The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	7560	75977	4793207	protease,transposase	Bacillus_phage(20.0%)	49	NA	NA
WP_024711641.1|7560_8397_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014501262.1|8583_9390_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501263.1|9666_10860_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_041182973.1|11013_11685_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|11769_12531_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12577_13000_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13003_13417_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_014501266.1|13712_14480_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_024712593.1|14490_14760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621217.1|14834_16295_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_149621218.1|17004_17961_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.6e-42
WP_149621219.1|18267_19233_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014501290.1|19366_20425_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_014501292.1|20734_21808_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033005790.1|22561_23614_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011258802.1|23973_24942_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_047339403.1|25554_26685_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_149621220.1|27211_27562_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024712393.1|27709_29521_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_044749555.1|29683_30340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033005598.1|30499_31735_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_047339404.1|31839_33369_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.9	2.9e-25
WP_024712397.1|33535_34528_-	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	30.1	1.5e-09
WP_008572943.1|34527_34848_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_010364746.1|34964_35657_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_047339405.1|35875_37225_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_149621221.1|37558_38353_+	2OG-Fe(II) oxygenase	NA	A0A0E3ESN0	Synechococcus_phage	42.9	8.6e-13
WP_014501306.1|38369_39497_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_014501309.1|42523_43339_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	2.8e-19
WP_149621222.1|43560_44880_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_149621223.1|44975_45774_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_076342587.1|45900_46992_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_149621224.1|47060_48659_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_014505344.1|48823_50068_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|50519_51149_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_048485274.1|51355_53332_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	5.3e-112
WP_044749561.1|55666_56677_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_044749562.1|56673_57405_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_044749563.1|57758_59288_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	2.3e-46
WP_149621225.1|59397_62430_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044749565.1|62728_65767_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014505331.1|65933_66986_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024712203.1|67397_68372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621226.1|68371_71038_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_014505327.1|71233_72214_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_149621938.1|72829_73045_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_047340310.1|73187_73760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621227.1|74853_75207_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_149621228.1|75213_75977_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	247682	320233	4793207	transposase	Staphylococcus_prophage(33.33%)	55	NA	NA
WP_149621228.1|247682_248445_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014501268.1|248578_249535_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_143703547.1|250023_251463_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_024712590.1|252526_254935_-	serine kinase	NA	NA	NA	NA	NA
WP_024712589.1|255063_255306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014505161.1|255743_256190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047340268.1|256186_258118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183522.1|258890_259361_-	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
WP_014505158.1|259415_259697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047340267.1|259777_260020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505156.1|260029_260968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505155.1|260964_261792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505154.1|261788_262049_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_014505153.1|262053_262698_-	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_024712172.1|262684_263638_-	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_149621255.1|263730_264372_-	type III secretion system protein SctP	NA	NA	NA	NA	NA
WP_014505150.1|264371_266294_-	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_047340265.1|266302_267376_-	type III secretion system export apparatus subunit SctU	NA	NA	NA	NA	NA
WP_014505148.1|267590_268046_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_014505147.1|268079_268472_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_014505146.1|268473_269238_+	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_024712167.1|269245_269875_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_014505144.1|269859_270561_+	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_014505143.1|270550_271879_+	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_044749626.1|271871_272381_+	serine kinase	NA	NA	NA	NA	NA
WP_024712165.1|272377_273208_+	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_024712164.1|273290_275114_+	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_149621256.1|275852_276266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505137.1|276640_277204_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	38.5	3.3e-11
WP_014505136.1|277666_279220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257097.1|281005_281347_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_048485758.1|281531_284090_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011407204.1|284108_284369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|284468_285437_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_149621257.1|285746_285953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712034.1|286156_287881_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRP3	Ostreococcus_lucimarinus_virus	28.7	6.0e-35
WP_149621258.1|288121_289063_+	DUF808 family protein	NA	NA	NA	NA	NA
WP_024712033.1|289255_290620_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_149621259.1|290616_292245_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_041183519.1|292736_294320_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_149621260.1|294316_296548_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_149621261.1|296550_298308_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_082348549.1|298364_300254_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_048484348.1|300250_302860_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_024712025.1|302882_303068_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_014505120.1|303182_305345_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_047340568.1|305361_305994_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_143706730.1|306157_306655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407197.1|306795_307842_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_161600043.1|308056_309016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621228.1|309026_309789_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_161600044.1|312474_317808_+	type IV secretion protein Rhs	NA	S5W9C6	Leptospira_phage	38.7	4.4e-12
WP_149621263.1|317820_318258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621264.1|318278_319241_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|319276_320233_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 3
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	552846	635010	4793207	tRNA,transposase	Staphylococcus_phage(14.29%)	52	NA	NA
WP_014504888.1|552846_553410_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_024711277.1|553420_555913_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.1e-114
WP_149621295.1|556095_557355_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_149621296.1|557396_558071_-	pilus assembly protein PilA	NA	NA	NA	NA	NA
WP_003484452.1|558159_558633_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_044749740.1|558675_559818_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_024711281.1|559889_561026_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_014504882.1|561158_561671_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_014504881.1|562064_562988_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_014504880.1|562987_564301_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_024711283.1|564351_566073_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_024711284.1|566237_567515_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_024711285.1|567712_568537_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014504876.1|568540_569596_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_149621297.1|569761_571267_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_048485763.1|571263_571773_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_014504873.1|571884_573018_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	7.9e-28
WP_149621298.1|573264_573786_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_041183493.1|573985_574900_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|575000_575441_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014504870.1|575550_577425_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024711291.1|577617_577938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076342545.1|578773_578956_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	48.4	1.9e-08
WP_024712046.1|581532_583770_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011257330.1|584192_584882_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_080344411.1|586649_586976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014504858.1|589867_590878_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024712050.1|591276_592470_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024712051.1|592466_593213_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_149621299.1|593244_594846_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|594906_595107_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_149621300.1|595103_595691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296754.1|595894_596056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|596176_596449_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_149621301.1|596514_597504_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_076342635.1|597587_598415_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_149621302.1|598451_599447_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	5.5e-25
WP_149621303.1|599464_600256_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257312.1|600219_601008_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_048482978.1|601126_602065_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_149621304.1|604484_605804_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044751441.1|605953_606937_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.0e-96
WP_149621305.1|607043_608000_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	4.8e-42
WP_024712719.1|608158_609436_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_044750250.1|609912_610881_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_012444053.1|611180_611465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621944.1|613126_614503_-|transposase	IS5-like element ISXo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.8	2.7e-78
WP_149621306.1|615418_617161_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_149621307.1|628561_629116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621308.1|629247_629514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621309.1|632844_633528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621945.1|633633_635010_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	7.0e-79
>prophage 4
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	837314	928460	4793207	tRNA,transposase	Enterobacteria_phage(22.22%)	68	NA	NA
WP_014504632.1|837314_838370_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.7	1.2e-83
WP_024710811.1|838425_839313_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.5	2.6e-95
WP_014504630.1|839309_839867_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	6.6e-44
WP_149621342.1|839863_840772_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	3.2e-27
WP_024710812.1|840888_842292_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	1.5e-47
WP_014504627.1|842339_843686_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.0e-33
WP_024710813.1|843819_844551_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_149621343.1|844550_845180_+	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_149621344.1|845248_846011_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_047340167.1|846053_848141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504624.1|848137_849787_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_041183461.1|849903_850512_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	34.0	2.4e-23
WP_149621345.1|851060_851705_-	ABC transporter	NA	NA	NA	NA	NA
WP_014504621.1|851701_852628_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|852630_853473_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_014504620.1|853558_854671_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014504619.1|854841_856101_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_014504618.1|856160_856622_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_047340165.1|856764_858459_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_047340164.1|858570_858975_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_024710819.1|859106_859880_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_024710820.1|859890_860358_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_014504613.1|860354_860837_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_014504611.1|861663_862797_+	pectate lyase	NA	NA	NA	NA	NA
WP_047340547.1|863064_865038_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	37.3	5.5e-16
WP_149621346.1|865760_868775_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	32.4	5.6e-129
WP_149621347.1|868982_869408_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_149621348.1|869763_871236_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	5.3e-48
WP_024711461.1|871343_872426_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_024711460.1|872422_873529_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_041183459.1|873533_873833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711458.1|873943_874411_-	RDD family protein	NA	NA	NA	NA	NA
WP_047340546.1|874837_875809_+	site-specific tyrosine recombinase XerD	NA	G8I6R6	Mycobacterium_virus	27.7	5.4e-17
WP_014504600.1|876293_877091_+	DsbC family protein	NA	NA	NA	NA	NA
WP_149621349.1|877531_881584_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.1	1.5e-121
WP_048488503.1|882562_888916_+	membrane protein	NA	NA	NA	NA	NA
WP_024711452.1|889136_891020_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	32.6	7.5e-23
WP_161795299.1|891194_892877_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_149621350.1|892873_893053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711451.1|893052_894270_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014504591.1|894537_894969_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_014504590.1|894978_895488_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_014504589.1|895484_895901_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_024745204.1|895897_896533_+	type II secretion system protein J	NA	NA	NA	NA	NA
WP_044749902.1|896529_897381_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_047340160.1|897377_898499_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_024711447.1|898482_899136_+	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_149621351.1|899125_900001_+	general secretion pathway protein GspN	NA	NA	NA	NA	NA
WP_047340158.1|899997_902322_+	type II secretion system secretin GspD	NA	G4WZN6	Enterobacteria_phage	21.7	5.3e-10
WP_044749904.1|902318_903158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621352.1|903541_904600_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044749906.1|904620_905379_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_044749907.1|905484_906060_-	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_047340156.1|906434_908597_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_047340155.1|908632_909790_-	phosphotransferase	NA	NA	NA	NA	NA
WP_014504575.1|910401_911241_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_041183455.1|911368_912391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014504573.1|912403_914311_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_024712377.1|914360_915659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749912.1|915823_916753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712379.1|917139_918318_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	1.2e-50
WP_149621353.1|918643_919609_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_149621354.1|920279_921236_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	9.6e-43
WP_014504567.1|922042_922465_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.4e-41
WP_014504566.1|922787_923303_+	peptide deformylase	NA	NA	NA	NA	NA
WP_149621304.1|924056_925376_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_048485357.1|925851_927453_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_149621228.1|927697_928460_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	1085587	1173003	4793207	tRNA,transposase	Leptospira_phage(18.18%)	57	NA	NA
WP_149621375.1|1085587_1086689_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	9.7e-39
WP_149621376.1|1087413_1089414_+	transketolase	NA	NA	NA	NA	NA
WP_143703532.1|1094186_1094426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750896.1|1094486_1097201_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_087770520.1|1097320_1098496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621228.1|1100254_1101017_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024711129.1|1101800_1102505_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_149621377.1|1108291_1108657_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_149621378.1|1108646_1109957_+	TonB family protein	NA	NA	NA	NA	NA
WP_047340119.1|1109953_1110538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014504402.1|1110894_1111509_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	9.6e-20
WP_044750893.1|1111508_1112201_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024711121.1|1112211_1112988_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024711120.1|1113058_1113889_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033004774.1|1113902_1114676_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011407830.1|1115654_1116656_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_047340117.1|1117683_1118859_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_024711114.1|1118855_1119500_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_149621380.1|1119756_1121223_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_007964528.1|1121821_1122826_+	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	48.5	3.6e-80
WP_149621382.1|1123027_1123567_-	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	42.3	1.3e-28
WP_024711110.1|1123762_1124269_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_149621383.1|1124562_1125522_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.7	5.8e-80
WP_149621384.1|1125538_1126744_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_014504384.1|1126911_1127895_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014504383.1|1127905_1128187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711106.1|1129253_1130450_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_014504380.1|1130773_1131211_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_024711105.1|1131405_1133409_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_149621385.1|1133408_1135001_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014504377.1|1135136_1135862_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_076342517.1|1135858_1137580_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_044750884.1|1137688_1139536_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_014504374.1|1139715_1140624_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_047340110.1|1140623_1142600_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.3	4.8e-28
WP_024711100.1|1142861_1143932_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_149621386.1|1143928_1147054_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.8	1.4e-74
WP_149621387.1|1147405_1150075_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	48.2	3.1e-240
WP_041183424.1|1151895_1152108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504364.1|1152149_1152287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621388.1|1152654_1153566_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_024712692.1|1156942_1157365_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_014504357.1|1157425_1158139_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_014504356.1|1158881_1159157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504354.1|1159415_1159757_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_014504353.1|1159814_1161677_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_024712532.1|1161752_1162511_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_019303101.1|1162812_1163607_-	thiazole synthase	NA	NA	NA	NA	NA
WP_014504350.1|1163969_1164170_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_047340106.1|1164357_1166142_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011258802.1|1166621_1167590_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_149621952.1|1167787_1169164_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	3.3e-76
WP_044749921.1|1169478_1170090_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_149621389.1|1170347_1170593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409118.1|1170683_1171076_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_144406551.1|1171108_1171907_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014501268.1|1172046_1173003_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
>prophage 6
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	1251275	1326645	4793207	tRNA,transposase	Hokovirus(16.67%)	50	NA	NA
WP_044749946.1|1251275_1254107_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	3.7e-42
WP_024711667.1|1254421_1254940_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_014504272.1|1255008_1255959_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_047340090.1|1256475_1257411_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014504269.1|1257410_1259411_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_041183763.1|1259413_1260040_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_014504267.1|1260039_1260375_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_161600045.1|1260544_1262425_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_048483568.1|1262649_1264896_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	3.4e-54
WP_149621401.1|1264919_1266539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621402.1|1266682_1271521_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.1	1.2e-21
WP_041183403.1|1271522_1271891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161600046.1|1271933_1275947_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.8	2.4e-18
WP_149621403.1|1275956_1276352_+	immunity protein 12	NA	NA	NA	NA	NA
WP_149621945.1|1276371_1277748_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	7.0e-79
WP_149621404.1|1278209_1279311_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	8.0e-41
WP_014504258.1|1279574_1280966_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_149621405.1|1281103_1282069_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_143703539.1|1282840_1283122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047340086.1|1283339_1284131_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_162484708.1|1284615_1284756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621406.1|1284891_1286322_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014504252.1|1286534_1288409_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.4e-15
WP_047340085.1|1288433_1290758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621407.1|1291432_1292275_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_014504248.1|1292276_1292639_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_014504247.1|1292635_1293031_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_149621408.1|1293021_1294032_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_014504245.1|1294028_1294916_+	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	7.1e-24
WP_033005506.1|1294899_1296861_+	response regulator	NA	NA	NA	NA	NA
WP_047340084.1|1298563_1300147_-	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_014504239.1|1300394_1301444_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_011407903.1|1301732_1302524_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_024711812.1|1302878_1304255_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_044749970.1|1305828_1306899_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_024711814.1|1306889_1307687_+	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_011258141.1|1307796_1308054_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_024711815.1|1308097_1308610_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_024711816.1|1308674_1309433_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005989873.1|1309577_1309985_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_044751477.1|1310614_1312105_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_024711817.1|1312445_1312853_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_149621409.1|1312994_1315241_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_149621410.1|1315671_1316286_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_024711820.1|1316564_1319180_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	3.9e-30
WP_014504223.1|1319560_1319866_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_041183397.1|1320311_1322897_+	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	2.9e-126
WP_149621411.1|1323104_1324466_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1324560_1325529_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_149621305.1|1325688_1326645_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	4.8e-42
>prophage 7
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	1667755	1726124	4793207	protease,transposase,coat	Escherichia_phage(16.67%)	44	NA	NA
WP_014503925.1|1667755_1668748_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	56.7	8.3e-98
WP_014503924.1|1669447_1671814_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_149621463.1|1671897_1673244_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012445186.1|1673270_1674461_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_014503921.1|1674463_1675291_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_024710300.1|1675287_1676049_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	1.0e-15
WP_011258697.1|1676066_1676624_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_014503919.1|1676804_1677527_-	UMP kinase	NA	NA	NA	NA	NA
WP_024710301.1|1677633_1679157_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.0	5.3e-19
WP_047340004.1|1679432_1680311_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|1680480_1681284_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_012445181.1|1681675_1682401_-	molecular chaperone	NA	NA	NA	NA	NA
WP_024710302.1|1682403_1682736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024710303.1|1682782_1683817_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_149621464.1|1683813_1686165_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_024710305.1|1686181_1686952_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033013198.1|1686960_1687485_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_014503910.1|1687803_1688580_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_041183360.1|1688576_1691186_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_048484580.1|1691202_1692399_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_024710308.1|1692395_1692866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503906.1|1692862_1693219_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_149621959.1|1693358_1693721_+	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	39.0	1.2e-14
WP_149621465.1|1693725_1694856_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_014503903.1|1695150_1696845_+	asparagine synthase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	39.0	1.6e-88
WP_014503902.1|1696913_1697966_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_014503900.1|1698396_1700523_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_149621466.1|1701071_1703492_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_024710311.1|1703587_1704124_+	bacterioferritin	NA	NA	NA	NA	NA
WP_014503897.1|1704607_1706851_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.6	5.5e-81
WP_048484061.1|1706911_1707763_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024710314.1|1707885_1708326_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033004534.1|1708322_1709840_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_044750143.1|1709850_1711044_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014503892.1|1711050_1712628_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_014503890.1|1714339_1715002_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_047340520.1|1715579_1717769_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_149621467.1|1717897_1719676_-	peptidase M14	NA	NA	NA	NA	NA
WP_014503886.1|1720876_1721485_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011259018.1|1721899_1722088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048481690.1|1722271_1722586_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_047339997.1|1722636_1723470_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_047339996.1|1723536_1724037_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149621468.1|1725325_1726124_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	1877708	1903530	4793207	tRNA,integrase,transposase	Ralstonia_phage(50.0%)	20	1896254:1896313	1903536:1904694
WP_024712336.1|1877708_1878989_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.1	1.3e-98
WP_024712335.1|1879309_1879894_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024712334.1|1879993_1881010_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_162527322.1|1881560_1883027_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_078565843.1|1883050_1883500_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_149621485.1|1883500_1883986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621962.1|1884363_1884723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621486.1|1884740_1885055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621487.1|1885100_1885853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108723645.1|1885957_1886281_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_149621488.1|1889291_1890260_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_149621489.1|1890560_1892666_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_040237360.1|1892658_1893852_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_149621963.1|1894028_1895132_+	abortive infection family protein	NA	NA	NA	NA	NA
1896254:1896313	attL	TAGGGAACCTCTGAACAACGCACCACAAATGCGAGACACTATTTGTTCGGAATGAGGAGG	NA	NA	NA	NA
WP_011258802.1|1896318_1897287_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_149621490.1|1897982_1899383_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059XK29	uncultured_phage	24.1	4.7e-06
WP_161600047.1|1900492_1900735_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	66.0	9.3e-11
WP_149621492.1|1901039_1901921_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_149621493.1|1902129_1902447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1902561_1903530_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1903536:1904694	attR	CCTCCTCATTCCGAACAAATAGTGTCTCGCATTTGTGGTGCGTTGTTCAGAGGTTCCCTAGCAGCAGCGATTGCGGCGCAGACAATCTCAGTTCACGCAGTTTTTCTTTTGGTTATCGTTTACATCGTTGCGTTCTTTCACTGGATGAGTCTTGGAAGCGCTCACATCGAAGCCAAACAGCTCGTTGCTCCTCGCTTTGGGTTCGGCGACTTGCTCGCACACGCACCCCTGCGCCGATTGACGACATTTCGCTTGCTGACCGCTTGCGCCCATTCCGCCACATTGGTCGCCATTCCGCTCTTGGCGGCTCGAGTAGCTTCTGCGCACACCGCAGGCGTTGTCCAATCAATTTTTTTACTTGCCGTAGCTCTAGGCTTCGCGGCCGGCCATTGGCAAGGAACGCGCTGGCGATCAAGTAGTCCGCCGTCGTTCGTGTTGATTTGGATCGGGTGCATCGGAAGTTCGGCGGCTTGGATAGCCGTTGCTCTGACTGGTTCCATCGCACTAGGGATTATTGCCTGTGCTGCTCACGGATTCGCGCTCTATTGCCTGCGTATGGCTGGGGTGCTTGTTGGTCGCTTAGTGACTCCAACTACCGTCTTCGGGCAAGCAGTTCTGATTGGGGACACAATTTCCCGATTCGGTTCGGCCCTGGTGGGCGTGAGCGTCTCGATGTTCCTGATTCGACTGAATAGTGGGGAGCCGCGTCTGCTTCTGGTAGGAGGTCTTGCGCTCATCGCCGCAAGCGCCGTGCTCGTGGCAGGAAGGCTCTGGCGGGACATACCCCGCGATAGCCCCCCCTTTACCAGAACTAATTGAGCTTGCTTTCCACTGCGCTATGAGGAACAACAATGAAAGACCAAACAAGGACTGGCACACCGCTGGATGACTGGAACTGGTTTGATCCGACCAGCGATGCAAGGTTTGATCGGCGAGAACTTCTGATTCGTGATGACTCATCGGTGGAACTGCGCTTGCAGAGCATTGTCCGAATGGCTGATGCGATCTATGACCACCTATCAGTATTCGAGCAGTTCTATGCCAATCCCCCCGGGGGAGGGCGCGGTGGAAATTGCGCATTGGGGGACCCCTCCCGCAAACTTGAGTTACCTGAAGCTAAGCAGAAACTCGCCGATGTCGAGCGGACATTGATGGCCCT	NA	NA	NA	NA
>prophage 9
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	2011931	2021975	4793207	tRNA	Micromonas_sp._RCC1109_virus(16.67%)	8	NA	NA
WP_024710529.1|2011931_2013608_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.5	1.9e-38
WP_024710528.1|2013696_2014338_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	1.8e-13
WP_014503651.1|2014510_2015545_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	3.6e-112
WP_014503650.1|2015846_2016335_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_014503649.1|2016436_2019085_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	9.7e-85
WP_003481884.1|2019224_2019437_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_149621968.1|2020502_2021252_+	isopentenyl transferase	NA	NA	NA	NA	NA
WP_014503645.1|2021495_2021975_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.1	3.0e-53
>prophage 10
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	2162457	2315779	4793207	plate,transposase	Ralstonia_phage(25.0%)	97	NA	NA
WP_149621558.1|2162457_2163423_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_048483243.1|2163541_2163907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621559.1|2163903_2164506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483755.1|2164772_2165729_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_047339893.1|2167264_2167726_-	cytochrome c	NA	NA	NA	NA	NA
WP_041183307.1|2167734_2168127_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_024712491.1|2168330_2169464_+	MexH family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_047339892.1|2169460_2172973_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.5	1.8e-110
WP_149621562.1|2172969_2176044_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_149621563.1|2176158_2177127_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|2177318_2178287_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_024712742.1|2178409_2179474_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_014504829.1|2181675_2182644_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_024712191.1|2183058_2183718_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_014503510.1|2183770_2185687_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_014503509.1|2185789_2186509_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_014503508.1|2186505_2187513_-	glucokinase	NA	NA	NA	NA	NA
WP_024712193.1|2187509_2188940_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.1	2.2e-67
WP_014503506.1|2189362_2190460_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	1.3e-22
WP_024712194.1|2190588_2191461_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_080344391.1|2191404_2191671_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_014503504.1|2191730_2192126_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_014503503.1|2192122_2192509_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_014503502.1|2192542_2194333_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_080344390.1|2194336_2194546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007963513.1|2194562_2195345_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011408531.1|2195455_2195704_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_014503500.1|2195654_2196107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712197.1|2196130_2197372_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503499.1|2197364_2198099_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_014503498.1|2198123_2198321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621564.1|2199684_2202093_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_014503494.1|2202121_2202784_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_014503493.1|2202787_2203252_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_014503492.1|2203248_2205018_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	7.2e-52
WP_024712330.1|2205014_2206055_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_014503490.1|2206346_2207126_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_014503489.1|2207122_2207587_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_162527327.1|2207610_2209029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750477.1|2209025_2210882_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_014503486.1|2210881_2211514_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_149621473.1|2214069_2215026_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	3.1e-41
WP_149621563.1|2216124_2217093_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_153296772.1|2218483_2218627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621566.1|2218640_2219603_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_048485474.1|2219904_2229489_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.9	9.0e-56
WP_149621567.1|2229485_2241134_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	30.9	4.0e-66
WP_033005365.1|2241343_2242114_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_014503478.1|2242483_2243776_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_149621568.1|2243759_2245022_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_149621569.1|2245033_2245465_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_014503475.1|2245523_2245889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503474.1|2245988_2246750_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_014503473.1|2246962_2247610_+	response regulator	NA	NA	NA	NA	NA
WP_149621973.1|2248204_2251915_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_014503471.1|2252325_2253312_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_014503470.1|2253344_2255135_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_014503468.1|2256018_2256441_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_019301510.1|2256437_2256794_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011408965.1|2256882_2257482_+	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_149621570.1|2257495_2259319_+	transmembrane repetitive protein	NA	NA	NA	NA	NA
WP_149621571.1|2259522_2260624_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	7.4e-39
WP_044750469.1|2260987_2262007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621974.1|2263586_2264963_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	2.7e-78
WP_149621572.1|2265385_2266411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621573.1|2266414_2269279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080496134.1|2269297_2270203_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_149621574.1|2270144_2272907_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	1.0e-44
WP_024711387.1|2273507_2274014_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_149621575.1|2274006_2275521_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711385.1|2275620_2276124_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259604.1|2276159_2276993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621576.1|2276980_2277484_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_047339877.1|2277487_2279365_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_027703474.1|2279328_2280339_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_149621577.1|2280371_2283077_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.7	1.9e-80
WP_027703476.1|2283265_2283763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621578.1|2283828_2284323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621579.1|2284733_2285192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183296.1|2285455_2287393_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	2.6e-39
WP_014503444.1|2287401_2287941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621580.1|2287937_2289362_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_149621581.1|2289358_2290696_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_149621582.1|2290697_2292014_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_149621583.1|2292017_2295476_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_048483311.1|2295472_2296120_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_044750449.1|2296116_2296839_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_149621584.1|2296835_2299739_+	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_044750447.1|2299735_2300062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047339870.1|2300234_2301263_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_047339869.1|2301271_2302252_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149621585.1|2302365_2304825_-	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_014503433.1|2304821_2305814_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_033004902.1|2305810_2306518_-	response regulator	NA	NA	NA	NA	NA
WP_149621586.1|2309414_2312495_-	histidine kinase	NA	NA	NA	NA	NA
WP_149621587.1|2312901_2313993_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_149621975.1|2314402_2315779_+|transposase	IS5-like element ISXo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.8	1.2e-78
>prophage 12
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	2826108	2909162	4793207	transposase	Ralstonia_phage(35.71%)	44	NA	NA
WP_048485516.1|2826108_2827071_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_144406639.1|2827577_2827940_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_149621652.1|2827997_2832305_+	avirulence protein	NA	NA	NA	NA	NA
WP_149621653.1|2832438_2835522_+	avirulence protein	NA	NA	NA	NA	NA
WP_149621654.1|2835655_2839654_+	avirulence protein	NA	NA	NA	NA	NA
WP_033006040.1|2840001_2840202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621655.1|2840597_2843321_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	3.7e-71
WP_149621656.1|2843388_2845542_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.1	2.0e-27
WP_149621657.1|2845538_2847233_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|2847229_2847493_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_149621658.1|2847554_2849261_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.7	2.7e-19
WP_149621659.1|2849220_2850606_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_024712301.1|2850612_2851368_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_149621660.1|2851511_2852891_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_149621661.1|2852890_2854222_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041183204.1|2854304_2855603_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.0e-19
WP_024712297.1|2855908_2857189_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_149621662.1|2857466_2857769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621663.1|2857758_2860107_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_024712294.1|2860103_2860949_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_162484709.1|2862783_2862939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502966.1|2863167_2864520_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_149621488.1|2866091_2867060_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_011258802.1|2867251_2868220_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044750271.1|2870198_2871053_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_087770819.1|2871223_2872528_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_047339750.1|2872669_2876764_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_014502961.1|2876797_2877784_+	response regulator	NA	W8CYM9	Bacillus_phage	26.8	4.8e-05
WP_149621664.1|2878568_2879996_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_044750267.1|2880191_2880740_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_047339748.1|2880963_2885988_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_024712001.1|2886265_2886940_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149621665.1|2886939_2888247_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_047339746.1|2888259_2891430_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014502953.1|2893230_2894226_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_047339745.1|2894386_2896903_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	1.8e-08
WP_014502951.1|2896899_2897856_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_047339744.1|2898014_2899757_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_047339743.1|2899934_2901212_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_044750250.1|2901482_2902451_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_048485530.1|2902682_2904554_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_024712636.1|2904591_2905545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621945.1|2905568_2906945_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	7.0e-79
WP_149621666.1|2908062_2909162_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	7.4e-39
>prophage 13
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	3123817	3185029	4793207	protease,tRNA,transposase	Acidithiobacillus_phage(18.18%)	38	NA	NA
WP_149621691.1|3123817_3125194_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	2.4e-79
WP_048485604.1|3125441_3126410_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_149621945.1|3126754_3128131_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	7.0e-79
WP_014503523.1|3128201_3128708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|3129210_3130179_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_024712210.1|3133831_3134953_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_041183173.1|3134949_3135858_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_014502751.1|3136386_3137508_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	4.8e-25
WP_014502750.1|3137667_3139593_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.9e-147
WP_011258741.1|3139734_3140253_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_024712213.1|3140353_3141385_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_014502748.1|3141522_3143187_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002804358.1|3143628_3144039_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|3144143_3144539_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_014502746.1|3144887_3145163_-	RnfH family protein	NA	NA	NA	NA	NA
WP_149621693.1|3145176_3145608_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010366344.1|3145668_3146172_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
WP_149621989.1|3146315_3148763_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	26.4	9.8e-15
WP_149621694.1|3151297_3153313_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_014502737.1|3154264_3154579_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_024712694.1|3157123_3157822_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_149621695.1|3159049_3162334_-	avirulence protein	NA	NA	NA	NA	NA
WP_149621696.1|3162466_3165955_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_149621697.1|3166087_3169582_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_024710670.1|3169922_3171293_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	3.5e-38
WP_047339696.1|3171289_3172540_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041183170.1|3172547_3173792_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_047339695.1|3174019_3174499_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_047340467.1|3174609_3175191_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.2	1.3e-18
WP_024710675.1|3175261_3176011_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_041183169.1|3176185_3176677_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024710677.1|3176923_3177760_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024710678.1|3177769_3179110_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_149621990.1|3179252_3180959_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_047339693.1|3180992_3182297_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_014502711.1|3182328_3182589_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_014502710.1|3182590_3183466_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_047339692.1|3183931_3185029_+|protease	protease	protease	NA	NA	NA	NA
>prophage 14
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	3470639	3507639	4793207	plate,transposase	Ralstonia_phage(50.0%)	22	NA	NA
WP_011258802.1|3470639_3471608_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_161600052.1|3471659_3471815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048485604.1|3472188_3473157_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_149621390.1|3473301_3474404_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	1.1e-42
WP_011258802.1|3474747_3475716_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_113164883.1|3477723_3478476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621999.1|3478498_3481333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621751.1|3481329_3482259_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_149621752.1|3482267_3485030_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	1.0e-44
WP_048485603.1|3489314_3489704_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_011258802.1|3489851_3490820_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_048485605.1|3491144_3491591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183259.1|3491587_3492004_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_149622000.1|3492839_3493577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621754.1|3493594_3495943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|3495967_3496696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621755.1|3496724_3499559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621756.1|3499555_3500485_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_149621757.1|3500493_3503253_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	6.6e-44
WP_014502423.1|3503345_3503699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621758.1|3503729_3506462_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	1.9e-91
WP_075242666.1|3506547_3507639_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 15
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	3581800	3592409	4793207	transposase	Ralstonia_phage(33.33%)	6	NA	NA
WP_149621766.1|3581800_3584704_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.7	3.2e-259
WP_076342481.1|3585056_3585641_+	PAAR domain-containing protein	NA	A0A0M4UVC5	Ralstonia_phage	30.1	1.3e-05
WP_047339622.1|3585637_3586333_+	VRR-NUC domain-containing protein	NA	E5E3X9	Burkholderia_phage	40.2	4.7e-31
WP_011258802.1|3586929_3587898_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_149621390.1|3588034_3589137_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	1.1e-42
WP_014502343.1|3590303_3592409_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.9	1.5e-136
>prophage 16
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	4107092	4182414	4793207	protease,transposase	Acidithiobacillus_phage(20.0%)	52	NA	NA
WP_149621834.1|4107092_4108535_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.6e-78
WP_149622010.1|4108527_4109904_-|transposase	IS5-like element ISXo4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.8	1.2e-78
WP_146255810.1|4110035_4110569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161600053.1|4110670_4112893_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_149621836.1|4112897_4115399_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_014501876.1|4116160_4117279_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_044751138.1|4117275_4119336_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_012444098.1|4119339_4119825_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_149621837.1|4119821_4121168_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003482734.1|4121340_4122387_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	2.7e-06
WP_014501872.1|4122662_4123595_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_014501871.1|4123706_4124330_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024711069.1|4124629_4125349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751142.1|4125520_4127533_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501867.1|4127654_4128545_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_149621838.1|4128717_4129479_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_024711072.1|4129565_4131215_+	MFS transporter	NA	NA	NA	NA	NA
WP_044751144.1|4131211_4132300_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_024711074.1|4132474_4132975_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014501862.1|4132971_4133427_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_149621228.1|4133607_4134371_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014501860.1|4134445_4135813_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	30.0	6.2e-43
WP_014501859.1|4135916_4136468_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024711077.1|4136986_4137904_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	2.2e-12
WP_014501857.1|4138097_4138769_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_024711078.1|4138765_4139620_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_014501855.1|4139609_4139852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711079.1|4139909_4140308_-	YbaN family protein	NA	NA	NA	NA	NA
WP_044751800.1|4140651_4142787_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.0	1.6e-29
WP_149621839.1|4142964_4144095_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014501849.1|4144903_4146997_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_014501848.1|4147064_4147376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711083.1|4147761_4148331_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_014501846.1|4148681_4149647_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_014501845.1|4150209_4151010_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024711085.1|4151565_4152480_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_014501843.1|4152510_4153248_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024711087.1|4153278_4154331_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_014501841.1|4154335_4155004_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014501840.1|4155155_4157093_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_024711090.1|4158095_4159745_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_149621840.1|4159896_4160958_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.7	4.4e-12
WP_024711091.1|4161140_4162628_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	9.2e-125
WP_024711092.1|4167344_4169927_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	2.5e-08
WP_024711093.1|4170180_4173060_+	insulinase family protein	NA	NA	NA	NA	NA
WP_014501826.1|4173626_4174556_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_149621841.1|4174594_4175590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711096.1|4176834_4177620_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_149621842.1|4177873_4179547_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_149621843.1|4180092_4180539_-	autotransporter	NA	NA	NA	NA	NA
WP_014501818.1|4180869_4181154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621844.1|4181615_4182414_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	4188174	4264269	4793207	transposase	Staphylococcus_prophage(13.33%)	44	NA	NA
WP_048485691.1|4188174_4189137_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044751159.1|4191165_4192938_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_041183059.1|4193213_4194089_-	DMT family transporter	NA	NA	NA	NA	NA
WP_041183607.1|4194286_4195165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047339512.1|4196126_4197218_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_149621945.1|4197478_4198855_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	7.0e-79
WP_149621847.1|4198932_4199502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751163.1|4199529_4199916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621848.1|4199873_4200230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621849.1|4200649_4202974_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_014501793.1|4205275_4205467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501792.1|4205857_4207441_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_149621850.1|4207787_4208384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621851.1|4208582_4209685_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	2.8e-38
WP_014504812.1|4210091_4212779_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_082351864.1|4212791_4213748_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	2.4e-41
WP_149622011.1|4214730_4217169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621852.1|4217262_4219440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621853.1|4219955_4221029_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.2	7.4e-84
WP_149622012.1|4221900_4224690_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.9	2.0e-104
WP_149621854.1|4224788_4225745_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.3e-42
WP_048485694.1|4226121_4228392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501779.1|4228691_4230332_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	6.7e-177
WP_014501778.1|4230468_4230756_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.9	2.3e-16
WP_076342523.1|4232639_4232939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712189.1|4234233_4234848_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_010370120.1|4234926_4235802_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	2.7e-44
WP_014501767.1|4236019_4236745_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	6.2e-50
WP_014501766.1|4236741_4237584_-	response regulator	NA	NA	NA	NA	NA
WP_024712190.1|4237592_4238543_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003484499.1|4238539_4239226_-	cell division ATP-binding protein FtsE	NA	F2Y165	Organic_Lake_phycodnavirus	24.4	7.5e-05
WP_149621855.1|4239301_4241026_-	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	2.3e-47
WP_014501763.1|4241224_4241566_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
WP_014501761.1|4241782_4243672_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_024712111.1|4245847_4246081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501756.1|4246155_4248387_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_047339503.1|4248576_4250289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501753.1|4251111_4251927_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.1	7.4e-36
WP_149621856.1|4252688_4254005_-	amidohydrolase	NA	NA	NA	NA	NA
WP_014501750.1|4254264_4255509_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_047339501.1|4255602_4258851_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_024712104.1|4258984_4262125_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_149621857.1|4262594_4262957_+	VOC family protein	NA	NA	NA	NA	NA
WP_149621858.1|4263303_4264269_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	4315917	4394793	4793207	tRNA,transposase	Staphylococcus_prophage(20.0%)	54	NA	NA
WP_024712516.1|4315917_4317129_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_149621866.1|4317299_4318718_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A222ZJ66	Rhodococcus_phage	32.9	2.2e-11
WP_047339493.1|4319088_4320222_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_014501697.1|4320259_4320487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047339492.1|4320545_4321841_-	MFS transporter	NA	NA	NA	NA	NA
WP_014501695.1|4322159_4322960_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.0	5.2e-26
WP_149621867.1|4323832_4324935_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	4.4e-39
WP_149621868.1|4326167_4327763_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_024712497.1|4327862_4328348_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_014501689.1|4328373_4328538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712496.1|4328893_4331722_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_024712495.1|4331721_4332096_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_024712494.1|4332092_4333637_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_014501685.1|4333633_4334140_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011260421.1|4334136_4334421_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4334417_4334771_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_076342620.1|4335167_4335557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712714.1|4335981_4337307_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_014501681.1|4339090_4340206_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_019301451.1|4340328_4340817_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024712413.1|4341172_4341763_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014501677.1|4341774_4343283_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.7	1.2e-63
WP_014501676.1|4343725_4344619_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_024712412.1|4346711_4347800_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_047339489.1|4347792_4348863_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_024712410.1|4348864_4349248_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_024712409.1|4349244_4350756_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_044751219.1|4350993_4351317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048485704.1|4351781_4352753_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.3	2.7e-85
WP_149621869.1|4353591_4354881_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.6	2.7e-40
WP_014501665.1|4355320_4355656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712587.1|4355930_4356362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712586.1|4356710_4358120_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_144406624.1|4361212_4361575_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_149621870.1|4361631_4365126_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_149621871.1|4366107_4367064_+|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	1.8e-41
WP_041183558.1|4368388_4368658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182976.1|4369321_4369960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296758.1|4370136_4370289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621872.1|4370322_4371279_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	5.3e-41
WP_149621873.1|4371316_4372585_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014501285.1|4372581_4374684_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.3	5.1e-28
WP_011257407.1|4377255_4377582_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_044751232.1|4377553_4378048_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	3.6e-17
WP_149621874.1|4378067_4379051_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011257405.1|4379096_4380140_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.7	1.5e-153
WP_014501652.1|4380316_4382815_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	66.9	8.3e-304
WP_024712256.1|4383428_4384472_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	2.2e-80
WP_047339484.1|4384578_4387287_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_149622013.1|4387573_4388188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621875.1|4388265_4389633_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024712251.1|4390314_4392138_+	potassium transporter KefB	NA	NA	NA	NA	NA
WP_014502919.1|4392380_4393337_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_149621876.1|4393825_4394793_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	5.6e-99
>prophage 19
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	4493100	4544886	4793207	tRNA,transposase,holin	Ralstonia_phage(40.0%)	48	NA	NA
WP_048485604.1|4493100_4494069_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_033005103.1|4494143_4494620_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_047339460.1|4495177_4497340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501551.1|4497460_4499629_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_153296829.1|4500035_4500197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501549.1|4500265_4500895_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|4500897_4501329_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_047339459.1|4501385_4501964_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_044751268.1|4502059_4502812_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_014501544.1|4503509_4503899_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_149621885.1|4504012_4505686_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	A9YVW0	Ostreococcus_tauri_virus	29.6	6.2e-29
WP_014501542.1|4505682_4506327_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_149621886.1|4506561_4507665_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003468167.1|4508265_4508424_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_024711717.1|4508489_4509500_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.2	4.5e-14
WP_149621887.1|4509728_4511399_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_010370556.1|4511727_4512111_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_044751276.1|4512332_4513235_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014501535.1|4513375_4514494_-	Fic family protein	NA	NA	NA	NA	NA
WP_014501534.1|4514665_4515682_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010370565.1|4515783_4516104_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_044751278.1|4516489_4516939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501532.1|4516965_4517442_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_014501531.1|4517783_4519007_-	MFS transporter	NA	NA	NA	NA	NA
WP_149621888.1|4519111_4519723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047339451.1|4519943_4520693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712153.1|4520883_4522230_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_024712154.1|4522214_4523657_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014501526.1|4523706_4525434_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_024712156.1|4525793_4526390_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_024712157.1|4526712_4527738_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014501523.1|4527753_4528266_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_014501522.1|4528375_4528810_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_024712158.1|4528885_4529308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712159.1|4529336_4529807_-	thioesterase	NA	NA	NA	NA	NA
WP_047339450.1|4530077_4530887_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_076342529.1|4531062_4531866_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_149621889.1|4531969_4532947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501516.1|4532943_4534209_+	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_047339447.1|4534633_4535098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712162.1|4535248_4536544_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_082351970.1|4536615_4537518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621228.1|4539433_4540197_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_154583350.1|4540345_4540672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4540791_4541760_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_149622017.1|4542139_4542388_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_048483807.1|4543510_4543882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621890.1|4543929_4544886_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.3e-42
>prophage 20
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	4605814	4620360	4793207	transposase	Staphylococcus_prophage(50.0%)	13	NA	NA
WP_149621896.1|4605814_4606771_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	3.7e-42
WP_149621897.1|4607131_4607596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4607969_4608938_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044751314.1|4609222_4610179_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.3e-42
WP_149621899.1|4610153_4610693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149621900.1|4610745_4611516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076342625.1|4611985_4612258_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_149621901.1|4612610_4612853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4612903_4613872_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_161600054.1|4615751_4617356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621903.1|4617352_4617751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749826.1|4617889_4618846_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_149622018.1|4618983_4620360_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	62.4	1.7e-77
>prophage 21
NZ_CP043403	Xanthomonas oryzae pv. oryzicola strain GX01 chromosome, complete genome	4793207	4661718	4715803	4793207	protease,transposase	Ralstonia_phage(22.22%)	36	NA	NA
WP_033005488.1|4661718_4662210_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_149621909.1|4662206_4662437_+	esterase	NA	NA	NA	NA	NA
WP_047339429.1|4662506_4662905_+	host attachment protein	NA	NA	NA	NA	NA
WP_024712269.1|4663902_4665150_+	MFS transporter	NA	NA	NA	NA	NA
WP_047339427.1|4665508_4665982_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_048483759.1|4666177_4666972_+	EcsC family protein	NA	NA	NA	NA	NA
WP_024712271.1|4667125_4667788_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_149621910.1|4668277_4669376_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	5.1e-40
WP_149621911.1|4669722_4670745_+	sugar kinase	NA	NA	NA	NA	NA
WP_014501394.1|4671376_4672585_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011258802.1|4672981_4673950_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_149621228.1|4674206_4674970_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_047340426.1|4675339_4675651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149621912.1|4675814_4676771_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	2.1e-42
WP_024712632.1|4678895_4679462_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_149621913.1|4679608_4680775_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_149621914.1|4680887_4681763_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.7	7.9e-84
WP_149621915.1|4681733_4682384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162527340.1|4683047_4685186_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	2.4e-65
WP_024712580.1|4685341_4686544_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_044751337.1|4686814_4687825_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.2	1.0e-47
WP_149621917.1|4687960_4688926_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014501379.1|4689715_4689946_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_014501378.1|4690012_4690675_-	hemolysin III	NA	NA	NA	NA	NA
WP_044751352.1|4690852_4693348_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.2e-07
WP_149621918.1|4693344_4695165_+	exonuclease	NA	NA	NA	NA	NA
WP_024711848.1|4695640_4697785_-	avirulence protein	NA	NA	NA	NA	NA
WP_014501372.1|4697975_4699133_-	ROK family protein	NA	NA	NA	NA	NA
WP_014501371.1|4699305_4701894_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014501370.1|4701904_4702690_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_011407253.1|4705293_4705599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080344353.1|4705809_4706997_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	8.6e-41
WP_011257161.1|4707143_4707524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044751345.1|4707725_4712198_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_149621919.1|4712392_4713874_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_149621920.1|4714426_4715803_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	1.5e-76
