304496.1|3729329_3730832_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	2.0e-82
WP_023304495.1|3730969_3732616_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_015571992.1|3732708_3733728_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	31.0	3.2e-44
>prophage 281
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3737852	3754889	4897642		Mycoplasma_phage(14.29%)	17	NA	NA
WP_003861882.1|3737852_3739364_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.2	1.2e-47
WP_003861881.1|3739629_3740730_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_045911914.1|3741948_3744282_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.0	6.4e-40
WP_015571987.1|3744514_3745168_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_015571986.1|3745164_3745890_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_003861872.1|3745929_3746202_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_003861870.1|3746198_3747053_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003861869.1|3747098_3747590_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003861866.1|3747672_3747960_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_045907663.1|3747982_3749416_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003861862.1|3749463_3750189_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.1e-22
WP_006812136.1|3750195_3750750_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_015571983.1|3750718_3751294_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_017693909.1|3751290_3751857_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.6	8.5e-55
WP_003861853.1|3751871_3752858_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	1.1e-38
WP_003861852.1|3752871_3753849_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_017382730.1|3754076_3754889_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	3.7e-19
>prophage 282
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3758933	3760422	4897642		Vibrio_phage(50.0%)	2	NA	NA
WP_020480545.1|3758933_3759221_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	69.8	1.0e-16
WP_045911912.1|3759450_3760422_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.7	2.7e-08
>prophage 283
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3763553	3765256	4897642		Bacillus_phage(100.0%)	2	NA	NA
WP_017693913.1|3763553_3764597_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	23.0	9.6e-12
WP_015571977.1|3764593_3765256_-	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	38.1	6.9e-32
>prophage 284
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3768698	3770633	4897642	protease	Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_003861810.1|3768698_3770633_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	2.0e-116
>prophage 285
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3773745	3780358	4897642		Dickeya_phage(50.0%)	4	NA	NA
WP_015571974.1|3773745_3775092_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	9.6e-65
WP_014833432.1|3775662_3776115_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003861798.1|3776143_3777646_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_006812117.1|3777670_3780358_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.8	2.5e-27
>prophage 286
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3785799	3787695	4897642		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003861780.1|3785799_3787695_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.5	5.4e-53
>prophage 287
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3793379	3801170	4897642		Invertebrate_iridovirus(25.0%)	10	NA	NA
WP_003861768.1|3793379_3793709_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	46.8	8.8e-12
WP_015571966.1|3793723_3794158_+	YhbP family protein	NA	NA	NA	NA	NA
WP_015571965.1|3794137_3794656_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.3	1.8e-11
WP_045911543.1|3794784_3795429_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_045911542.1|3795469_3796507_+	permease	NA	NA	NA	NA	NA
WP_006812102.1|3796556_3797132_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_003861754.1|3797141_3797732_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	4.1e-12
WP_003861751.1|3797753_3798149_-	YraN family protein	NA	NA	NA	NA	NA
WP_058686835.1|3798106_3800245_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809144.1|3800306_3801170_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.2	4.3e-50
>prophage 288
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3818117	3819263	4897642		Streptococcus_phage(100.0%)	1	NA	NA
WP_045911539.1|3818117_3819263_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.4	1.4e-48
>prophage 289
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3824947	3827242	4897642		Tetraselmis_virus(100.0%)	1	NA	NA
WP_045911537.1|3824947_3827242_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	7.4e-158
>prophage 290
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3844342	3845308	4897642		Escherichia_phage(100.0%)	1	NA	NA
WP_017382424.1|3844342_3845308_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.4	1.8e-36
>prophage 291
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3853469	3854957	4897642		Pithovirus(100.0%)	1	NA	NA
WP_032669124.1|3853469_3854957_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W5SAS9	Pithovirus	28.6	1.1e-08
>prophage 292
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3868651	3873775	4897642		Klosneuvirus(33.33%)	3	NA	NA
WP_080339763.1|3868651_3870058_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-32
WP_047726811.1|3870453_3871974_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	36.7	2.5e-32
WP_045911525.1|3872215_3873775_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.9	1.9e-08
>prophage 293
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3877508	3899339	4897642	terminase,capsid,portal,head,integrase,tail,holin	Cronobacter_phage(83.33%)	29	3876559:3876608	3907255:3907304
3876559:3876608	attL	AAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_110871475.1|3877508_3878531_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.6	1.0e-122
WP_110871477.1|3878532_3879114_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	36.4	4.1e-28
WP_023136170.1|3879254_3879476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042863262.1|3879506_3880010_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	70.1	1.6e-57
WP_042863261.1|3880019_3880214_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_058656673.1|3880203_3880632_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	50.0	2.0e-24
WP_013097407.1|3881098_3881332_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_032657714.1|3882186_3882399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110871481.1|3882367_3884416_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	76.3	7.3e-306
WP_032657719.1|3884537_3884744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045626029.1|3884717_3885041_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	88.6	3.3e-48
WP_110871483.1|3885037_3886090_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	79.2	6.2e-160
WP_110871485.1|3886086_3887862_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.8	2.8e-290
WP_110871487.1|3888034_3888829_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	54.9	3.8e-69
WP_039268761.1|3888888_3889911_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.1	1.6e-152
WP_032657737.1|3889913_3890615_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	3.3e-85
WP_032657740.1|3890674_3891166_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	77.3	3.2e-58
WP_032657743.1|3891162_3891669_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	2.8e-65
WP_110871489.1|3891665_3892373_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	77.8	2.6e-101
WP_149912305.1|3892369_3893497_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	82.9	3.3e-175
WP_032657750.1|3893493_3893949_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	73.5	5.4e-60
WP_032657752.1|3893958_3894246_+|holin	holin	holin	C7BGD7	Burkholderia_phage	51.8	2.1e-14
WP_032657755.1|3894242_3894584_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	89.1	3.2e-49
WP_110871494.1|3894583_3894952_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.3	4.7e-22
WP_110871496.1|3894848_3895088_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	56.6	4.2e-16
WP_059452982.1|3895071_3895332_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.8	2.8e-21
WP_110871498.1|3895519_3897832_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	56.3	2.8e-213
WP_039268773.1|3897828_3898158_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.5	4.6e-37
WP_110871500.1|3898154_3899339_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.5	1.2e-175
3907255:3907304	attR	AAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAG	NA	NA	NA	NA
>prophage 294
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3902384	3904054	4897642	tail	Cronobacter_phage(66.67%)	3	NA	NA
WP_110871504.1|3902384_3902819_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	61.5	4.0e-20
WP_044857639.1|3902808_3903534_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.0	1.2e-61
WP_032657780.1|3903505_3904054_+	protein phage	NA	F1BUJ9	Cronobacter_phage	72.9	1.1e-62
>prophage 295
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3908068	3913392	4897642	tRNA	Vibrio_phage(33.33%)	4	NA	NA
WP_015571912.1|3908068_3909913_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_003862574.1|3910065_3911811_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_001144069.1|3911926_3912142_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015571911.1|3912378_3913392_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
>prophage 296
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3922667	3923909	4897642		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_023304444.1|3922667_3923909_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.6	3.6e-90
>prophage 297
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3929046	3931903	4897642		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_015571898.1|3929046_3930477_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.8	3.3e-39
WP_149912306.1|3930576_3930873_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_015571897.1|3931249_3931903_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.9	1.6e-44
>prophage 298
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3938887	3950413	4897642		Ralstonia_phage(20.0%)	10	NA	NA
WP_045911492.1|3938887_3940048_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.6	9.1e-88
WP_003862522.1|3940050_3940716_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.5	1.5e-39
WP_017384041.1|3940910_3942389_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_017384042.1|3942592_3943225_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	36.7	1.8e-21
WP_003862516.1|3943221_3943644_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_017384043.1|3943671_3944499_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_015571888.1|3944498_3945080_+	esterase YqiA	NA	NA	NA	NA	NA
WP_017384044.1|3945108_3947001_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	6.5e-91
WP_015571887.1|3947086_3949216_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017384046.1|3949600_3950413_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	2.7e-14
>prophage 299
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3963437	3966216	4897642		Stx_converting_phage(50.0%)	2	NA	NA
WP_003862501.1|3963437_3963839_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	44.4	1.6e-20
WP_015571873.1|3963957_3966216_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.3	3.4e-86
>prophage 300
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3981951	3986230	4897642		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_007894989.1|3981951_3985026_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_007851507.1|3985147_3986230_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
>prophage 301
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	3991163	4000609	4897642		uncultured_Caudovirales_phage(62.5%)	11	NA	NA
WP_016151342.1|3991163_3991742_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	5.7e-22
WP_004206572.1|3991917_3993123_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_004206574.1|3993133_3993439_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007898876.1|3993567_3994266_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	7.7e-90
WP_022649397.1|3994351_3994672_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	8.5e-20
WP_007898880.1|3994716_3996006_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
WP_007898882.1|3996018_3996444_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
WP_007898884.1|3997883_3998162_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007898888.1|3998492_3998786_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_004152282.1|3998884_3999652_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118246.1|3999652_4000609_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
>prophage 302
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4007673	4012635	4897642	transposase	Erysipelothrix_phage(33.33%)	3	NA	NA
WP_007896426.1|4007673_4008999_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_007901308.1|4009197_4010121_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
WP_016151369.1|4012284_4012635_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
>prophage 303
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4025009	4026948	4897642		Pseudomonas_phage(50.0%)	2	NA	NA
WP_072210248.1|4025009_4026035_+	DUF3362 domain-containing protein	NA	M1QSD9	Pseudomonas_phage	71.7	1.5e-105
WP_032655034.1|4026120_4026948_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	1.9e-63
>prophage 304
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4036074	4037622	4897642		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_045910779.1|4036074_4037622_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	1.2e-10
>prophage 305
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4041843	4043175	4897642		Salmonella_phage(100.0%)	1	NA	NA
WP_015571860.1|4041843_4043175_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	B9UDL7	Salmonella_phage	35.9	1.0e-05
>prophage 306
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4053076	4054861	4897642		Tupanvirus(100.0%)	1	NA	NA
WP_045910777.1|4053076_4054861_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	23.7	7.9e-14
>prophage 307
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4085118	4086273	4897642		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003860037.1|4085118_4086273_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	3.1e-128
>prophage 308
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4099119	4100668	4897642		Mycobacterium_phage(50.0%)	2	NA	NA
WP_032619068.1|4099119_4099890_+	alpha/beta hydrolase	NA	A0A249XTU1	Mycobacterium_phage	36.6	9.6e-09
WP_015571822.1|4099873_4100668_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.3	8.3e-08
>prophage 309
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4117572	4118805	4897642		Catovirus(100.0%)	1	NA	NA
WP_017692705.1|4117572_4118805_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	4.1e-102
>prophage 310
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4126645	4129519	4897642		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_039269830.1|4126645_4129519_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.2	3.1e-262
>prophage 311
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4139846	4147435	4897642	tRNA	Brevibacillus_phage(20.0%)	7	NA	NA
WP_003863442.1|4139846_4140743_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.3	1.5e-29
WP_003863443.1|4140771_4141485_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_017382886.1|4141490_4143224_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_096147815.1|4143314_4144412_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_003863452.1|4144422_4145940_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	7.7e-87
WP_047727300.1|4145988_4146531_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_022651807.1|4146694_4147435_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	35.7	2.2e-10
>prophage 312
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4153505	4156475	4897642		Tetraselmis_virus(50.0%)	2	NA	NA
WP_045910755.1|4153505_4155488_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.8	1.4e-152
WP_032649406.1|4155590_4156475_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.0	1.0e-78
>prophage 313
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4174491	4179493	4897642		Trichoplusia_ni_ascovirus(33.33%)	4	NA	NA
WP_003862835.1|4174491_4175253_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.5e-19
WP_045910750.1|4175565_4176981_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.8	8.4e-27
WP_017382862.1|4177065_4178352_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058686785.1|4178365_4179493_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.5	8.8e-11
>prophage 314
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4186429	4187467	4897642		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003862814.1|4186429_4187467_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	2.8e-27
>prophage 315
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4193446	4195606	4897642		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045910746.1|4193446_4195606_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.8	1.3e-18
>prophage 316
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4200323	4204475	4897642		Hokovirus(50.0%)	3	NA	NA
WP_015571752.1|4200323_4202570_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	23.9	5.4e-12
WP_058686783.1|4202798_4203674_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_149912311.1|4203680_4204475_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	3.4e-118
>prophage 317
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4209904	4225227	4897642	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_045910743.1|4209904_4212787_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.9	8.1e-61
WP_047727309.1|4212783_4216326_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.0	7.3e-11
WP_017692741.1|4216322_4218143_+	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	27.1	9.5e-23
WP_015571744.1|4218176_4219508_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_017382840.1|4219735_4220989_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.0	1.8e-12
WP_015571742.1|4221605_4222703_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_006811804.1|4222778_4223585_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.7	1.1e-15
WP_003862762.1|4223575_4224022_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_045911286.1|4224021_4225227_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	38.0	2.7e-74
>prophage 318
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4228499	4229255	4897642		Bacillus_phage(100.0%)	1	NA	NA
WP_023295348.1|4228499_4229255_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.6	9.4e-09
>prophage 319
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4234072	4234915	4897642		Vibrio_phage(100.0%)	1	NA	NA
WP_015571734.1|4234072_4234915_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	36.4	1.4e-40
>prophage 320
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4242172	4247484	4897642		Streptococcus_phage(33.33%)	3	NA	NA
WP_045141979.1|4242172_4243318_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.4	1.7e-49
WP_003862726.1|4243368_4246128_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.7	1.3e-55
WP_023295343.1|4246185_4247484_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.3	1.4e-39
>prophage 321
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4250849	4253868	4897642		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_003862718.1|4250849_4252487_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	2.7e-154
WP_006811784.1|4252569_4253868_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	2.4e-129
>prophage 322
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4257231	4257903	4897642		Vibrio_phage(100.0%)	1	NA	NA
WP_015571722.1|4257231_4257903_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	31.4	1.4e-11
>prophage 323
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4271706	4273736	4897642		Hokovirus(50.0%)	2	NA	NA
WP_045911277.1|4271706_4273131_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	28.4	2.0e-36
WP_045911276.1|4273130_4273736_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.6	8.5e-29
>prophage 324
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4276747	4280422	4897642		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_017382816.1|4276747_4277509_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	3.9e-55
WP_015571709.1|4277502_4278129_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	5.7e-36
WP_017692761.1|4278245_4279370_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.1	3.8e-06
WP_013098493.1|4279429_4280422_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 325
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4286012	4288574	4897642		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_017382809.1|4286012_4288574_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.2	9.8e-34
>prophage 326
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4306434	4307448	4897642		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017382794.1|4306434_4307448_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.4	9.3e-28
>prophage 327
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4315777	4316743	4897642		Tetraselmis_virus(100.0%)	1	NA	NA
WP_045911266.1|4315777_4316743_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.8	1.2e-35
>prophage 328
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4322354	4330289	4897642	tRNA	Bodo_saltans_virus(20.0%)	8	NA	NA
WP_015571670.1|4322354_4323008_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.0	8.1e-09
WP_015571669.1|4323004_4323865_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_022649141.1|4323879_4324758_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003862172.1|4324888_4325386_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.1	9.1e-29
WP_015571667.1|4325475_4326534_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	1.5e-113
WP_017382782.1|4326602_4327103_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_015571666.1|4327234_4329862_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	1.7e-81
WP_000906486.1|4330103_4330289_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 329
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4344594	4349863	4897642		Bacillus_virus(20.0%)	5	NA	NA
WP_015571658.1|4344594_4345797_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	1.4e-27
WP_045911575.1|4346130_4347090_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.1	2.6e-136
WP_045911574.1|4347099_4349244_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.2	1.9e-195
WP_015571656.1|4349216_4349627_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.3	3.0e-17
WP_017382770.1|4349623_4349863_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.9	3.7e-12
>prophage 330
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4354722	4355328	4897642		Canarypox_virus(100.0%)	1	NA	NA
WP_045911570.1|4354722_4355328_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	25.2	3.2e-07
>prophage 331
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4365246	4365922	4897642		Escherichia_phage(100.0%)	2	NA	NA
WP_015571639.1|4365246_4365612_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	64.2	2.0e-33
WP_032654718.1|4365622_4365922_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	60.6	2.3e-27
>prophage 332
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4395755	4396811	4897642		Planktothrix_phage(100.0%)	1	NA	NA
WP_015571586.1|4395755_4396811_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.3	3.0e-21
>prophage 333
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4403528	4406325	4897642		Enterobacteria_phage(50.0%)	2	NA	NA
WP_058686776.1|4403528_4405253_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	31.0	1.8e-15
WP_021530654.1|4405503_4406325_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.3	2.2e-43
>prophage 334
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4411591	4411804	4897642		Vibrio_phage(100.0%)	1	NA	NA
WP_072210223.1|4411591_4411804_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	41.7	3.5e-06
>prophage 335
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4418626	4421007	4897642	integrase	Escherichia_phage(50.0%)	2	4408176:4408189	4422043:4422056
4408176:4408189	attL	AGGTCAGCGTCAGG	NA	NA	NA	NA
WP_058686769.1|4418626_4419868_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.5	1.6e-101
WP_003863115.1|4420524_4421007_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
4422043:4422056	attR	AGGTCAGCGTCAGG	NA	NA	NA	NA
>prophage 336
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4436528	4437599	4897642		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_006811632.1|4436528_4437599_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
>prophage 337
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4444396	4446970	4897642		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017692862.1|4444396_4446970_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	6.9e-128
>prophage 338
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4452495	4454407	4897642		Cyanophage(50.0%)	2	NA	NA
WP_045911880.1|4452495_4452948_+	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	7.8e-35
WP_017383558.1|4453099_4454407_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	3.5e-43
>prophage 339
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4459705	4532611	4897642	tRNA,terminase,tail,holin	Escherichia_phage(20.37%)	80	NA	NA
WP_003860733.1|4459705_4460125_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_017383555.1|4460329_4461415_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860729.1|4461454_4462144_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_003860727.1|4462459_4462843_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_045911879.1|4462895_4464224_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	8.1e-48
WP_017383553.1|4464356_4465094_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_017692868.1|4465078_4466698_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_006176728.1|4467123_4467699_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_015572138.1|4467730_4468381_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_003860717.1|4468380_4469334_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_015572140.1|4469330_4469807_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_022651668.1|4471444_4471729_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_053520758.1|4471775_4472018_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.7	2.1e-34
WP_058686878.1|4472004_4472649_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	47.2	2.7e-41
WP_058686877.1|4472641_4472998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058686880.1|4473032_4474145_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	74.5	6.4e-155
WP_149912317.1|4474156_4477429_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	64.4	0.0e+00
WP_149912318.1|4478187_4478820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149912319.1|4478942_4479185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058686872.1|4479174_4479942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058686871.1|4480073_4480463_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	64.3	1.1e-40
WP_072210252.1|4480561_4480789_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	62.2	1.2e-20
WP_058686870.1|4480791_4481343_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	45.9	2.6e-32
WP_080398158.1|4481487_4482345_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	70.8	5.3e-101
WP_058686868.1|4482341_4483028_+	phage replication protein	NA	G8C7U6	Escherichia_phage	63.9	2.6e-82
WP_059498673.1|4483437_4484127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059498672.1|4484128_4484785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059498671.1|4484789_4485308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059498675.1|4485901_4486129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059498670.1|4486386_4487175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059498669.1|4487431_4488385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059498668.1|4488848_4489073_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	70.1	2.8e-25
WP_059498667.1|4489460_4490063_+	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	86.5	2.3e-98
WP_032620270.1|4490068_4490269_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	69.7	1.9e-22
WP_022651648.1|4490271_4490553_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	100.0	7.2e-47
WP_006811583.1|4490549_4490906_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	94.9	1.0e-61
WP_006811582.1|4490902_4491040_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	73.8	9.8e-10
WP_006811581.1|4491036_4491849_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	70.7	6.8e-106
WP_006811580.1|4491992_4492364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006811579.1|4492870_4493842_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.0	6.5e-71
WP_006811578.1|4494020_4494407_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	77.3	9.2e-45
WP_022651286.1|4494393_4494675_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
WP_023304238.1|4494674_4495304_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	6.0e-102
WP_023314673.1|4495311_4495581_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.3	9.0e-31
WP_006811575.1|4495789_4496014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006811574.1|4496207_4496471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003859853.1|4496675_4496906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023314672.1|4497125_4498115_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	44.0	1.1e-38
WP_045349479.1|4498092_4499400_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.0	1.9e-142
WP_045911871.1|4499401_4500790_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	50.5	1.6e-126
WP_045331452.1|4500791_4501883_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	57.9	6.7e-117
WP_045911870.1|4501969_4502740_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	60.0	2.2e-69
WP_045911869.1|4502752_4503706_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	9.0e-134
WP_045343117.1|4504023_4504506_+	hypothetical protein	NA	A0A2I2L6M9	Escherichia_phage	35.4	4.0e-13
WP_045343118.1|4504507_4504858_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	54.3	3.6e-32
WP_045911868.1|4504859_4505444_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	55.3	3.8e-50
WP_045911867.1|4505440_4505851_+	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	50.0	4.3e-32
WP_045911866.1|4505908_4506580_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	48.4	3.3e-50
WP_022651271.1|4506641_4506953_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	1.8e-35
WP_032654529.1|4506949_4507264_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.0	8.6e-17
WP_045911864.1|4507260_4510173_+|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	34.8	1.8e-132
WP_020690998.1|4510247_4510601_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	98.3	6.0e-59
WP_015570921.1|4510657_4511005_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	63.5	7.5e-38
WP_032654526.1|4511001_4511757_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	76.4	6.3e-114
WP_045911863.1|4511758_4512469_+	peptidase P60	NA	K7PJX1	Enterobacterial_phage	97.0	1.0e-142
WP_015570918.1|4512502_4513132_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.4	1.6e-54
WP_058686851.1|4513184_4516766_+|tail	phage tail protein	tail	Q9MCU0	Escherichia_phage	85.3	0.0e+00
WP_045911861.1|4516767_4517733_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.9	6.3e-58
WP_045911860.1|4517792_4519025_+	hypothetical protein	NA	K7PM99	Enterobacterial_phage	65.4	2.5e-144
WP_006811569.1|4520584_4521007_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.1	3.5e-21
WP_058686849.1|4521776_4523792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006811567.1|4523936_4524869_+	helix-turn-helix domain-containing protein	NA	A0A077SL42	Escherichia_phage	42.3	1.5e-64
WP_003860714.1|4525840_4527646_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_006811565.1|4527661_4528636_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003860711.1|4528859_4529540_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
WP_003860709.1|4529536_4530442_+	GTPase Era	NA	NA	NA	NA	NA
WP_015572142.1|4530459_4531167_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_015572143.1|4531242_4531974_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_015572144.1|4531973_4532354_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003860704.1|4532350_4532611_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	1.4e-17
>prophage 340
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4538813	4549996	4897642		Bacillus_phage(50.0%)	6	NA	NA
WP_032671871.1|4538813_4542701_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	5.9e-131
WP_015572148.1|4543278_4544667_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.8	8.5e-16
WP_015572149.1|4544663_4545416_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_015572150.1|4545412_4546750_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.0	2.0e-09
WP_003860685.1|4546830_4547169_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_003860678.1|4548742_4549996_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
>prophage 341
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4557367	4563674	4897642		Faustovirus(20.0%)	8	NA	NA
WP_003860663.1|4557367_4558582_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
WP_003860661.1|4558606_4558993_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	1.2e-52
WP_003860659.1|4559006_4559330_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	4.5e-21
WP_003860657.1|4559406_4559922_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_032654486.1|4559936_4561787_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.7	5.9e-105
WP_003860652.1|4561788_4562124_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003860650.1|4562125_4562326_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_032671867.1|4562387_4563674_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.7	4.5e-35
>prophage 342
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4576836	4582071	4897642		Escherichia_phage(66.67%)	5	NA	NA
WP_087924344.1|4576836_4579242_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	38.5	8.4e-136
WP_015572168.1|4579238_4579868_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.9	7.9e-62
WP_045911324.1|4579860_4580640_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_045911325.1|4580639_4581515_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_003860625.1|4581639_4582071_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	7.4e-19
>prophage 343
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4590895	4598230	4897642		Acinetobacter_phage(33.33%)	7	NA	NA
WP_015572174.1|4590895_4592437_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.6	3.7e-161
WP_047727265.1|4592498_4593533_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015572176.1|4593583_4593805_+	DUF1407 domain-containing protein	NA	NA	NA	NA	NA
WP_006811517.1|4593801_4594152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023295137.1|4594152_4595172_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_032654466.1|4595230_4596604_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	1.3e-40
WP_003860601.1|4596763_4598230_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	1.0e-88
>prophage 344
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4610346	4610535	4897642		Escherichia_phage(100.0%)	1	NA	NA
WP_022648984.1|4610346_4610535_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	76.7	1.9e-19
>prophage 345
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4616960	4624849	4897642		Prochlorococcus_phage(50.0%)	7	NA	NA
WP_032654434.1|4616960_4617602_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.0	4.5e-28
WP_017383509.1|4617598_4618636_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.8	4.8e-72
WP_023295128.1|4618902_4620333_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_003860560.1|4620549_4621176_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_017692944.1|4621258_4622548_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	4.1e-65
WP_071524135.1|4622629_4623346_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_032669404.1|4623430_4624849_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	33.3	6.0e-41
>prophage 346
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4634579	4635293	4897642		Cyanophage(100.0%)	1	NA	NA
WP_001171626.1|4634579_4635293_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.2	9.1e-38
>prophage 347
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4655675	4658759	4897642		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_045911346.1|4655675_4658759_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	1.3e-162
>prophage 348
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4662455	4663406	4897642		Cyanophage(100.0%)	1	NA	NA
WP_015572217.1|4662455_4663406_-	transaldolase	NA	A0A127KMN5	Cyanophage	34.2	3.7e-10
>prophage 349
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4666950	4678707	4897642		Deep-sea_thermophilic_phage(20.0%)	13	NA	NA
WP_015572219.1|4666950_4667826_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	26.9	1.6e-12
WP_003861292.1|4668038_4668464_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_045911348.1|4668450_4668900_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_045911349.1|4668963_4669539_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_017383480.1|4669631_4670531_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.9	1.5e-24
WP_032649009.1|4670707_4671721_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017383478.1|4671720_4672554_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_003861305.1|4672553_4673429_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_017383477.1|4673418_4674513_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-30
WP_017383476.1|4674631_4675543_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.4	5.5e-56
WP_015572224.1|4675548_4676385_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_003861316.1|4676429_4676939_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_006811455.1|4676979_4678707_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 350
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4682515	4686771	4897642		Ralstonia_phage(50.0%)	4	NA	NA
WP_017383473.1|4682515_4684531_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.1	4.5e-151
WP_003861328.1|4684532_4684748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304176.1|4684744_4685740_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_045911350.1|4685829_4686771_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	8.4e-07
>prophage 351
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4701519	4702251	4897642		Clostridioides_phage(100.0%)	1	NA	NA
WP_015572237.1|4701519_4702251_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.5	1.7e-15
>prophage 352
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4706073	4709732	4897642		Morganella_phage(33.33%)	3	NA	NA
WP_026080619.1|4706073_4706994_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.7	4.9e-76
WP_045910695.1|4707262_4708642_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.0	8.5e-16
WP_015572241.1|4708802_4709732_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	83.6	4.1e-139
>prophage 353
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4718902	4719988	4897642		Pandoravirus(100.0%)	1	NA	NA
WP_015572247.1|4718902_4719988_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.9	1.1e-87
>prophage 354
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4728339	4729476	4897642		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_045910701.1|4728339_4729476_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.3	3.0e-19
>prophage 355
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4735883	4737401	4897642		Mollivirus(100.0%)	1	NA	NA
WP_006811407.1|4735883_4737401_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	4.5e-87
>prophage 356
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4741636	4742410	4897642		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003861426.1|4741636_4742410_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	3.6e-08
>prophage 357
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4747094	4748114	4897642		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017383439.1|4747094_4748114_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.8	3.2e-20
>prophage 358
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4757251	4760504	4897642		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_003861463.1|4757251_4757911_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	26.6	1.7e-06
WP_045910707.1|4757986_4759819_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_003861468.1|4759904_4760504_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	1.5e-06
>prophage 359
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4779515	4780520	4897642		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_015572274.1|4779515_4780520_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.5	4.4e-30
>prophage 360
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4802292	4814051	4897642		Pseudomonas_phage(33.33%)	7	NA	NA
WP_017693020.1|4802292_4803354_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	7.7e-09
WP_003859419.1|4803437_4803692_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	66.7	2.6e-27
WP_026080618.1|4803691_4804822_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	1.7e-176
WP_023295072.1|4804922_4807208_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.3	8.4e-287
WP_006811346.1|4807557_4808286_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_047636909.1|4808432_4811069_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	5.6e-93
WP_017383412.1|4811204_4814051_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	5.8e-43
>prophage 361
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4818219	4826817	4897642		Tupanvirus(40.0%)	7	NA	NA
WP_017693024.1|4818219_4819311_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.7	8.0e-118
WP_015572290.1|4819425_4820481_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_047727283.1|4820553_4821612_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2K9L698	Tupanvirus	48.0	2.8e-19
WP_045910715.1|4821611_4822262_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.7	3.7e-06
WP_017383408.1|4822338_4823982_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.0	8.3e-10
WP_006811337.1|4824122_4825559_+	magnesium transporter	NA	NA	NA	NA	NA
WP_040118313.1|4825521_4826817_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.6	7.1e-81
>prophage 362
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4832120	4833128	4897642		Vibrio_phage(100.0%)	1	NA	NA
WP_017693031.1|4832120_4833128_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	2.2e-82
>prophage 363
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4836223	4839637	4897642		Salmonella_phage(50.0%)	3	NA	NA
WP_017383400.1|4836223_4837423_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.0	7.6e-21
WP_003859372.1|4837699_4838044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045910719.1|4838047_4839637_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.9	3.2e-19
>prophage 364
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4845329	4849638	4897642		Bacillus_phage(50.0%)	4	NA	NA
WP_047727285.1|4845329_4845899_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	36.8	2.3e-12
WP_023295065.1|4846314_4847028_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017383393.1|4847061_4848048_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_045910721.1|4848171_4849638_-	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	29.0	1.2e-39
>prophage 365
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4857523	4858381	4897642		Catovirus(100.0%)	1	NA	NA
WP_045910724.1|4857523_4858381_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.7	1.1e-24
>prophage 366
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4862158	4867296	4897642		Acinetobacter_phage(50.0%)	4	NA	NA
WP_149912323.1|4862158_4864144_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	31.9	2.2e-09
WP_045910726.1|4864411_4865239_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_017383385.1|4865376_4866525_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_015572317.1|4866627_4867296_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	2.4e-56
>prophage 367
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4871023	4872544	4897642		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003859320.1|4871023_4872544_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 368
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4884724	4885279	4897642		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_045910728.1|4884724_4885279_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	35.9	4.0e-17
>prophage 369
NZ_CP043853	Enterobacter hormaechei strain EB_P6_L3_02.19 chromosome, complete genome	4897642	4891842	4897546	4897642		Enterobacteria_phage(75.0%)	7	NA	NA
WP_058686839.1|4891842_4892793_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.5	4.5e-08
WP_017383373.1|4892776_4893514_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017383372.1|4893488_4893602_-	protein YohO	NA	NA	NA	NA	NA
WP_017693055.1|4893671_4894412_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	82.9	1.7e-92
WP_032648895.1|4894630_4896316_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	87.9	2.6e-269
WP_015572336.1|4896309_4897029_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_015572337.1|4897075_4897546_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.4	3.4e-65
>prophage 1
NZ_CP043856	Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence	51628	7929	40033	51628	protease,transposase,integrase	Escherichia_phage(33.33%)	40	28979:28995	44288:44304
WP_032493169.1|7929_8715_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_040115096.1|9401_9740_-	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
WP_040115094.1|10303_11185_-	replication protein	NA	NA	NA	NA	NA
WP_064754415.1|11371_12001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085954994.1|12228_13355_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	1.4e-48
WP_032493174.1|13584_13917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000275218.1|14103_14712_+	recombinase family protein	NA	NA	NA	NA	NA
WP_024562121.1|14708_14894_-	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	57.8	2.6e-05
WP_099156415.1|15177_15465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040115112.1|15489_15714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024562120.1|15824_16175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960955.1|16178_16496_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024562119.1|16595_17378_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_015060076.1|17337_17616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015060075.1|17624_17921_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_000462629.1|17960_18278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115085.1|18278_20852_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_014014949.1|20867_21569_+	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_000858958.1|21578_21821_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_014014948.1|21837_22875_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_032493177.1|22951_23083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208352.1|23093_23789_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000758230.1|23799_24687_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000101920.1|24686_25820_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_001076634.1|25870_26872_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_000715148.1|26868_27396_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.7	1.1e-24
WP_149912353.1|27904_28912_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
28979:28995	attL	AAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001138073.1|28990_31963_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|31965_32523_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_122146091.1|32560_32851_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067855.1|33106_33811_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_003159548.1|34814_35555_+	subclass B1 metallo-beta-lactamase IMP-1	NA	NA	NA	NA	NA
WP_003159191.1|35694_36249_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000679427.1|36417_36765_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|36758_37598_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|37527_37707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|37725_38226_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|38531_38645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134872537.1|38746_39496_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	64.4	4.4e-83
WP_149912354.1|39520_40033_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	65.6	4.7e-12
44288:44304	attR	CTTAGCGTGCTTTATTT	NA	NA	NA	NA
>prophage 1
NZ_CP043854	Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence	166898	92790	101658	166898	integrase	Macacine_betaherpesvirus(42.86%)	7	90403:90416	96572:96585
90403:90416	attL	CCTGCACCGCATTG	NA	NA	NA	NA
WP_047366186.1|92790_93534_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	1.2e-51
WP_045334592.1|94225_95236_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.2	6.3e-85
WP_045334590.1|95975_97142_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.1	1.2e-217
96572:96585	attR	CCTGCACCGCATTG	NA	NA	NA	NA
WP_045334588.1|97141_98104_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	77.3	7.5e-136
WP_045334587.1|98752_100024_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	3.4e-152
WP_032663686.1|100023_100455_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	7.9e-29
WP_080338034.1|100686_101658_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	47.4	4.8e-74
>prophage 1
NZ_CP043855	Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed2, complete sequence	270269	184299	236228	270269	protease,integrase,transposase	Salmonella_phage(27.27%)	57	181526:181541	235910:235925
181526:181541	attL	CGCACCACCATCATGA	NA	NA	NA	NA
WP_000795949.1|184299_185475_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|185644_185857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|186217_187300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284318.1|187465_188965_-	kinase	NA	NA	NA	NA	NA
WP_000081060.1|188990_190628_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|190627_191668_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|191752_192391_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|192390_193032_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|193054_193693_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|194155_194623_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|194640_195849_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011152965.1|195859_196816_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_148735718.1|196815_197895_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	3.6e-38
WP_001040058.1|197896_198670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|198662_199805_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|199814_200873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254137.1|201193_201775_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|201774_202932_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|202954_203410_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|203432_204473_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|204521_205100_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|205168_205744_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|206172_207414_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000374058.1|207504_207960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|208200_208392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|208483_208825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|209811_210066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065644.1|211807_214774_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|214932_215223_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|215219_215621_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|215610_215967_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|216221_216548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|216544_217045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021243030.1|217041_217413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|217406_217964_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_000427623.1|218042_219047_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000211823.1|220985_221972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|222892_223285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695443.1|223263_223575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|223943_224600_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_123906519.1|224639_224822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|224802_225300_+	membrane protein	NA	NA	NA	NA	NA
WP_000083579.1|225304_226693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|227093_227387_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|227391_228717_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|228777_228984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|229084_229495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001641519.1|229507_230323_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.2	2.5e-15
WP_000278471.1|230575_231001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|231549_231858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|231873_232731_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001194554.1|232792_232996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287391.1|233337_233742_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|233919_234213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|234238_234475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|234515_234971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|235247_236228_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
235910:235925	attR	TCATGATGGTGGTGCG	NA	NA	NA	NA
