The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043773	Salmonella enterica strain QH chromosome, complete genome	4835467	1136814	1201228	4835467	transposase,head,integrase,tRNA,lysis,tail,plate,portal,capsid,terminase	Salmonella_phage(93.48%)	61	1138202:1138250	1172236:1172284
WP_110161805.1|1136814_1137983_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.1	4.2e-165
1138202:1138250	attL	TATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000360326.1|1138369_1139032_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_000218402.1|1139584_1140601_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000932273.1|1140603_1141236_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|1141357_1141600_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460848.1|1141633_1142143_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000956190.1|1142150_1142351_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000963474.1|1142314_1142656_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_001244219.1|1142723_1142957_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000752613.1|1142956_1143184_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104187.1|1143180_1144038_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000017507.1|1144034_1146449_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_001154433.1|1146601_1146790_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217575.1|1146800_1147034_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001673609.1|1147147_1147825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284991.1|1148138_1149803_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001542203.1|1149906_1150947_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|1150946_1152713_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|1152855_1153689_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730759.1|1153705_1154767_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000059173.1|1154770_1155421_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673537.1|1155514_1155979_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000868184.1|1155978_1156182_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1156185_1156401_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069923.1|1156381_1156897_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000196199.1|1156893_1157322_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_072100776.1|1157251_1157455_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	92.5	8.3e-29
WP_001039958.1|1157417_1157849_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|1157841_1158288_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|1158289_1159141_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1159218_1159797_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1159793_1160153_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1160139_1161048_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086804.1|1161040_1161646_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_001274649.1|1161642_1163496_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_000143187.1|1163495_1164071_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1164940_1165165_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046108.1|1165267_1166440_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_001207651.1|1166449_1166965_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280963.1|1167019_1167322_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_000763316.1|1167336_1167456_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001677191.1|1167448_1170256_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	0.0e+00
WP_000980411.1|1170252_1170738_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001102269.1|1170734_1171835_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1171903_1172122_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_072102794.1|1172673_1173837_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1172236:1172284	attR	TATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196135.1|1173844_1176025_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533855.1|1176021_1177431_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001518569.1|1189584_1190067_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1190216_1190693_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1190682_1190973_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1191138_1191477_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1191625_1193287_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059160.1|1193372_1194251_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1194374_1194965_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_127172650.1|1195723_1197010_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1197029_1197821_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460054.1|1197986_1199348_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1199600_1199849_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043267.1|1199867_1200416_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469813.1|1200460_1201228_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP043773	Salmonella enterica strain QH chromosome, complete genome	4835467	1705866	1715035	4835467	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569173.1|1705866_1706814_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824848.1|1706797_1707529_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1707509_1707617_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1707676_1708408_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272854.1|1708630_1710316_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	8.1e-279
WP_000598637.1|1710312_1711032_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1711078_1711546_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000703137.1|1712302_1712761_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195341.1|1713001_1715035_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP043773	Salmonella enterica strain QH chromosome, complete genome	4835467	1884404	1891653	4835467		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1884404_1884824_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_149826942.1|1884826_1886095_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.7	1.5e-224
WP_000208509.1|1886549_1886762_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1886772_1886961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080669.1|1887219_1888413_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.0	1.5e-109
WP_000107439.1|1889062_1889374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377046.1|1889453_1890149_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.6	4.3e-08
WP_001157303.1|1890222_1891653_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 4
NZ_CP043773	Salmonella enterica strain QH chromosome, complete genome	4835467	2794503	2996771	4835467	transposase,integrase,tRNA,protease,portal,tail,holin,terminase	Salmonella_phage(25.22%)	204	2867138:2867156	3003421:3003439
WP_077905920.1|2794503_2794827_-	hypothetical protein	NA	E5G6P3	Salmonella_phage	66.7	3.2e-06
WP_001123044.1|2795041_2795917_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
WP_000938189.1|2796138_2796819_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	66.4	1.3e-73
WP_024142146.1|2797204_2797471_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	86.4	1.7e-37
WP_024138909.1|2797486_2797678_-	DUF2767 family protein	NA	A0A0M4R5C3	Salmonella_phage	97.7	5.8e-16
WP_001530989.1|2797786_2798221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046595041.1|2798576_2799170_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	8.2e-93
WP_010835745.1|2799159_2799984_-	Gifsy-1 prophage protein	NA	A0A0M4QWS3	Salmonella_phage	94.9	9.8e-153
WP_046595042.1|2799980_2801690_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	65.6	7.6e-91
WP_000729406.1|2801686_2802313_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_149827020.1|2802296_2803523_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	5.4e-147
WP_001261467.1|2803519_2803852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026342.1|2803848_2804565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010835743.1|2804561_2805605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000061271.1|2805604_2805880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000011138.1|2805876_2806593_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.5	1.3e-28
WP_046595047.1|2806592_2808647_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	35.8	2.9e-20
WP_046595050.1|2808770_2809358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133547.1|2809357_2809795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018953.1|2809798_2811193_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.0	9.3e-71
WP_010835739.1|2811198_2812137_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.5	1.9e-51
WP_046595124.1|2812120_2812531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046595054.1|2812548_2812974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001643824.1|2812986_2813472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110972.1|2813536_2814568_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.5	1.5e-73
WP_046595057.1|2814585_2815458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046595059.1|2815478_2817053_-	NUDIX domain-containing protein	NA	Q6UJ14	Burkholderia_virus	48.6	2.9e-20
WP_046595062.1|2817053_2817929_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	44.3	2.9e-54
WP_001648831.1|2817900_2819340_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	38.0	9.9e-92
WP_046595063.1|2819339_2820611_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.6	1.0e-84
WP_046595066.1|2820600_2821572_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	32.8	4.6e-24
WP_046595068.1|2821670_2821991_-	negative regulator GrlR	NA	NA	NA	NA	NA
WP_046595070.1|2822131_2822662_-	DUF2514 family protein	NA	A0A291AXG6	Shigella_phage	29.1	1.2e-07
WP_046595071.1|2822664_2823081_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	57.3	7.9e-42
WP_050186221.1|2823083_2823431_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.7	1.3e-53
WP_046595075.1|2823870_2824449_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	51.4	1.2e-43
WP_045441384.1|2824445_2824739_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	64.2	3.6e-33
WP_045441382.1|2824735_2825332_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	74.7	1.7e-82
WP_046595078.1|2825399_2825591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046595080.1|2825976_2827200_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_046595081.1|2827219_2827750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046595082.1|2827793_2828045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046598784.1|2828048_2828729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001648813.1|2828767_2830156_-	replication protein P	NA	Q8HA30	Enterobacteria_phage	47.5	1.2e-107
WP_046595084.1|2830152_2831136_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	79.6	1.2e-43
WP_001648809.1|2831138_2831363_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	46.1	4.7e-09
WP_000429172.1|2831385_2831832_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.1	1.9e-25
WP_072053482.1|2831766_2831970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000364674.1|2831896_2832130_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
WP_024136813.1|2832238_2832694_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	1.7e-34
WP_046595087.1|2833380_2833704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042827223.1|2833711_2833957_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	4.5e-13
WP_042827221.1|2833986_2836227_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.8	1.8e-108
WP_046595089.1|2836223_2836778_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	58.2	4.9e-47
WP_000916251.1|2836780_2836963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024131616.1|2837012_2837210_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.5	8.3e-10
WP_000196401.1|2837175_2837400_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_046595090.1|2837400_2838420_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.2	2.0e-91
WP_000374046.1|2839007_2839667_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2839753_2840083_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2840079_2840361_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2840409_2841189_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2841214_2841763_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140474.1|2841977_2843189_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2843246_2843564_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2843608_2844025_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2844195_2844858_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2844952_2845411_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420529.1|2845446_2847501_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_001261222.1|2847624_2848071_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950883.1|2848089_2850243_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202378.1|2850229_2850838_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288731.1|2851054_2851564_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001539650.1|2851920_2852973_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2853044_2853497_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156451.1|2853682_2855443_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2855511_2856030_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2856129_2856297_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2856552_2857116_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433417.1|2857112_2858753_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_149827022.1|2858757_2860011_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2860025_2861933_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086477.1|2861945_2864054_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224080.1|2864152_2865262_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2865258_2865801_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2865966_2866977_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
2867138:2867156	attL	GCGCTAACGCTTACCGGGC	NA	NA	NA	NA
WP_000193762.1|2867184_2869797_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	6.3e-20
WP_000497441.1|2870223_2870415_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2870684_2871371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2871355_2871655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334548.1|2871723_2872350_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_012664643.1|2872997_2873876_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.0	1.2e-172
WP_000143167.1|2874440_2875022_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144684.1|2875021_2877229_-|tail	tail protein	tail	E5G6P0	Salmonella_phage	51.5	6.2e-77
WP_000178849.1|2877282_2877525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139133709.1|2877563_2879132_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	63.9	7.2e-128
WP_041030834.1|2880984_2881689_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	3.2e-67
WP_000606351.1|2881586_2882324_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2882333_2883029_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2883118_2883652_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2883768_2884266_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|2884364_2884697_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_010989010.1|2884693_2887681_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2887760_2888090_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2888086_2888485_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2888530_2889280_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196703.1|2889291_2889693_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453192.1|2889689_2890256_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000774239.1|2890236_2890536_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107905.1|2890528_2890852_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	60.4	6.6e-28
WP_077906341.1|2890942_2893024_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	3.1e-264
WP_077906340.1|2892947_2894465_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.9	7.5e-175
WP_000196190.1|2894491_2894698_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989240.1|2894694_2896833_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.5	2.2e-289
WP_000371784.1|2896789_2897323_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_110161804.1|2897619_2897808_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	66.7	2.9e-12
WP_000984586.1|2898027_2898480_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_077905918.1|2898463_2898793_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.2e-55
WP_001539630.1|2899068_2899755_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.1	1.8e-131
WP_000798706.1|2900115_2900565_+	lipoprotein	NA	NA	NA	NA	NA
WP_024131667.1|2900729_2900939_-	hypothetical protein	NA	H6WRZ2	Salmonella_phage	98.1	3.5e-22
WP_001047630.1|2901110_2901908_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|2901897_2902044_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096557.1|2902040_2902652_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	96.1	3.6e-91
WP_001241019.1|2902654_2902861_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929798.1|2902860_2903463_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	1.7e-109
WP_014343878.1|2903497_2903746_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2903862_2904096_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_001220149.1|2904251_2904518_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	98.9	1.3e-45
WP_000664367.1|2904616_2905414_-	hypothetical protein	NA	A0A1R3Y5Q8	Salmonella_virus	81.9	1.7e-32
WP_000801767.1|2905427_2906123_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.9	1.5e-56
WP_000024045.1|2906119_2906947_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	8.3e-51
WP_015702794.1|2907038_2907413_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
WP_000145711.1|2907378_2907606_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_001151473.1|2907619_2908087_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	83.9	3.0e-66
WP_001170496.1|2908237_2908711_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	59.1	2.3e-53
WP_000997167.1|2908707_2909640_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	53.2	9.6e-88
WP_000373338.1|2909672_2909879_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000017137.1|2910948_2913876_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.8	0.0e+00
WP_001539618.1|2913838_2914996_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2915038_2915278_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2915318_2915567_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262312.1|2915611_2916904_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	8.5e-252
WP_000191404.1|2917098_2918301_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893204.1|2918378_2919815_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544852.1|2920060_2921275_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2921592_2922054_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117871.1|2922254_2923655_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.9	1.7e-80
WP_000977709.1|2924261_2925353_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_149827024.1|2925537_2926728_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001109471.1|2926789_2927437_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357053.1|2927464_2928013_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925873.1|2928272_2930120_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001539612.1|2930464_2934931_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|2934930_2935635_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_149827026.1|2935615_2936938_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154028.1|2936930_2937734_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899553.1|2937869_2938646_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436889.1|2938625_2939519_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011576.1|2939729_2940476_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350061.1|2940472_2940655_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056908.1|2940706_2941939_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000561679.1|2941982_2942960_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551246.1|2942956_2944705_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
WP_086011253.1|2947183_2948439_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_000167332.1|2948551_2948836_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
WP_000140324.1|2948991_2950665_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125007.1|2950778_2951462_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_149827028.1|2951634_2952396_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000445191.1|2952538_2953822_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000079591.1|2953887_2954976_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	2.1e-78
WP_000642866.1|2955161_2955854_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_023234775.1|2955990_2957751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000642539.1|2958155_2959013_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292804.1|2959072_2961355_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.4e-161
WP_001145563.1|2961430_2962390_-	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
WP_077905879.1|2962577_2962847_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_012539861.1|2962938_2963763_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
WP_001134270.1|2964055_2965477_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109274.1|2965694_2966843_-	MFS transporter	NA	NA	NA	NA	NA
WP_000534681.1|2967192_2968056_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213069.1|2968057_2968675_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
WP_149827031.1|2968685_2971130_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	5.4e-223
WP_000887397.1|2971366_2972659_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.2	5.0e-95
WP_000067792.1|2972917_2974261_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
WP_024131664.1|2974270_2974882_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_149827033.1|2975024_2979101_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
WP_000228469.1|2979235_2979730_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537400.1|2980276_2981245_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.2	2.5e-62
WP_023260425.1|2981358_2983125_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	7.8e-22
WP_001202248.1|2983125_2984847_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.3	6.4e-13
WP_001241650.1|2984891_2985596_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001539595.1|2985596_2985980_+	membrane protein	NA	NA	NA	NA	NA
WP_001040187.1|2985907_2986126_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597928.1|2986216_2987128_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809969.1|2987236_2988097_+	pirin family protein	NA	NA	NA	NA	NA
WP_000097893.1|2988116_2988794_+	hydrolase	NA	NA	NA	NA	NA
WP_001539594.1|2989458_2989836_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2989997_2990195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2990407_2992684_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2992714_2993035_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2993358_2993580_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125882.1|2993709_2995656_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	1.6e-39
WP_149827035.1|2995652_2996771_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.1	4.0e-08
3003421:3003439	attR	GCCCGGTAAGCGTTAGCGC	NA	NA	NA	NA
>prophage 5
NZ_CP043773	Salmonella enterica strain QH chromosome, complete genome	4835467	3031284	3060740	4835467	head,integrase,portal,tail,holin,capsid,terminase	Cronobacter_phage(78.12%)	36	3030094:3030111	3060815:3060832
3030094:3030111	attL	GTGGGTTTTTTGTTGCCT	NA	NA	NA	NA
WP_001748638.1|3031284_3032985_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	4.4e-224
WP_149827041.1|3032987_3033533_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	2.8e-63
WP_000267958.1|3033504_3034230_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	3.8e-68
WP_000122988.1|3034219_3034774_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	93.9	1.8e-94
WP_149827043.1|3034786_3036943_-|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	65.2	6.9e-190
WP_001001824.1|3036952_3037540_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_000136928.1|3037532_3038717_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.1	1.7e-177
WP_001002797.1|3038713_3039043_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811084.1|3039039_3041010_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	67.9	7.1e-258
WP_000411339.1|3041197_3041455_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_001270303.1|3041441_3041630_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	80.6	1.1e-22
WP_000376370.1|3041601_3041934_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_000175560.1|3041933_3042275_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3042271_3042565_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3042574_3043030_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3043026_3044154_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000084220.1|3044854_3045361_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000447487.1|3045357_3045846_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_001218537.1|3045906_3046608_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550496.1|3046611_3047634_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018801.1|3047695_3048499_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.4	9.1e-79
WP_149827045.1|3048659_3050435_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.8	2.8e-290
WP_000038208.1|3050431_3051493_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_001552031.1|3051489_3051813_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000960960.1|3051786_3052005_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	2.8e-06
WP_000170881.1|3052117_3054139_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	3.6e-297
WP_000279400.1|3054135_3054996_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	83.5	1.5e-132
WP_000057334.1|3054986_3055217_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022789.1|3055284_3055686_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3055685_3056111_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3056100_3056328_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460872.1|3056337_3056841_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.3	1.7e-59
WP_024131661.1|3056870_3057092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008375.1|3057220_3057790_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.8	5.4e-33
WP_000357961.1|3057801_3059583_+	AIPR family protein	NA	NA	NA	NA	NA
WP_024131660.1|3059687_3060740_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	5.2e-106
3060815:3060832	attR	GTGGGTTTTTTGTTGCCT	NA	NA	NA	NA
>prophage 6
NZ_CP043773	Salmonella enterica strain QH chromosome, complete genome	4835467	4421118	4468001	4835467	tail,plate,tRNA	Burkholderia_phage(40.91%)	49	NA	NA
WP_001182218.1|4421118_4422117_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039346.1|4422204_4423515_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416267.1|4423761_4424277_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4424376_4424586_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4424607_4424721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000646079.1|4426216_4426825_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4426933_4427302_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4427472_4429893_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455248.1|4429991_4430864_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4430877_4431375_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4431555_4432473_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973642.1|4432636_4433995_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4434083_4435193_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4435554_4436745_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|4436876_4438421_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252086.1|4438435_4439326_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4439491_4439902_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750792.1|4440044_4442141_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977962.1|4442140_4442878_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000824806.1|4442874_4443513_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4443576_4443819_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4444262_4445912_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136395.1|4446256_4447606_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615249.1|4447658_4448006_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	1.7e-21
WP_001226439.1|4448580_4448868_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_001270437.1|4448870_4449476_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	8.4e-61
WP_000777267.1|4449488_4449803_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	8.3e-20
WP_000449439.1|4449961_4450417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4450413_4450611_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729853.1|4450600_4452028_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_000907494.1|4452027_4452552_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003641.1|4452603_4452921_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185655.1|4452880_4453009_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262482.1|4453105_4455460_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	9.0e-66
WP_000271432.1|4455459_4456413_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269715.1|4456412_4456622_+	membrane protein	NA	A4JWL2	Burkholderia_virus	58.8	2.6e-17
WP_000818153.1|4456609_4457653_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	1.2e-75
WP_001541288.1|4457662_4458385_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_071786937.1|4458393_4458636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593182.1|4458711_4459074_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703637.1|4459070_4460000_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.4	2.0e-149
WP_000632047.1|4459999_4461547_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_001093501.1|4461710_4462070_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951730.1|4462060_4463176_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_000359503.1|4463168_4463801_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000368206.1|4463803_4465462_+|tail	tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	1.8e-52
WP_001151757.1|4465468_4466083_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084338.1|4466079_4466535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587743.1|4467272_4468001_+	hypothetical protein	NA	A0A292GAQ8	Xanthomonas_phage	28.2	3.5e-13
>prophage 1
NZ_CP043774	Salmonella enterica strain QH plasmid p1, complete sequence	55361	19993	26897	55361	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925627.1|19993_20416_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457543.1|20415_21690_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	4.3e-155
WP_077906345.1|21771_22749_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	52.9	1.1e-83
WP_000427676.1|22745_23951_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|24365_25307_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|25338_25905_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|25961_26297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041030921.1|26480_26897_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
