The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	513129	603854	4790657	portal,head,capsid,transposase,tRNA,terminase,tail,integrase,lysis	Enterobacteria_phage(37.74%)	90	522828:522845	588438:588455
WP_047603291.1|513129_514224_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|514292_515219_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|515448_515931_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|516008_516824_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|516913_518695_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|518707_519484_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_047603289.1|519583_520462_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|520630_522085_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|522144_523506_+	allantoinase AllB	NA	NA	NA	NA	NA
522828:522845	attL	GTATCTGGCGAAAGTTGC	NA	NA	NA	NA
WP_001302767.1|523562_524864_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706355.1|524885_526031_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
WP_000540943.1|526258_527044_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001468137.1|527054_528290_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703918.1|528311_529361_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580830.1|529677_531345_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_149796510.1|531354_532614_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001306952.1|532624_533440_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855378.1|533436_534330_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815566.1|534524_535592_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001351650.1|535588_536098_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212253.1|536215_536938_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|536940_537435_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|537608_538994_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|539029_539551_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|539658_539871_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|539872_540739_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|541209_541752_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_001529553.1|542693_545303_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|546332_546848_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|546850_547483_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_019842496.1|547817_548981_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	1.7e-198
WP_000206811.1|549207_549513_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_001242717.1|549512_549875_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_047603828.1|549865_550402_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	2.4e-99
WP_106508551.1|550529_551354_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	8.6e-149
WP_000135680.1|551419_551782_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001020632.1|552484_553177_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_001191669.1|553274_553535_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526668.1|553527_554085_+	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
WP_001250269.1|554260_554440_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104977.1|554429_555371_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
WP_077473411.1|555367_555862_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	1.6e-86
WP_047604015.1|556510_556837_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767113.1|556833_557223_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|557242_558052_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_021535258.1|558059_559049_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
WP_001204774.1|559066_559450_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	5.2e-56
WP_000737271.1|559639_560722_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|561295_561511_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135256.1|561510_562008_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
WP_000092273.1|562004_562472_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001139678.1|562459_562612_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_047606757.1|563739_564150_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.1	1.1e-51
WP_001309326.1|564207_564441_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000867489.1|564828_565374_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	1.2e-79
WP_047604242.1|565348_567274_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
WP_000198149.1|567270_567477_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_047604244.1|567473_569075_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.3	3.9e-307
WP_001591724.1|569055_570375_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	2.8e-234
WP_047604247.1|570384_570717_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_000063277.1|570772_571798_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_047604248.1|571839_572238_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	4.7e-60
WP_000752960.1|572249_572603_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_001741402.1|572614_573193_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.0e-79
WP_000683105.1|573189_573585_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|573592_574333_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|574348_574771_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|574752_575187_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_065898537.1|575179_577741_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
WP_000847379.1|577737_578067_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|578066_578765_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_001565249.1|578770_579514_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090891.1|579450_580083_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_149796511.1|580143_583623_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001228252.1|583690_584290_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_088895425.1|585854_587083_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000654811.1|587961_588930_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
588438:588455	attR	GCAACTTTCGCCAGATAC	NA	NA	NA	NA
WP_000770953.1|589449_590133_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074234.1|590289_591663_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709870.1|591820_592153_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717157.1|592168_593392_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573945.1|593403_596547_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000786320.1|596648_598025_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153148.1|598092_599340_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351480.1|599447_600101_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|600194_600563_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682524.1|600627_600876_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001130653.1|600941_602060_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000956455.1|602512_602665_+	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001300563.1|602741_603854_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	791832	830436	4790657	transposase,terminase,tail,integrase,lysis	Escherichia_phage(30.3%)	41	780377:780393	831665:831681
780377:780393	attL	GCGGATGATCGCCAGTA	NA	NA	NA	NA
WP_000533646.1|791832_792903_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
WP_001303849.1|792880_793099_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545741.1|793138_793306_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_000762731.1|793389_793818_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_001129736.1|793846_794185_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	6.4e-50
WP_065898524.1|794971_795478_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	96.9	6.8e-88
WP_001228696.1|795694_795880_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001393986.1|796076_797534_+	trk system potassium uptake protein trkG	NA	NA	NA	NA	NA
WP_001752316.1|797671_798460_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.9	9.7e-49
WP_047604197.1|798452_799316_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	2.3e-83
WP_001307172.1|799319_799571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547055.1|799574_800669_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.8	3.1e-114
WP_021546822.1|800649_801951_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	60.3	9.4e-150
WP_021546823.1|801953_803360_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	6.1e-187
WP_001469192.1|803343_804456_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.8	2.7e-113
WP_074442971.1|804560_804833_+	hypothetical protein	NA	A0A0D4DCP5	Acinetobacter_phage	54.3	1.0e-05
WP_074442970.1|804802_805324_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	67.6	5.6e-61
WP_000918487.1|805422_806562_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|806604_806781_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|806784_807180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547052.1|807179_807563_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	38.6	1.1e-13
WP_001029815.1|807563_807944_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_021546825.1|807940_808333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|808359_809322_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_122452218.1|809472_809832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032139919.1|809939_810140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654811.1|812576_813545_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_106508656.1|813578_814604_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	39.7	6.7e-58
WP_000024051.1|814596_814935_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152428.1|814934_815633_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.0	2.7e-127
WP_047606715.1|815638_816382_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	3.1e-150
WP_032156414.1|816279_816927_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	2.1e-110
WP_149796512.1|816987_820401_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_001752322.1|820470_821070_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	4.4e-110
WP_130564161.1|821134_824014_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0A7NV63	Enterobacteria_phage	74.1	5.0e-236
WP_001164109.1|824017_824545_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	97.1	8.1e-92
WP_000972143.1|824573_825107_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	6.4e-97
WP_001378636.1|826134_826329_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.3	2.3e-28
WP_001468417.1|826534_827866_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_000767389.1|828611_829088_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001295303.1|829146_830436_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
831665:831681	attR	GCGGATGATCGCCAGTA	NA	NA	NA	NA
>prophage 3
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	1317046	1383234	4790657	portal,head,transposase,capsid,holin,terminase,tail,protease,integrase	Escherichia_phage(32.31%)	87	1309601:1309615	1341368:1341382
1309601:1309615	attL	CGTGAACGCGAAATA	NA	NA	NA	NA
WP_000113681.1|1317046_1318177_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1318154_1318403_-	excisionase	NA	NA	NA	NA	NA
WP_126125394.1|1318467_1320939_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1321031_1321223_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1321219_1321408_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000358771.1|1321967_1322246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339605.1|1322205_1322607_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_000367380.1|1322618_1322771_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	4.3e-06
WP_047604206.1|1323043_1323760_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	41.6	4.2e-51
WP_001517935.1|1323809_1324025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693942.1|1324021_1324447_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|1324469_1325432_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_001151203.1|1325472_1325895_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.0e-64
WP_000004324.1|1325891_1326146_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	92.9	5.3e-41
WP_001002676.1|1326138_1326450_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	96.1	3.4e-58
WP_001224665.1|1326578_1326761_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
WP_000753053.1|1326753_1326930_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
WP_001289986.1|1326926_1327286_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	73.5	1.7e-37
WP_000510387.1|1327286_1327502_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	94.4	2.2e-35
WP_001142588.1|1327503_1327722_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	93.1	3.6e-30
WP_000224216.1|1327723_1327987_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	3.9e-31
WP_000207997.1|1327997_1328165_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000350274.1|1328272_1328506_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000967408.1|1328740_1328953_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_016230710.1|1329120_1329393_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	8.0e-11
WP_001737090.1|1329394_1330441_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	2.9e-109
WP_001737091.1|1330453_1330828_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	2.7e-33
WP_001737092.1|1330824_1331646_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.7	6.1e-78
WP_000917749.1|1331870_1332068_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_001737094.1|1332218_1333268_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	2.8e-197
WP_000562553.1|1334069_1334201_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000871291.1|1334481_1334817_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|1335077_1335266_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001355909.1|1335262_1335424_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_000284518.1|1335574_1335790_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1335794_1336139_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_047604109.1|1336189_1336723_+	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	1.8e-99
WP_001043230.1|1336800_1337013_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
WP_032159578.1|1337277_1337364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001228710.1|1337585_1337792_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_001390467.1|1337820_1337973_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_000343118.1|1338051_1338339_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_000240372.1|1338792_1339197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102142.1|1339590_1340139_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.0	6.7e-57
WP_047604041.1|1340474_1340879_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_000612626.1|1340875_1341223_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099202.1|1341271_1342810_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
1341368:1341382	attR	CGTGAACGCGAAATA	NA	NA	NA	NA
WP_000258993.1|1344484_1344691_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_047604002.1|1344687_1346280_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.2e-185
WP_001253888.1|1346269_1347775_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_001545916.1|1347811_1348159_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522603.1|1348216_1349245_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
WP_000201530.1|1349296_1349671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|1349663_1350017_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974996.1|1350032_1350566_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683079.1|1350562_1350958_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235048.1|1350965_1351715_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
WP_001309426.1|1351733_1352165_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
WP_000533401.1|1352191_1352605_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
WP_000082417.1|1352585_1355147_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847298.1|1355143_1355473_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001335877.1|1355472_1356171_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000194723.1|1356181_1356925_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_072129443.1|1356870_1357503_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	2.1e-102
WP_149796515.1|1357846_1361320_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
WP_001233154.1|1361387_1361987_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.5e-107
WP_000216486.1|1362138_1365165_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|1365164_1365749_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|1365803_1366472_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1366528_1366798_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1366912_1367083_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079505.1|1367570_1368077_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056490.1|1368122_1368623_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1368708_1368888_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1369268_1370075_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1370074_1371268_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|1371279_1372641_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|1372641_1374237_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194582.1|1374236_1375799_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1375890_1375935_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1376072_1376954_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1376950_1377571_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001326916.1|1377598_1379494_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|1379704_1380580_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1380619_1381210_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559286.1|1381206_1381965_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|1382184_1383234_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	1555408	1637588	4790657	transposase	Stx2-converting_phage(25.0%)	55	NA	NA
WP_085947771.1|1555408_1556570_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001752488.1|1557723_1558860_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001120143.1|1558959_1559193_+	tautomerase PptA	NA	NA	NA	NA	NA
WP_000085899.1|1559189_1559759_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000187919.1|1559931_1560777_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000804381.1|1560872_1561766_-	PhzF family isomerase	NA	NA	NA	NA	NA
WP_000617116.1|1561844_1562525_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001166353.1|1562521_1563217_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702535.1|1563216_1564761_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
WP_047604252.1|1564757_1568498_-	nitrate reductase Z subunit alpha	NA	NA	NA	NA	NA
WP_001207905.1|1568579_1569968_-	nitrate/nitrite transporter NarU	NA	NA	NA	NA	NA
WP_000198211.1|1571502_1572384_-	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_014639908.1|1572615_1575663_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_001240582.1|1575675_1576560_+	formate dehydrogenase N subunit beta	NA	NA	NA	NA	NA
WP_000045648.1|1576552_1577206_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_000781370.1|1577434_1577719_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_047603412.1|1577864_1578875_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000433476.1|1579008_1580706_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000841554.1|1580862_1581000_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_000495771.1|1581101_1581317_-	biofilm-dependent modulation protein	NA	NA	NA	NA	NA
WP_000152305.1|1581661_1582093_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_001285536.1|1582148_1583075_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_000193547.1|1583067_1584054_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
WP_000979626.1|1584050_1584947_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_000145123.1|1584943_1585966_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047603414.1|1585967_1587518_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001285833.1|1587531_1588113_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_074442962.1|1588370_1590770_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426299.1|1590794_1592177_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_000350395.1|1592548_1593868_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_000246019.1|1593998_1595534_-	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_000358930.1|1595689_1597090_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_074442961.1|1597451_1600247_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
WP_000832407.1|1600291_1602664_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_047604299.1|1602701_1604387_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.0	3.5e-11
WP_120795387.1|1604589_1604712_+	protein YneP	NA	NA	NA	NA	NA
WP_088895425.1|1606241_1607469_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000060492.1|1610084_1610846_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_000543384.1|1610920_1611118_-	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000726691.1|1611365_1613645_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000520675.1|1613978_1614893_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000951129.1|1617385_1617700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000947155.1|1618069_1619020_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_000467150.1|1619320_1622434_-	chromate transporter	NA	NA	NA	NA	NA
WP_000555831.1|1624907_1626446_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.6	8.2e-278
WP_000214164.1|1626494_1626677_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.2	1.3e-25
WP_149796517.1|1627006_1628062_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_149796518.1|1628603_1630112_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_164708657.1|1631074_1632287_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
WP_001254932.1|1632587_1633739_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000830196.1|1633658_1634009_-|transposase	transposase	transposase	Q716C1	Shigella_phage	90.9	4.9e-37
WP_001388968.1|1634068_1634800_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047604041.1|1635252_1635657_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_000612626.1|1635653_1636001_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099202.1|1636049_1637588_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
>prophage 5
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	1644069	1752982	4790657	portal,transposase,terminase,holin,tail,protease,integrase,lysis	Enterobacteria_phage(34.43%)	116	1712198:1712213	1753073:1753088
WP_001745714.1|1644069_1645641_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	2.9e-169
WP_000624622.1|1645660_1646008_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1646007_1646685_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000379665.1|1646993_1647290_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001088744.1|1647595_1648156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446018.1|1648253_1648586_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001214166.1|1648788_1649223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000716059.1|1649222_1651589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047603981.1|1651585_1652332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125439.1|1653967_1655290_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|1655289_1655556_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001083595.1|1655778_1657179_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
WP_047603804.1|1661729_1663280_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154352.1|1663400_1664354_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194916.1|1664602_1666138_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.4e-21
WP_000911166.1|1666131_1667160_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222729.1|1667159_1668152_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172488.1|1668163_1669186_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_047603806.1|1669212_1670088_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_047603808.1|1670111_1670402_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|1670458_1671217_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001351738.1|1671220_1672135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854633.1|1672341_1673793_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558029.1|1674019_1675438_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
WP_001191027.1|1675576_1675936_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1675935_1676862_-	glutaminase B	NA	NA	NA	NA	NA
WP_047603809.1|1676925_1678314_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366501.1|1678414_1679296_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258598.1|1679373_1680489_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1680638_1681829_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1681853_1682519_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000268704.1|1682639_1682924_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000273128.1|1682913_1683234_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
WP_000843419.1|1683453_1683888_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1683908_1684292_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803653.1|1684323_1684542_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087211.1|1684572_1685472_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054175.1|1685666_1686854_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1686980_1687076_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592802.1|1687294_1688185_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
WP_000671737.1|1688439_1688832_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024558.1|1689109_1689628_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000210373.1|1689671_1691717_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1691853_1692600_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1692688_1693375_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1693551_1693755_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|1693789_1695250_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|1695338_1696622_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1697225_1697339_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|1697407_1697641_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_047603812.1|1697959_1698550_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_016245272.1|1698777_1699071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047606545.1|1699081_1699786_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
WP_047606548.1|1699795_1700077_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	46.7	2.2e-16
WP_001228252.1|1702511_1703111_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_149796519.1|1703178_1706658_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_032156414.1|1706718_1707366_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	2.1e-110
WP_047606715.1|1707263_1708007_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	3.1e-150
WP_052987489.1|1708012_1708711_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	3.9e-134
WP_094318779.1|1708720_1709050_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.1e-59
WP_097312989.1|1709049_1712115_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161009.1|1712086_1712416_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
1712198:1712213	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
WP_001300035.1|1712424_1712811_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211114.1|1712871_1713615_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	1.7e-132
WP_001079419.1|1713625_1714027_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677106.1|1714023_1714602_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|1714613_1714889_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097039.1|1714881_1715205_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_106508632.1|1715291_1717319_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
WP_001459763.1|1717296_1718772_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
WP_047603824.1|1718771_1718984_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	3.2e-31
WP_001542226.1|1718980_1721083_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_000373425.1|1721082_1721577_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001031431.1|1722139_1722346_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035577.1|1723422_1723833_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019606.1|1723984_1724158_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1724329_1724485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|1724564_1724630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1724632_1724821_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1724831_1725044_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1725405_1725903_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1725899_1726433_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_047603358.1|1726429_1726741_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	4.5e-26
WP_000839588.1|1726745_1726961_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	91.5	1.2e-30
WP_021559276.1|1727714_1728695_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.7e-184
WP_000592549.1|1729471_1730431_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|1730623_1731148_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|1731303_1731681_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_149796520.1|1731698_1732748_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.3e-113
WP_047604052.1|1732749_1733028_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_000980999.1|1733094_1733346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039005560.1|1733562_1733775_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	1.9e-28
WP_021568046.1|1734330_1734996_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001366387.1|1735049_1735283_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
WP_001151183.1|1735279_1735702_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
WP_000054497.1|1735742_1736708_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_000705360.1|1736688_1737210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|1737193_1737421_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|1737501_1737909_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379591.1|1738077_1738230_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001241299.1|1738229_1738607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|1738782_1740011_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000854559.1|1740614_1740803_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1740799_1740991_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_149796521.1|1741084_1743556_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1743628_1743880_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000877006.1|1743914_1745195_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.1e-155
WP_001389342.1|1745196_1745325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1745382_1746402_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1746413_1747628_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1747833_1748160_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1748294_1748636_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1748670_1749231_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1749233_1749944_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1750051_1750357_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|1750555_1752982_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
1753073:1753088	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
>prophage 6
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	2002328	2093412	4790657	portal,head,capsid,tRNA,terminase,tail,holin,plate,protease	Enterobacteria_phage(53.12%)	106	NA	NA
WP_000984517.1|2002328_2003210_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055779.1|2003401_2005450_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
WP_000431370.1|2005469_2006168_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2006264_2006762_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207283.1|2006891_2008175_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|2008143_2010777_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001397399.1|2010856_2012296_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001338166.1|2012413_2012650_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001338167.1|2012754_2012946_+	YebW family protein	NA	NA	NA	NA	NA
WP_000976472.1|2014775_2015117_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879295.1|2015129_2016002_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|2016005_2016380_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2016518_2016749_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2016850_2017507_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_047603977.1|2017530_2018193_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_047603975.1|2018189_2020250_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2020458_2021118_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2021444_2021801_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2021867_2022158_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173449.1|2022291_2023470_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2023525_2024167_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|2024203_2026015_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301719.1|2026249_2027725_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
WP_001056706.1|2028062_2028932_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091148.1|2029059_2030502_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2030632_2031604_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_047603972.1|2031723_2033046_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|2033061_2033994_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2034072_2034828_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|2034824_2035610_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2035756_2036767_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580327.1|2036775_2037387_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072094247.1|2037525_2037591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024904.1|2037661_2038264_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2038265_2038787_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2038821_2039562_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|2039590_2040043_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258678.1|2040160_2041933_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891599.1|2042242_2042809_+	hydrolase	NA	NA	NA	NA	NA
WP_032199916.1|2043392_2043923_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	85.2	1.4e-83
WP_032300822.1|2043937_2045047_-	hypothetical protein	NA	Q8W613	Enterobacteria_phage	61.1	1.1e-111
WP_149796522.1|2045077_2046127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000377821.1|2046150_2047110_-	YmfQ family protein	NA	Q8W614	Enterobacteria_phage	91.8	9.5e-107
WP_000785585.1|2047109_2048192_-|plate	baseplate J/gp47 family protein	plate	Q8W615	Enterobacteria_phage	97.2	4.7e-203
WP_000973348.1|2048184_2048598_-	phage GP46 family protein	NA	Q8W616	Enterobacteria_phage	97.8	1.1e-72
WP_001013087.1|2048603_2049137_-|plate	phage baseplate assembly protein	plate	Q8W617	Enterobacteria_phage	98.3	7.9e-95
WP_032199921.1|2049136_2050192_-|plate	baseplate protein	plate	Q8W618	Enterobacteria_phage	98.9	1.0e-199
WP_032199922.1|2050188_2051580_-	DNA circularization N-terminal domain-containing protein	NA	Q8W619	Enterobacteria_phage	95.5	4.4e-246
WP_032301204.1|2051595_2053545_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	97.2	0.0e+00
WP_001103276.1|2053629_2053959_-|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	98.2	8.7e-52
WP_001062340.1|2053958_2054315_-|tail	phage tail tube protein	tail	Q8W622	Enterobacteria_phage	99.2	5.3e-63
WP_000155746.1|2054314_2055811_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8W623	Enterobacteria_phage	98.2	1.7e-275
WP_032301205.1|2055807_2055969_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	76.6	1.6e-14
WP_000779447.1|2055978_2056542_-	hypothetical protein	NA	Q8W624	Enterobacteria_phage	100.0	4.3e-107
WP_001076768.1|2056538_2057063_-	hypothetical protein	NA	Q8W625	Enterobacteria_phage	98.9	5.0e-94
WP_032301206.1|2057028_2057445_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	69.1	6.9e-46
WP_000924706.1|2057441_2057765_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8W626	Enterobacteria_phage	100.0	3.3e-56
WP_000257482.1|2057811_2059038_-|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	92.1	1.6e-199
WP_001193641.1|2059051_2059702_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	97.7	2.5e-119
WP_032301207.1|2059679_2060921_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	93.0	3.4e-226
WP_000478603.1|2060920_2061103_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	81.7	2.4e-19
WP_001140897.1|2061114_2062872_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_024166447.1|2062871_2063354_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140103.1|2063501_2063852_-	HNH endonuclease	NA	Q8W633	Enterobacteria_phage	99.1	3.6e-64
WP_001138287.1|2064215_2064371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297666.1|2064399_2064513_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	86.5	5.6e-11
WP_001117825.1|2064645_2065023_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	5.6e-63
WP_032340623.1|2065025_2065301_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	4.2e-44
WP_001297664.1|2065290_2065683_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	3.4e-47
WP_032301263.1|2065771_2065924_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_032340622.1|2065920_2066346_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	3.3e-59
WP_032219863.1|2066820_2067870_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.8	1.0e-183
WP_000917691.1|2068020_2068218_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	1.4e-28
WP_000640018.1|2068530_2069073_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.8	2.4e-67
WP_001217422.1|2069081_2069441_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	1.5e-36
WP_001436039.1|2069453_2070443_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	93.9	3.4e-184
WP_032199832.1|2070494_2070752_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	69.7	1.4e-20
WP_032300827.1|2070748_2072140_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	93.7	2.2e-250
WP_149796523.1|2072136_2073015_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	81.2	2.3e-115
WP_032300828.1|2073025_2073850_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	77.6	6.3e-91
WP_032219868.1|2073846_2074071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032201677.1|2074067_2074730_-	ash family protein	NA	Q8W643	Enterobacteria_phage	88.3	5.7e-103
WP_001017344.1|2074839_2075547_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.2	7.4e-117
WP_000398850.1|2075543_2075834_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	89.7	1.7e-35
WP_000800136.1|2075967_2076657_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	6.1e-116
WP_032163017.1|2076802_2077264_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	71.1	7.4e-41
WP_000606214.1|2077432_2077660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001436867.1|2077998_2078205_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	97.1	6.9e-31
WP_001538853.1|2078400_2078760_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.6	3.2e-39
WP_000002321.1|2078759_2078975_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	63.4	1.2e-17
WP_001538854.1|2079161_2079554_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.1	1.4e-35
WP_032219869.1|2079799_2080627_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	97.5	9.9e-129
WP_032199838.1|2080668_2081040_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	97.6	3.8e-64
WP_001538858.1|2081071_2081314_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	95.0	1.4e-35
WP_032219870.1|2081317_2081464_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	91.7	1.6e-21
WP_000528718.1|2081472_2081709_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_016239042.1|2081764_2083078_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	96.8	1.8e-249
WP_049768377.1|2083059_2083830_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|2083882_2084278_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2084318_2085062_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564725.1|2085058_2086030_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176796.1|2086194_2088624_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214316.1|2088648_2089749_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185727.1|2090136_2090883_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001295504.1|2090896_2091463_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025322.1|2091678_2093412_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 7
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	2122815	2179080	4790657	portal,head,capsid,transposase,terminase,holin,tail,plate,integrase	Enterobacteria_phage(78.72%)	72	2122586:2122645	2159179:2159302
2122586:2122645	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|2122815_2123817_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2123822_2124170_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290347.1|2124199_2124850_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|2124865_2125270_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|2125359_2125497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014505.1|2125568_2125772_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739032.1|2125793_2126144_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	84.5	2.7e-51
WP_000158971.1|2126154_2126442_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|2126453_2126696_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|2126692_2126806_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|2126892_2127096_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153674.1|2127092_2127338_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_001274214.1|2127334_2127634_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.8	8.2e-41
WP_112059343.1|2127645_2128263_+	ash family protein	NA	S5MQL6	Escherichia_phage	48.1	5.0e-08
WP_000599410.1|2128259_2128625_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	8.7e-61
WP_000123425.1|2128631_2131439_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	95.7	0.0e+00
WP_149796524.1|2131515_2132475_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.0e-177
WP_000211268.1|2132479_2132791_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.3	8.5e-41
WP_000236493.1|2133985_2134510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087825.1|2134524_2135571_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	5.0e-202
WP_000613809.1|2135570_2137322_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262655.1|2137476_2138313_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055107.1|2138336_2139389_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_000632322.1|2139434_2140235_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_000063077.1|2140338_2140833_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.6	1.9e-87
WP_000864897.1|2140832_2141033_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|2141035_2141359_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072347.1|2141355_2141748_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	3.2e-69
WP_074507087.1|2141744_2142152_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	9.4e-64
WP_000920594.1|2142289_2142757_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356339.1|2142749_2143385_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001436184.1|2143396_2143963_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.9e-99
WP_001067548.1|2143980_2144310_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111964.1|2144313_2145210_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	1.8e-155
WP_000071720.1|2145202_2145733_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001708047.1|2145735_2148102_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	60.5	2.7e-203
WP_000972151.1|2148104_2148638_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	97.2	3.9e-94
WP_001164126.1|2148666_2149194_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	94.3	1.7e-89
WP_001171280.1|2149197_2150034_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	93.5	7.1e-151
WP_000905056.1|2150138_2150726_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.5	6.0e-104
WP_000979956.1|2150761_2151250_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.6e-86
WP_074507538.1|2151262_2154070_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.8	0.0e+00
WP_000333495.1|2154056_2154212_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665308.1|2154220_2154586_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|2154640_2155153_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005413.1|2155152_2156337_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	5.6e-226
WP_000132785.1|2156494_2157604_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_000488107.1|2157646_2157907_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2158096_2158237_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_071595684.1|2158426_2158708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160187.1|2159701_2160250_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2159179:2159302	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
WP_001283421.1|2160306_2162139_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000611338.1|2162135_2162792_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001302050.1|2163087_2163264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106474.1|2163250_2163475_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001154273.1|2163542_2164265_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_047603369.1|2164494_2165247_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	1.9e-25
WP_001158220.1|2165243_2165912_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001128219.1|2165926_2166913_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001295643.1|2167017_2167818_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001301374.1|2167905_2168457_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001087467.1|2168502_2169222_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_000079829.1|2169386_2170961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047603367.1|2171215_2172628_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287768.1|2172642_2173053_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_001015023.1|2173052_2173418_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_001245699.1|2173495_2174983_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001295642.1|2175016_2175430_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118901.1|2175616_2176822_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000789493.1|2176818_2177052_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000334609.1|2177160_2177832_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_072327920.1|2177871_2179080_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	5.4e-208
>prophage 8
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	2321010	2362274	4790657	portal,head,transposase,capsid,tRNA,holin,tail,terminase,plate,integrase,lysis	Escherichia_phage(29.79%)	51	2325309:2325336	2359733:2359760
WP_000675150.1|2321010_2322414_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|2322410_2323133_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2323323_2323656_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2323802_2325164_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2325309:2325336	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2325436_2325655_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_047603449.1|2325736_2326900_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.4	3.5e-204
WP_000978920.1|2326899_2327379_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.1	5.6e-84
WP_047603450.1|2327393_2329841_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.4	0.0e+00
WP_000785970.1|2329833_2329953_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2329985_2330261_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_047603452.1|2330317_2330836_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	1.9e-93
WP_149796526.1|2330848_2332039_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001745714.1|2332091_2333663_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	2.9e-169
WP_000624622.1|2333682_2334030_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2334029_2334707_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001461859.1|2335044_2335572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001461858.1|2335961_2336489_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	95.4	2.3e-91
WP_047603056.1|2336492_2338787_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	62.3	6.7e-183
WP_042032705.1|2338797_2339328_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	8.6e-102
WP_033550114.1|2339320_2340229_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_047603062.1|2340233_2340581_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	2.9e-58
WP_047603064.1|2340577_2341213_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	2.6e-113
WP_047603065.1|2341279_2341732_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	2.4e-76
WP_047603067.1|2341724_2342192_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.1	3.1e-79
WP_001440152.1|2342154_2342328_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_047603069.1|2342299_2342725_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	3.0e-65
WP_047603071.1|2342712_2343138_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	7.5e-56
WP_001144101.1|2343152_2343650_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2343649_2343931_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|2343934_2344138_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988639.1|2344137_2344647_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_047603074.1|2344746_2345490_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	98.0	9.8e-128
WP_001391285.1|2345493_2346567_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	1.9e-201
WP_047603076.1|2346625_2347480_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	97.2	7.6e-132
WP_047603079.1|2349425_2350460_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	9.3e-201
WP_001752367.1|2351162_2351600_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	86.0	1.4e-65
WP_021561350.1|2351762_2352854_+	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	33.3	9.1e-05
WP_021561351.1|2352867_2353356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047603084.1|2353773_2356074_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
WP_000027667.1|2356063_2356339_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_047603086.1|2356335_2356560_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	8.5e-35
WP_001277965.1|2356559_2356862_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	100.0	3.5e-47
WP_000557703.1|2356861_2357086_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|2357149_2357650_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001005162.1|2357646_2357817_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2357827_2358103_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2358224_2358524_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2358639_2359653_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_077775234.1|2359917_2360193_-	hypothetical protein	NA	NA	NA	NA	NA
2359733:2359760	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807345.1|2360647_2361547_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000481293.1|2361620_2362274_-	HAD-IA family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	24.8	9.0e-08
>prophage 9
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	2403109	2412550	4790657		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|2403109_2404246_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001375261.1|2404242_2406243_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2406367_2406829_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2406868_2407339_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2407385_2408105_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2408101_2409787_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2410008_2410740_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2410799_2410907_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2410887_2411619_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|2411623_2412550_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 10
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	3019152	3032335	4790657		Escherichia_phage(50.0%)	12	NA	NA
WP_001272895.1|3019152_3021714_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
WP_001141322.1|3021819_3022476_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3022526_3023294_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3023489_3024398_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3024394_3025657_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3025653_3026292_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3026296_3027073_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3027161_3028526_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3028619_3029612_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|3029674_3030814_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3030953_3031580_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3031573_3032335_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 11
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	3963755	3977397	4790657	integrase	Morganella_phage(37.5%)	16	3963635:3963647	3966112:3966124
3963635:3963647	attL	TCATGAGCTATCA	NA	NA	NA	NA
WP_021548272.1|3963755_3965024_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.3	5.1e-193
WP_001059729.1|3965020_3965671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001363069.1|3966141_3966360_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
3966112:3966124	attR	TCATGAGCTATCA	NA	NA	NA	NA
WP_000412540.1|3966359_3966791_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_021548274.1|3966803_3967637_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_021548275.1|3967629_3967812_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_024190779.1|3967805_3968873_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	1.1e-15
WP_001065738.1|3968865_3969060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024676.1|3969056_3969320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3969316_3969538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058744.1|3969530_3970133_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_047603036.1|3970145_3972902_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	2.3e-299
WP_032235469.1|3973134_3973593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018522.1|3973773_3973947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021548279.1|3973951_3975295_+	phage DNA ejection protein	NA	A0A0M5M1J8	Salmonella_phage	71.4	1.6e-160
WP_000729823.1|3975279_3977397_+	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	57.9	1.3e-169
>prophage 12
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	4527715	4589424	4790657	integrase,protease,tRNA,transposase	Ralstonia_phage(14.29%)	59	4526918:4526932	4557376:4557390
4526918:4526932	attL	TGCCACTGCCAGCAG	NA	NA	NA	NA
WP_047603616.1|4527715_4529035_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	32.3	2.4e-23
WP_047603618.1|4529107_4531039_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_047603620.1|4531113_4531464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045332297.1|4531518_4532703_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.7	3.6e-31
WP_089541817.1|4533364_4534592_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_047603283.1|4535868_4536444_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068922.1|4536480_4538178_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|4538153_4538492_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|4538607_4539909_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|4540026_4541463_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|4541799_4542276_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|4542291_4543548_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|4543823_4544117_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4544160_4545807_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|4545944_4546298_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008049.1|4546490_4547360_-	YjeJ family protein	NA	NA	NA	NA	NA
WP_000940526.1|4547754_4548783_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|4548824_4549391_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|4549442_4549568_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|4549678_4549825_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|4550006_4550324_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238369.1|4550320_4550854_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001300820.1|4550942_4552076_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|4552138_4552498_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|4552508_4552904_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|4552914_4553649_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192984.1|4553641_4555450_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004770.1|4555774_4556752_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001399652.1|4556970_4558473_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
4557376:4557390	attR	CTGCTGGCAGTGGCA	NA	NA	NA	NA
WP_000342867.1|4558524_4558839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|4558835_4559150_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236847.1|4559178_4562502_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|4562523_4563492_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041964.1|4563588_4564641_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|4564735_4565281_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|4566023_4566077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|4566059_4567199_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001295189.1|4567197_4568745_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|4568716_4569178_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990333.1|4569196_4570534_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|4570543_4572391_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|4572383_4573334_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4573419_4573728_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|4573803_4575084_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|4575169_4576429_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4576431_4577436_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4577517_4577715_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4577818_4579117_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|4579321_4579747_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|4579785_4582227_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001293282.1|4582406_4583138_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|4583264_4583666_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4583684_4584383_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_047603518.1|4584433_4585093_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|4585110_4585509_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101685.1|4585518_4586157_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943964.1|4586159_4587323_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_001295190.1|4587406_4589032_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4589148_4589424_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 13
NZ_CP041627	Escherichia coli strain ETEC6 chromosome, complete genome	4790657	4638195	4707362	4790657	transposase,tRNA,holin,protease	Stx2-converting_phage(16.67%)	56	NA	NA
WP_001162171.1|4638195_4639548_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|4639602_4639989_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106233.1|4640033_4640498_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187776.1|4640656_4642795_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001348238.1|4643188_4644844_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|4644893_4646315_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|4646433_4647381_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4647565_4647619_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001742597.1|4647759_4650456_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.6	4.1e-46
WP_000047539.1|4650661_4651048_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4651120_4651582_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4651594_4652530_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4652533_4652668_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230273.1|4652948_4653344_-	RidA family protein	NA	NA	NA	NA	NA
WP_047603530.1|4653474_4654188_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256664.1|4654258_4654852_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336307.1|4654996_4655449_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000012923.1|4657222_4658227_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4658388_4658805_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059425.1|4658850_4659354_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_149796549.1|4659546_4660743_+	DUF898 family protein	NA	NA	NA	NA	NA
WP_047603534.1|4660798_4663654_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786399.1|4663653_4664097_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4664230_4665742_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584117.1|4666008_4667109_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4667108_4668191_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001514874.1|4668351_4669854_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	7.9e-84
WP_001300770.1|4669983_4671003_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_047604041.1|4672528_4672933_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_000612626.1|4672929_4673277_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001741392.1|4674927_4676061_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000416151.1|4676999_4678031_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916805.1|4678301_4678745_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001741394.1|4678760_4679048_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|4679060_4680317_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_077775235.1|4680563_4680755_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004019923.1|4681239_4682253_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998346.1|4682264_4683581_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_001742622.1|4683608_4684529_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|4684834_4685617_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_126123275.1|4686833_4686944_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145475.1|4687124_4687781_-	TetR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001375347.1|4688028_4689306_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|4689368_4691366_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088351.1|4691519_4692659_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	7.9e-68
WP_001300018.1|4692839_4693784_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_052114387.1|4694565_4696062_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	6.2e-105
WP_001192736.1|4696367_4697201_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_047603908.1|4697559_4699614_+	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	31.0	1.4e-27
WP_047603910.1|4699610_4700921_+	McrC family protein	NA	NA	NA	NA	NA
WP_000168555.1|4700983_4701856_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001300013.1|4701937_4702060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047603913.1|4702067_4703048_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	1.1e-99
WP_001300022.1|4703111_4704218_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_071791375.1|4704237_4704954_-	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_088895425.1|4706133_4707362_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
