The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043761	Paenibacillus sp. 37 chromosome, complete genome	7075616	317308	356866	7075616	holin,capsid,integrase,terminase	Paenibacillus_phage(34.29%)	46	317169:317213	354565:354609
317169:317213	attL	AGCCTTCCAAGCTAATAGCGTGGGTTCGATTCCCATCACCCGCTT	NA	NA	NA	NA
WP_105597948.1|317308_318514_-|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	37.3	2.2e-68
WP_105597949.1|318644_319118_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	51.7	9.6e-36
WP_105597950.1|319122_319710_-	helix-turn-helix transcriptional regulator	NA	A0A0C5AC96	Paenibacillus_phage	43.0	4.4e-30
WP_105597951.1|319976_320171_+	helix-turn-helix transcriptional regulator	NA	A0A0C5AJQ3	Paenibacillus_phage	65.1	2.9e-15
WP_105597952.1|320245_320524_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105597953.1|320714_320906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105597954.1|320947_321853_+	hypothetical protein	NA	A0A1S7FYZ0	Listeria_phage	59.3	7.9e-95
WP_105597955.1|321852_322104_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	56.0	2.6e-16
WP_105597956.1|322126_322570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105597957.1|322566_323766_+	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	52.1	1.3e-105
WP_105598445.1|323851_324451_+	DUF2815 family protein	NA	A0A2I7QIM8	Bacillus_phage	63.8	3.2e-60
WP_105597958.1|324852_326802_+	hypothetical protein	NA	S5M5X4	Brevibacillus_phage	54.4	6.5e-195
WP_105597959.1|327241_329587_+	virulence protein E	NA	S5M5Y2	Brevibacillus_phage	56.8	1.3e-263
WP_105597960.1|329849_330131_+	VRR-NUC domain-containing protein	NA	S5MUC8	Brevibacillus_phage	51.7	5.9e-17
WP_105597961.1|330127_331498_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	64.6	1.2e-171
WP_105597962.1|331498_331963_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	30.8	1.5e-09
WP_105597963.1|332041_332380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105597964.1|332516_332771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105597965.1|332899_333697_+|terminase	terminase small subunit	terminase	A0A0A7RTY1	Clostridium_phage	41.0	3.6e-43
WP_105598446.1|333704_335024_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1J1J8Z1	Escherichia_phage	36.0	2.7e-72
WP_105597966.1|335026_336529_+|capsid	capsid protein	capsid	M9Q246	Clostridium_phage	60.0	4.9e-166
WP_105597967.1|336525_337641_+|capsid	capsid protein	capsid	M9Q2F2	Clostridium_phage	50.9	5.0e-75
WP_105597968.1|337747_338338_+	hypothetical protein	NA	A0A0K2CP96	Brevibacillus_phage	41.6	9.2e-28
WP_091014791.1|338355_339309_+|capsid	phage capsid protein	capsid	A0A1J0MCK3	Streptomyces_phage	58.7	2.9e-92
WP_105597969.1|339321_339591_+	hypothetical protein	NA	G9FH87	Rhodococcus_phage	45.0	1.0e-05
WP_146117071.1|339780_339873_+	GlyGly-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_091014785.1|339963_340290_+	hypothetical protein	NA	M9Q2I3	Clostridium_phage	55.8	3.9e-28
WP_105597971.1|340289_340679_+	hypothetical protein	NA	M9Q249	Clostridium_phage	48.4	4.3e-26
WP_076328814.1|340675_341065_+	hypothetical protein	NA	M9Q2F6	Clostridium_phage	58.9	1.2e-36
WP_105597972.1|341074_341527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105597973.1|341551_341863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105597974.1|341819_342197_+	hypothetical protein	NA	M9Q2I4	Clostridium_phage	51.6	2.2e-30
WP_105597975.1|342197_345218_+	hypothetical protein	NA	A0A2H4J4V9	uncultured_Caudovirales_phage	42.2	6.8e-50
WP_105597976.1|345230_345590_+	hypothetical protein	NA	R9TNE7	Paenibacillus_phage	52.9	4.1e-31
WP_105597977.1|345594_347655_+	polymer-forming cytoskeletal protein	NA	R9TMD0	Paenibacillus_phage	65.9	2.9e-201
WP_105597978.1|347696_348278_+	copper amine oxidase	NA	R9TPZ8	Paenibacillus_phage	38.0	3.6e-16
WP_105597979.1|348304_348586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105597980.1|348729_348936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105597981.1|348901_350857_+	hypothetical protein	NA	R9TQH9	Paenibacillus_phage	60.0	9.6e-05
WP_105597982.1|350869_351163_+	hypothetical protein	NA	A0A2R2ZGK0	Clostridioides_phage	51.5	2.3e-19
WP_105597983.1|351402_351831_+|holin	phage holin family protein	holin	D0R7H7	Paenibacillus_phage	64.4	2.8e-42
WP_105597984.1|351823_352552_+	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	44.5	1.3e-39
WP_105597985.1|352812_353211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105598447.1|353346_353748_-	hypothetical protein	NA	A0A0C5ABG6	Paenibacillus_phage	63.6	1.8e-43
WP_105597986.1|354055_354271_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0C5AED5	Paenibacillus_phage	71.8	7.9e-22
WP_105602502.1|355000_356866_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	H8ZJ31	Ostreococcus_tauri_virus	20.8	2.3e-08
354565:354609	attR	AGCCTTCCAAGCTAATAGCGTGGGTTCGATTCCCATCACCCGCTT	NA	NA	NA	NA
>prophage 2
NZ_CP043761	Paenibacillus sp. 37 chromosome, complete genome	7075616	840490	852120	7075616		Mollivirus(25.0%)	10	NA	NA
WP_105602019.1|840490_841789_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.0	2.4e-20
WP_105602021.1|842167_843040_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.2	4.5e-39
WP_017690695.1|843594_843840_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	39.0	9.7e-08
WP_036606071.1|843844_844534_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_105602022.1|844511_846755_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.3	6.6e-167
WP_105602024.1|846739_848218_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	6.0e-52
WP_105602185.1|848227_848665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105602187.1|848794_849835_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	6.1e-67
WP_105602025.1|849834_850452_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.4	3.8e-24
WP_105602027.1|850572_852120_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.0	1.3e-73
>prophage 3
NZ_CP043761	Paenibacillus sp. 37 chromosome, complete genome	7075616	1264761	1275550	7075616		Bacillus_phage(28.57%)	10	NA	NA
WP_149846352.1|1264761_1266594_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.1	3.0e-61
WP_149846353.1|1266586_1268371_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.1	6.2e-51
WP_149846354.1|1268473_1268908_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149846889.1|1269231_1270086_+	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	33.0	5.8e-31
WP_105600885.1|1270180_1270666_+	NADAR family protein	NA	A0A0S0N9W6	Pseudomonas_phage	51.3	1.8e-37
WP_105600884.1|1270658_1271651_+	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	45.3	1.4e-57
WP_149846355.1|1271892_1272315_+	macro domain-containing protein	NA	Q5ULS8	Lactobacillus_virus	42.1	5.4e-22
WP_149846356.1|1272449_1273397_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_105600879.1|1273457_1274474_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_105600877.1|1274476_1275550_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.5	5.1e-16
>prophage 4
NZ_CP043761	Paenibacillus sp. 37 chromosome, complete genome	7075616	1412091	1466314	7075616	tRNA,holin,portal,tail,plate	Bacillus_phage(24.14%)	61	NA	NA
WP_105600759.1|1412091_1412580_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_036668794.1|1413000_1414275_-	MFS transporter	NA	NA	NA	NA	NA
WP_105600758.1|1414528_1414741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105600756.1|1415105_1415597_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.6	1.7e-51
WP_105600754.1|1415746_1416520_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	43.9	4.7e-56
WP_100530025.1|1416512_1417004_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	68.0	1.1e-55
WP_105601091.1|1417000_1417678_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	53.7	1.1e-61
WP_105600752.1|1418056_1418761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105600751.1|1418779_1419235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017690195.1|1419940_1420645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105600749.1|1420742_1421768_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_017690193.1|1421825_1422497_-	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_149846891.1|1422989_1424879_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_091015523.1|1425246_1427031_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_105600748.1|1427631_1429431_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017690190.1|1429602_1430019_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	38.9	7.9e-18
WP_105600746.1|1430061_1430505_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	41.1	1.3e-18
WP_017690187.1|1431261_1431744_+	ArpU family transcriptional regulator	NA	A0A0C5AN03	Paenibacillus_phage	64.4	2.0e-44
WP_105600744.1|1431844_1433512_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_091015515.1|1433530_1434265_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036611439.1|1434452_1435028_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_105601089.1|1435075_1435534_+	VOC family protein	NA	NA	NA	NA	NA
WP_105600743.1|1435530_1436166_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_105600741.1|1436287_1437247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_091015510.1|1437342_1437825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105600739.1|1438169_1440020_+	DUF4127 family protein	NA	NA	NA	NA	NA
WP_105600738.1|1440024_1440375_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_149846358.1|1440836_1441730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105600734.1|1441980_1442181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105600733.1|1442180_1443644_+|tail	phage tail sheath protein	tail	A0A0N7AEC6	Bacillus_phage	35.9	6.6e-75
WP_105600731.1|1443795_1444203_+|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	57.3	2.1e-39
WP_017690174.1|1444377_1444812_+	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	41.3	4.7e-21
WP_105600729.1|1444994_1446734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105601088.1|1446790_1447423_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACF7	Bacillus_phage	47.2	2.0e-36
WP_105600728.1|1447419_1448409_+|portal	phage portal protein	portal	A0A0N6W8H4	Bacillus_phage	47.0	3.9e-79
WP_105600726.1|1448401_1448812_+	hypothetical protein	NA	A0A0N7ACD3	Bacillus_phage	32.3	1.1e-08
WP_105600724.1|1448804_1449260_+	DUF2634 domain-containing protein	NA	A0A0N7ACH4	Bacillus_phage	41.1	4.9e-21
WP_105600722.1|1449264_1450404_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	36.4	1.6e-44
WP_105600721.1|1450616_1451207_+	YmfQ family protein	NA	A0A0A8WI80	Clostridium_phage	32.0	7.1e-20
WP_105600719.1|1451206_1452121_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	34.2	4.0e-06
WP_105600717.1|1452143_1452731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149846359.1|1452797_1452980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146117094.1|1453062_1453326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105600714.1|1453453_1453663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105600713.1|1453662_1454979_+|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	51.6	4.0e-124
WP_017690162.1|1454980_1455439_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	65.6	1.4e-52
WP_105600712.1|1455609_1456032_+|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	40.4	7.5e-24
WP_105600710.1|1456233_1458327_+	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	29.6	3.3e-72
WP_074093888.1|1458327_1459023_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CNM3	Brevibacillus_phage	46.9	2.0e-50
WP_105600709.1|1459036_1460047_+	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	52.2	5.5e-97
WP_105600707.1|1460053_1460311_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	50.0	2.1e-13
WP_105600706.1|1460307_1460721_+	DUF2634 domain-containing protein	NA	A0A0K2CP95	Brevibacillus_phage	44.4	4.2e-19
WP_105600704.1|1460713_1461772_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	49.0	2.8e-83
WP_105600702.1|1461768_1462314_+	DUF2313 domain-containing protein	NA	A0A0A7RUW8	Clostridium_phage	31.3	2.5e-19
WP_105600700.1|1462314_1462953_+	hypothetical protein	NA	A0A060AKT8	Staphylococcus_phage	49.0	1.1e-05
WP_105600699.1|1462953_1463565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149846360.1|1463564_1464122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105597642.1|1464420_1464663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105597643.1|1464779_1465058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105597644.1|1465291_1465498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105597645.1|1465816_1466314_+|holin	phage holin family protein	holin	D0R7H7	Paenibacillus_phage	67.4	5.7e-47
>prophage 5
NZ_CP043761	Paenibacillus sp. 37 chromosome, complete genome	7075616	4569581	4580154	7075616	holin	Staphylococcus_phage(44.44%)	12	NA	NA
WP_105599495.1|4569581_4570349_-	hypothetical protein	NA	A0A1P8CWN6	Bacillus_phage	38.6	2.9e-26
WP_036607828.1|4570345_4570771_-|holin	phage holin family protein	holin	A0A1U9WQR6	Geobacillus_phage	49.3	5.4e-30
WP_105599496.1|4570933_4571416_-	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_105599498.1|4571563_4572295_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_105599500.1|4572483_4573140_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.0	2.1e-12
WP_076328266.1|4573108_4573909_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.1	5.4e-07
WP_017687651.1|4574013_4574481_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	56.3	4.7e-43
WP_076318983.1|4574583_4575816_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.7	4.0e-118
WP_105599501.1|4575848_4576517_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.2	9.4e-37
WP_091018283.1|4576539_4577637_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.1	9.6e-63
WP_105599503.1|4578301_4579627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017687646.1|4579722_4580154_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	43.9	2.1e-21
>prophage 6
NZ_CP043761	Paenibacillus sp. 37 chromosome, complete genome	7075616	5537308	5548241	7075616	tRNA	Emiliania_huxleyi_virus(16.67%)	8	NA	NA
WP_105601827.1|5537308_5538577_-	tetratricopeptide repeat protein	NA	V5LQX0	Emiliania_huxleyi_virus	87.5	2.8e-05
WP_091020461.1|5539209_5539656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105601829.1|5539760_5540267_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	37.6	1.1e-18
WP_091020464.1|5540776_5541238_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_105601831.1|5541250_5543428_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	43.0	1.7e-10
WP_091020470.1|5543802_5545119_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.9	1.1e-65
WP_091020472.1|5545279_5545795_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.2	1.2e-28
WP_105601832.1|5545832_5548241_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.4	2.8e-83
>prophage 7
NZ_CP043761	Paenibacillus sp. 37 chromosome, complete genome	7075616	5685151	5690495	7075616		Catovirus(66.67%)	6	NA	NA
WP_091020904.1|5685151_5685868_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	30.1	1.4e-06
WP_091020903.1|5685964_5686681_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.4	1.1e-06
WP_105601192.1|5686677_5687619_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1D7XFE8	Escherichia_phage	24.4	1.9e-11
WP_036605842.1|5687600_5688428_-	SDR family oxidoreductase	NA	A0A1V0SAG7	Catovirus	34.9	7.6e-28
WP_017692517.1|5688424_5689411_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI8	Catovirus	33.1	3.9e-39
WP_105601373.1|5689403_5690495_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	45.5	5.7e-92
