The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043820	Achromobacter xylosoxidans strain AX1 chromosome, complete genome	6402982	1886920	1898149	6402982	tail	Burkholderia_phage(55.56%)	14	NA	NA
WP_024068262.1|1886920_1887370_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	36.5	1.1e-17
WP_049072536.1|1887366_1887555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149894936.1|1887547_1889221_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_054518401.1|1889213_1889813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006388474.1|1889822_1890122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149894937.1|1890141_1891152_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	52.2	1.1e-76
WP_054472039.1|1891186_1891930_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	63.1	1.3e-82
WP_020924456.1|1891938_1892292_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	66.7	6.1e-35
WP_149894938.1|1892288_1893470_+	hypothetical protein	NA	A9YX12	Burkholderia_phage	62.6	7.5e-130
WP_149894939.1|1893471_1894137_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	60.2	1.6e-73
WP_149894940.1|1894151_1895099_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	52.9	1.7e-15
WP_076468321.1|1895605_1895956_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_102964841.1|1897188_1897629_+	hypothetical protein	NA	A0A0A7DJS9	Pseudomonas_phage	37.7	2.0e-11
WP_149894941.1|1897618_1898149_+	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	56.8	1.5e-42
>prophage 2
NZ_CP043820	Achromobacter xylosoxidans strain AX1 chromosome, complete genome	6402982	2776048	2783983	6402982	tRNA	Moraxella_phage(33.33%)	9	NA	NA
WP_006388149.1|2776048_2776636_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.8	1.2e-19
WP_006388150.1|2776669_2777044_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	27.8	1.9e-10
WP_006388151.1|2777241_2778264_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006388152.1|2778642_2778999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006388153.1|2779083_2780376_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	5.4e-65
WP_006388154.1|2780484_2781516_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.6	1.4e-92
WP_006388155.1|2781585_2782227_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_149895043.1|2782415_2783174_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	6.8e-68
WP_085941785.1|2783293_2783983_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.2	2.1e-31
>prophage 3
NZ_CP043820	Achromobacter xylosoxidans strain AX1 chromosome, complete genome	6402982	5794382	5835011	6402982	integrase,tail	Burkholderia_virus(33.33%)	42	5794194:5794248	5812965:5813019
5794194:5794248	attL	GACTCAAAATCCCCCGCCGCAAGGCGTGCCGGTTCGATTCCGGCCCCGGGCACCA	NA	NA	NA	NA
WP_149895546.1|5794382_5795510_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.3	6.9e-48
WP_108914010.1|5795841_5796198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149895547.1|5796370_5797327_-	DUF2332 family protein	NA	NA	NA	NA	NA
WP_063639474.1|5797545_5799477_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_088589721.1|5799779_5801198_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_029580638.1|5801354_5801801_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_149895548.1|5802092_5802782_-	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	48.9	7.1e-56
WP_149895549.1|5803206_5803476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149895550.1|5803472_5804483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042997010.1|5804479_5805019_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_149895551.1|5805015_5806011_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_033451588.1|5806015_5806294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149895552.1|5806551_5807277_+	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_149895553.1|5807287_5807734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149895554.1|5807730_5807991_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_149895555.1|5807992_5809045_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_149895556.1|5809697_5809931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149895557.1|5810225_5811749_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_149895558.1|5811809_5812631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149895559.1|5813299_5813623_-	BcpO-related WXXGXW repeat protein	NA	NA	NA	NA	NA
5812965:5813019	attR	GACTCAAAATCCCCCGCCGCAAGGCGTGCCGGTTCGATTCCGGCCCCGGGCACCA	NA	NA	NA	NA
WP_006385707.1|5813914_5814931_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.0	5.0e-66
WP_006385706.1|5815130_5815412_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_006385705.1|5815760_5816696_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_054516402.1|5816748_5817948_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006385703.1|5817978_5818797_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	49.3	1.4e-10
WP_053497395.1|5818815_5819745_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026382513.1|5819886_5820483_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	53.5	3.3e-49
WP_149895560.1|5820479_5820716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006385699.1|5820696_5821062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149895703.1|5821066_5824570_-	DUF1983 domain-containing protein	NA	A4JX16	Burkholderia_virus	45.2	1.9e-261
WP_006385697.1|5824695_5825301_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	55.7	1.0e-50
WP_054442583.1|5825297_5826077_-	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	46.9	9.5e-65
WP_047991976.1|5826079_5826808_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	57.9	2.4e-70
WP_149895561.1|5826810_5828772_-|tail	tail fiber domain-containing protein	tail	A0A0K0KVF1	Prochlorococcus_phage	36.2	8.7e-14
WP_035182017.1|5828768_5829107_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	38.4	8.1e-21
WP_054499930.1|5829109_5830396_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	30.3	2.2e-13
WP_054439099.1|5830453_5830744_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	48.2	2.7e-12
WP_054497360.1|5830743_5831217_-|tail	phage tail protein	tail	A4JX08	Burkholderia_virus	44.4	1.8e-26
WP_006385689.1|5831222_5831690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049055147.1|5831939_5832581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149895562.1|5832805_5833501_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_149895563.1|5833553_5835011_-	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	35.8	3.6e-65
