The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	172027	242915	4591632	transposase,plate,tRNA,protease	Shigella_phage(17.65%)	59	NA	NA
WP_000753940.1|172027_173452_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	6.5e-27
WP_000272188.1|174851_175238_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186650.1|175551_176376_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094600.1|176406_179079_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|179140_179935_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246888.1|180302_181028_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|181285_182137_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|182283_183009_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|183300_183858_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811938.1|183949_185146_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|185334_186093_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|186105_186963_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005053372.1|186974_188327_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|188356_190789_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|190910_191396_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|191399_192425_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|192529_192985_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|192988_193777_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000132065.1|193776_194925_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569431.1|194921_195518_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.8e-26
WP_001294739.1|195554_199037_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|199049_200009_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021013.1|200107_202249_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|202305_202695_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176576.1|202759_204058_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|204106_204367_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000553593.1|204353_204593_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|204718_205264_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635538.1|205260_205683_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239155.1|205696_206407_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_005053355.1|206561_207386_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|207438_209157_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094030.1|209267_209975_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202325.1|209971_210376_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|210493_211309_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294596.1|211348_212002_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593997.1|211994_213026_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|213213_213789_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997035.1|219547_220351_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	1.6e-38
WP_005093015.1|220389_221736_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000648578.1|221785_222700_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|222940_223741_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211683.1|223818_224589_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644679.1|224636_225983_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	3.7e-08
WP_001052754.1|226054_226810_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005060310.1|226843_227566_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|227562_228030_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|228094_228826_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000402248.1|229165_230212_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000371478.1|230781_232665_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001276640.1|232680_233175_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_094108335.1|234955_236228_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	6.8e-177
WP_000343116.1|236285_236573_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.8e-29
WP_000747032.1|236586_237755_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000785540.1|237844_238693_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	98.6	2.1e-102
WP_000627639.1|238692_239148_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	8.8e-87
WP_000964877.1|239150_239843_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.1e-111
WP_000246949.1|239852_241184_+	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	99.8	3.1e-217
WP_005060393.1|241184_242915_+	lytic transglycosylase domain-containing protein	NA	A0A088CQ71	Enterobacteria_phage	98.1	3.1e-281
>prophage 2
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	648973	755320	4591632	capsid,terminase,tRNA,transposase,head,tail,holin	Enterobacteria_phage(36.21%)	104	NA	NA
WP_001157892.1|648973_651556_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	1.4e-184
WP_001269672.1|651570_652152_+	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_000620544.1|652151_653183_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_000838889.1|653184_653826_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_001241888.1|653849_654461_+	adenosylcobalamin/alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_001161664.1|654720_655038_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_000776104.1|655041_655509_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_000776197.1|655539_657441_+	peptidoglycan DD-transpeptidase MrdA	NA	NA	NA	NA	NA
WP_000131719.1|657443_658556_+	peptidoglycan glycosyltransferase MrdB	NA	NA	NA	NA	NA
WP_001231405.1|658566_659655_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092085.1|659793_661005_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.2	7.5e-101
WP_000850550.1|661115_661379_+	YbeD family protein	NA	NA	NA	NA	NA
WP_000284045.1|661479_662121_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_000378035.1|662379_663333_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000042632.1|663541_664507_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_000503931.1|664607_664811_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_005049482.1|664939_665728_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_000939741.1|665820_666204_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|666257_666467_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_005049488.1|666641_667202_-	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_000955063.1|667790_669176_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000833599.1|669895_670405_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_077696331.1|670567_670813_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	63.2	6.1e-18
WP_094081558.1|672483_673639_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_011069283.1|673651_673927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627468.1|673923_674865_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	85.6	2.3e-153
WP_005060669.1|675009_675366_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	87.4	4.7e-51
WP_000873153.1|675369_676590_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	85.6	2.5e-192
WP_000184977.1|676593_677337_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
WP_149617741.1|677227_678694_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.0	1.6e-259
WP_005020049.1|678693_678927_-	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	65.8	6.2e-20
WP_005098291.1|678914_679454_-	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	61.4	6.6e-49
WP_094081542.1|679438_680667_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_000204761.1|680742_681426_-|terminase	PBSX family phage terminase large subunit	terminase	K4NXU1	Acinetobacter_phage	73.4	7.0e-96
WP_001108106.1|681376_682141_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	55.4	7.0e-12
WP_011069285.1|682335_682848_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_128567431.1|682980_683172_-	hypothetical protein	NA	Q76H62	Enterobacteria_phage	98.4	1.3e-28
WP_000747032.1|683254_684422_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000988183.1|684451_685330_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	95.6	3.0e-139
WP_000211324.1|685326_686718_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.7	3.6e-256
WP_001064799.1|686714_686972_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	93.8	1.1e-33
WP_000111769.1|687066_687267_+	protein ninH	NA	A0A088CC23	Shigella_phage	74.2	1.1e-20
WP_001204832.1|687259_687640_+	antitermination protein	NA	A0A088CD47	Shigella_phage	87.9	8.2e-62
WP_000839566.1|688442_688658_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	94.4	2.2e-32
WP_005083349.1|688661_689291_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	57.6	4.7e-30
WP_001274722.1|689356_689890_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.6e-100
WP_128567432.1|690106_690301_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	100.0	2.5e-27
WP_094081493.1|690352_691508_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_024260032.1|691831_693742_+|terminase	phage terminase large subunit family protein	terminase	K7P6G6	Enterobacteria_phage	64.1	5.3e-250
WP_000259004.1|693742_693946_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	57.4	8.6e-10
WP_001254019.1|695525_697031_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	4.3e-98
WP_000256830.1|697067_697415_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	6.4e-21
WP_000522647.1|697472_698501_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.8	1.8e-116
WP_000201488.1|698552_698939_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000348593.1|698950_699328_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	57.3	2.5e-31
WP_000677140.1|699314_699899_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	87.6	6.0e-88
WP_001079407.1|699895_700297_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	94.0	1.1e-69
WP_000211126.1|700307_701048_+	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	96.7	1.5e-128
WP_000478927.1|701106_701493_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_001161004.1|701501_701831_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_000371983.1|701802_704844_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
WP_000447264.1|704843_705173_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_001152490.1|705172_705871_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000194740.1|705875_706619_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_000090877.1|706555_707158_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_001152490.1|709536_710235_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000194740.1|710239_710983_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_000090877.1|710919_711522_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_000515521.1|711582_715062_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_001230368.1|715129_715729_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	6.1e-104
WP_000930145.1|717154_717778_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
WP_000801162.1|717957_719721_-	invasion plasmid antigen	NA	NA	NA	NA	NA
WP_000767391.1|720303_720780_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_005048541.1|720838_722128_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000951226.1|722214_723255_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000118810.1|723251_724406_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000246759.1|724392_725148_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000044878.1|725140_725818_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000042516.1|726396_728418_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_005048534.1|728609_729518_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_005048531.1|729914_730904_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_000084630.1|730925_731438_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_000080885.1|731440_731926_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000598624.1|731918_732164_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000852286.1|732165_732618_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000373626.1|732754_733459_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000446914.1|733663_734377_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000045466.1|734412_735369_-	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000650363.1|735368_736610_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_001113348.1|736606_737368_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000871982.1|737500_737911_+	YbhQ family protein	NA	NA	NA	NA	NA
WP_000469031.1|737872_738979_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000070107.1|738989_740123_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000996107.1|740115_741852_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|741844_742840_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|742842_743514_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001145124.1|745136_745619_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	1.3e-35
WP_005048497.1|745738_747889_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.6	3.1e-41
WP_000386531.1|747916_748879_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443521.1|749019_750105_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|750333_750594_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000135439.1|750858_751125_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	4.0e-07
WP_000990151.1|751198_751876_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	3.4e-18
WP_005083739.1|753973_755320_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	832916	952035	4591632	integrase,transposase,tRNA,protease	Stx2-converting_phage(17.78%)	89	884041:884100	900222:900696
WP_094085506.1|832916_834190_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001298299.1|834585_835281_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|836481_838140_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_005067329.1|838136_839093_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_047343235.1|839243_840359_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188161.1|840355_842302_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	5.5e-37
WP_000410785.1|842374_842599_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|842921_843242_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934033.1|843272_845549_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	4.3e-166
WP_001040187.1|846292_846511_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|846795_847500_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202220.1|847541_849263_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043574.1|849263_851030_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	4.6e-22
WP_000537402.1|851152_852118_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	3.2e-62
WP_000228473.1|852661_853156_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077083.1|853290_857319_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|857473_858085_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067746.1|858095_859439_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	4.3e-81
WP_000886683.1|859529_860822_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000213098.1|863515_864133_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534651.1|864134_864926_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165870.1|864961_865588_-	hydrolase	NA	NA	NA	NA	NA
WP_000109301.1|865902_867051_+	MFS transporter	NA	NA	NA	NA	NA
WP_004967157.1|867363_868038_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_005048975.1|868034_868385_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_005063916.1|868381_869983_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.6	1.2e-146
WP_087880099.1|870522_871691_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_000228005.1|871874_872165_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	9.6e-47
WP_094081518.1|872462_873618_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_000687442.1|874069_874357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882657.1|874606_874819_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
WP_029716636.1|874989_875655_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_005048249.1|875823_876180_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	5.1e-58
WP_001118167.1|876237_876660_-	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
WP_000702036.1|878282_878705_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	3.8e-68
WP_000912291.1|878688_878916_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787424.1|878992_879400_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_001091985.1|879602_879758_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.2e-07
WP_001005968.1|879759_879963_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	1.0e-10
WP_094081542.1|880204_881433_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_000935590.1|881980_882829_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	57.0	9.7e-55
WP_094108368.1|883342_884471_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.9	1.0e-59
884041:884100	attL	GCTGGCATCAAAGATGTTTATACGTGCGAAATTGTCGGCTACGCCATGGGAGAGCGCATG	NA	NA	NA	NA
WP_094081550.1|885484_886641_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_005061679.1|886706_887324_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.7e-81
WP_001039888.1|887323_887503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011110560.1|887503_889330_-	invasion protein	NA	NA	NA	NA	NA
WP_005061694.1|889820_889952_+	hypothetical protein	NA	A0A0C4UR34	Shigella_phage	86.7	2.6e-07
WP_000815445.1|890211_891207_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_000723652.1|892384_893437_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_001036463.1|893512_894946_+	anion permease	NA	NA	NA	NA	NA
WP_000593940.1|895128_897309_+	hydratase	NA	NA	NA	NA	NA
WP_001091542.1|897449_898733_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_024219169.1|898867_899749_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001088287.1|901581_902256_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
900222:900696	attR	CATGCGCTCTCCCATGGCGTAGCCGACAATTTCGCACGTATAAACATCTTTGATGCCAGCGAGGTACAACCATCCCTCCTGTGTGGCAACATACGTCAGGTCCGCCACCCAGACCTGATTTGGTGCTGTAGGAGCGAACGTCTGGTTCAGCAGATTTGGCGCAACTGGCAGATTGTGGTTCGGGTTCGTAGTCGCTCTGAACTTGCGTTTCTGCTTACAGCGTAGCCTCAGCTCCTTACGAAGACGTGCCAGTCGGTCACGACCAACGATGATGCCATTCTCTGCCAGCTCCGTCTGGAGCCGCCGGGTTCCATATGTTTCGCGAGTGCGGATATGTGCCACCTTAATCTCCAGTTTTAACCGCTCATCACTTTGTTTTCTGTCTGAGGGTTCATGCTGTACCCAGTTGTAATAACCGCTCCTGGATACACCAAATACCTGACACATCGCTTCAATGGGAAATTGTTGTCGCCAT	NA	NA	NA	NA
WP_005048975.1|902252_902603_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_000638232.1|904340_904529_+|transposase	transposase domain-containing protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	4.5e-05
WP_128874903.1|905905_906550_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094081495.1|907003_908159_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_094105059.1|908065_908392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094081495.1|909020_910177_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_000111043.1|910585_911326_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292813.1|911517_913800_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	4.9e-162
WP_000642544.1|913854_914712_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_149617743.1|915117_916878_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000057149.1|917832_918921_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445222.1|918991_920275_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005093015.1|920400_921747_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001295345.1|921882_922647_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125013.1|922819_923503_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|923613_925287_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|925446_925731_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000551266.1|928233_929982_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000570540.1|929978_930965_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056529.1|931001_932234_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|932285_932468_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011599.1|932464_933211_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|933364_934258_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899599.1|934234_935014_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_005047510.1|935149_935935_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|935931_937254_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|937234_937939_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572706.1|937938_942399_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_005083739.1|942543_943890_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000925980.1|944097_945945_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|946125_946674_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|946700_947348_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462668.1|947570_948761_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977934.1|948945_950034_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|950634_952035_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
>prophage 4
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	1041322	1078818	4591632	transposase	Acinetobacter_phage(33.33%)	28	NA	NA
WP_000937577.1|1041322_1042510_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000124119.1|1042509_1042875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000154398.1|1043695_1044823_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199452.1|1044828_1046094_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_005047400.1|1046700_1047489_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	8.6e-90
WP_085947598.1|1047598_1048761_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000611853.1|1049352_1050339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000283673.1|1051846_1052584_+	zinc-binding phosphatase	NA	NA	NA	NA	NA
WP_001001917.1|1052607_1053162_+	molecular chaperone YcdY	NA	NA	NA	NA	NA
WP_001297187.1|1053263_1053755_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001264088.1|1054620_1055037_-	curli production assembly/transport protein CsgF	NA	NA	NA	NA	NA
WP_000833291.1|1055061_1055451_-	curli production assembly/transport protein CsgE	NA	NA	NA	NA	NA
WP_000481500.1|1055455_1056106_-	transcriptional regulator CsgD	NA	NA	NA	NA	NA
WP_005047380.1|1056859_1057315_+	curlin minor subunit CsgB	NA	NA	NA	NA	NA
WP_001144017.1|1058590_1058956_+	curlin major subunit CsgA	NA	NA	NA	NA	NA
WP_000992821.1|1059014_1059347_+	curli assembly protein CsgC	NA	NA	NA	NA	NA
WP_000489563.1|1059467_1059779_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000857408.1|1059873_1060407_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
WP_011069326.1|1060348_1061830_+	cardiolipin synthase ClsC	NA	NA	NA	NA	NA
WP_001070350.1|1061837_1062995_-	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
WP_011069327.1|1063388_1064924_+	glucans biosynthesis protein MdoG	NA	NA	NA	NA	NA
WP_001295445.1|1064916_1067460_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_000937577.1|1067875_1069063_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000124119.1|1069062_1069428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818777.1|1072485_1072731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087880099.1|1072800_1073968_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_094081542.1|1074541_1075769_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_094081550.1|1077662_1078818_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
>prophage 5
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	1151705	1165170	4591632	portal,integrase,terminase,head,tail,protease	uncultured_Caudovirales_phage(90.91%)	21	1141984:1141998	1161038:1161052
1141984:1141998	attL	ACTGAATAACCGCAT	NA	NA	NA	NA
WP_000085257.1|1151705_1152935_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953271.1|1153309_1153498_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_154074686.1|1153547_1153877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103622.1|1154001_1154181_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
WP_000226783.1|1154310_1154511_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005005155.1|1154500_1154722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204964.1|1154936_1155170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770157.1|1155175_1155475_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761798.1|1155471_1157220_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.5	3.3e-89
WP_000557473.1|1157508_1157787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294165.1|1157783_1158089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126624.1|1158098_1158260_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132078.1|1158401_1158626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000504054.1|1160123_1160696_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_168219891.1|1160697_1161909_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.2	1.5e-186
1161038:1161052	attR	ATGCGGTTATTCAGT	NA	NA	NA	NA
WP_001020662.1|1161905_1162244_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134107.1|1162240_1162537_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.2	2.2e-30
WP_001145905.1|1162536_1162977_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|1162960_1163143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029716858.1|1163198_1163525_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	79.6	9.2e-46
WP_000127901.1|1163508_1165170_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	4.4e-277
>prophage 6
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	1362498	1383272	4591632	integrase,transposase,tail	Escherichia_phage(52.63%)	21	1368392:1368405	1381915:1381928
WP_094081493.1|1362498_1363655_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_094105053.1|1364182_1365456_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
WP_000788998.1|1366249_1366996_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	88.8	1.4e-121
WP_001118167.1|1367010_1367433_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
WP_005048249.1|1367490_1367847_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	5.1e-58
WP_000256998.1|1367939_1368158_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
WP_001229298.1|1368159_1368525_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	2.5e-68
1368392:1368405	attL	TTATCAGTGATGGT	NA	NA	NA	NA
WP_000208062.1|1368521_1369187_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	44.9	6.1e-36
WP_000610655.1|1369186_1369552_+	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	53.7	6.1e-30
WP_000018421.1|1369949_1370162_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000940329.1|1371485_1372085_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	1.4e-108
WP_000228038.1|1372084_1372375_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000640143.1|1372371_1372926_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	3.7e-71
WP_005049799.1|1373066_1373252_+	hypothetical protein	NA	A0A291AWU3	Escherichia_phage	63.4	1.5e-05
WP_094081550.1|1373313_1374469_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_045178261.1|1374516_1375023_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	73.2	1.9e-42
WP_000615489.1|1375656_1377261_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_094106009.1|1378018_1379187_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	6.8e-184
WP_134795493.1|1379210_1379369_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_011069357.1|1381043_1381412_+	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	55.4	2.6e-20
WP_051122911.1|1382003_1383272_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	43.2	5.7e-75
1381915:1381928	attR	ACCATCACTGATAA	NA	NA	NA	NA
>prophage 7
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	1547784	1604650	4591632	transposase,holin	Shigella_phage(22.73%)	58	NA	NA
WP_000534858.1|1547784_1548024_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|1548023_1548311_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|1548382_1548538_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980987.1|1548755_1549007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265249.1|1549353_1550403_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.2e-108
WP_000904111.1|1550415_1550772_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_000762882.1|1550786_1551608_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_000871291.1|1552906_1553242_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|1553501_1553690_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323614.1|1553686_1553848_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_000372594.1|1553997_1554177_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	91.5	4.1e-24
WP_094108347.1|1554201_1555358_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	7.5e-66
WP_000527804.1|1556527_1557988_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_000214712.1|1558023_1558227_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|1558404_1559091_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_005050098.1|1559179_1559926_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_005068122.1|1560062_1562108_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024558.1|1562152_1562671_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_094108358.1|1563236_1564392_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	6.8e-67
WP_000901367.1|1564640_1564736_-	protein MgtS	NA	NA	NA	NA	NA
WP_000212732.1|1564862_1565981_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087224.1|1566244_1567144_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803661.1|1567174_1567393_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|1567424_1567808_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|1567827_1568262_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885035.1|1568473_1569139_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210809.1|1569163_1570354_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000258546.1|1570503_1571619_-	putative protein YneK	NA	NA	NA	NA	NA
WP_005050114.1|1571698_1572634_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000257419.1|1572697_1573624_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191025.1|1573623_1573968_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000558037.1|1574121_1575540_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	1.1e-18
WP_000854655.1|1575766_1576846_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000957853.1|1578350_1578539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005050130.1|1578739_1579654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286595.1|1579657_1580416_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558531.1|1580455_1580746_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001191842.1|1580769_1581540_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000113157.1|1582982_1583885_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000154339.1|1583963_1584917_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_149617746.1|1585165_1586701_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000911160.1|1586694_1587723_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|1587722_1588715_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_167389525.1|1589964_1591192_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.9e-177
WP_085949497.1|1591242_1592390_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_005050183.1|1592466_1593681_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	2.4e-46
WP_001295395.1|1593886_1594213_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_000705197.1|1594347_1594689_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001321287.1|1595286_1595997_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_005050191.1|1596104_1596410_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_005091980.1|1596608_1596929_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
WP_000207512.1|1598740_1599730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971490.1|1599814_1600306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024194789.1|1600416_1600614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199921.1|1600626_1601127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091025.1|1601116_1601632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113584.1|1602062_1602431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087880099.1|1603481_1604650_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
>prophage 8
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	1771533	1806829	4591632	transposase	Shigella_phage(42.86%)	30	NA	NA
WP_000937575.1|1771533_1772721_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_005050384.1|1772991_1773657_-	colanic acid/biofilm transcriptional regulator McbR	NA	NA	NA	NA	NA
WP_005050386.1|1773854_1774892_-	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_167550002.1|1775021_1776250_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	6.5e-177
WP_000027560.1|1776408_1776927_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_001076516.1|1776923_1777373_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000018633.1|1777373_1777607_-	YdcY family protein	NA	NA	NA	NA	NA
WP_032323992.1|1777692_1777866_-	orphan toxin OrtT	NA	NA	NA	NA	NA
WP_001303494.1|1778060_1778156_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_000867989.1|1778557_1779367_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	5.9e-17
WP_001163923.1|1779576_1781001_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000555458.1|1781022_1781817_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000937573.1|1782655_1783843_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001260991.1|1785455_1786112_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586723.1|1786414_1787008_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_005047890.1|1787004_1787997_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234071.1|1788120_1789101_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000140890.1|1789095_1789632_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1789694_1789919_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375966.1|1790058_1791714_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013771.1|1791938_1793282_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414573.1|1793498_1794422_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098545.1|1794459_1796100_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_094081542.1|1797721_1798950_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_094081541.1|1799016_1800173_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.0e-68
WP_023517637.1|1800547_1800697_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1800768_1800942_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|1801186_1801717_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115920.1|1802947_1804387_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_094106009.1|1805661_1806829_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	6.8e-184
>prophage 9
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	1833868	1934514	4591632	integrase,transposase,tRNA,tail	Enterobacteria_phage(35.0%)	85	1851413:1851472	1916505:1916943
WP_000081423.1|1833868_1834804_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	3.2e-144
WP_000123730.1|1834932_1836300_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.2e-51
WP_000387377.1|1836777_1837761_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_011069405.1|1840085_1841540_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_000957853.1|1842044_1842233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587200.1|1843604_1844252_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000156575.1|1844348_1845164_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000945011.1|1845707_1846223_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000611911.1|1846417_1847170_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_001262123.1|1847321_1848272_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000124119.1|1849675_1850041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937575.1|1850040_1851228_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
1851413:1851472	attL	CGATGAACCCCGAACACATGGCAGAGTGTGACCACAGGATAATGCGCTCTGAGTTTCCCG	NA	NA	NA	NA
WP_000559908.1|1851903_1852935_+	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_000683016.1|1852985_1854599_-	murein tripeptide ABC transporter substrate-binding protein MppA	NA	NA	NA	NA	NA
WP_005127484.1|1858048_1858330_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_001189099.1|1858295_1858688_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.8	2.0e-31
WP_000976476.1|1859775_1860117_-	YebY family protein	NA	NA	NA	NA	NA
WP_000168747.1|1861005_1861380_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1861518_1861749_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000944268.1|1862530_1863193_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	3.5e-07
WP_000936980.1|1863189_1865250_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024751.1|1865459_1866119_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_005047608.1|1866445_1866802_-	protein YebF	NA	NA	NA	NA	NA
WP_000173488.1|1867292_1868471_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|1868526_1869168_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069479.1|1869204_1871016_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301736.1|1871250_1872726_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056694.1|1873063_1873933_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000044417.1|1874060_1875503_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448385.1|1875633_1876605_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|1876724_1878047_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|1878062_1878995_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202992.1|1879073_1879829_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	3.8e-18
WP_000571470.1|1879825_1880611_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568525.1|1880757_1881768_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.2	2.8e-08
WP_000580324.1|1881776_1882388_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1882526_1882592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|1882661_1883264_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000974712.1|1883265_1883787_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|1883821_1884562_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|1884590_1885043_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258670.1|1885160_1886933_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891627.1|1887242_1887497_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_005047585.1|1887688_1888885_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001210039.1|1889613_1889862_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	4.1e-38
WP_005031414.1|1890460_1892212_+	T3SS effector E3 ubiquitin-protein ligase IpaH2	NA	NA	NA	NA	NA
WP_000930145.1|1892391_1893015_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
WP_001230368.1|1894440_1895040_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	6.1e-104
WP_000515521.1|1895107_1898587_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
WP_000090877.1|1898647_1899250_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_000194740.1|1899186_1899930_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
WP_001152490.1|1899934_1900633_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
WP_000447264.1|1900632_1900962_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
WP_000371983.1|1900961_1904003_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
WP_001161004.1|1903974_1904304_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
WP_000478927.1|1904312_1904699_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
WP_005047550.1|1904757_1905498_-	Ig-like domain-containing protein	NA	A5LH35	Enterobacteria_phage	96.3	4.9e-127
WP_001079406.1|1905508_1905910_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	97.7	1.6e-71
WP_000677116.1|1905906_1906497_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	78.2	7.4e-78
WP_000753026.1|1906483_1906855_-|tail	tail attachment protein	tail	NA	NA	NA	NA
WP_001074423.1|1906866_1907268_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	66.2	3.3e-37
WP_005049126.1|1907531_1908728_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001064885.1|1909913_1910603_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.4	2.9e-57
WP_001215517.1|1910599_1910959_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.1	8.3e-40
WP_000248820.1|1910958_1911096_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	100.0	1.9e-16
WP_000755956.1|1912816_1913644_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	94.5	2.3e-125
WP_001099210.1|1913687_1914437_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	96.0	1.7e-135
WP_000586688.1|1914433_1915003_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	6.8e-28
WP_000457719.1|1915126_1915369_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	85.0	6.2e-31
WP_001030133.1|1915372_1915519_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	1.4e-22
WP_000528720.1|1915527_1915725_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.2	3.7e-26
WP_094108353.1|1915699_1916868_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	1.3e-182
WP_000905997.1|1917097_1917448_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
1916505:1916943	attR	CGATGAACCCCGAACACATGGCAGAGTGTGACCACAGGATAATGCGCTCTGAGTTTCCCGATTATCGAGAACTGTTCAGGGAGTCTGACATCAAGAGCGCGGTAGCCTTTTTTAATATTTCATTCTCCATTTCAATGCGTTGTAGCTTTTTCCTGAGCTCACGGATTTCAATTTGTTCCGGGGTAATGGGGGAGGCTTTTGGTGTTTTGCCCTGACGCTCATCACGCAGTTGTTTGACCCATCTTGTCATTGTGGAAAGGCCAACATCCATAGCTTTGGCGGCATCTGCCACCGTGTATTTCTGGTCAACAACCAGTTGAGCGGATTCGCGTTTAAACTCTGCGCTAAAATTTCTTTTTTTCATTGGAGCACCTGTGTTGTTCTGAGGTGAGCATATCACCTCTGTTCAGGTGGCCAAATTCAGTGTGCCACTTCACCC	NA	NA	NA	NA
WP_005048647.1|1917500_1917896_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|1917936_1918680_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564755.1|1918676_1919648_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_001229400.1|1919812_1922242_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214308.1|1922266_1923367_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|1923754_1924501_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005048653.1|1924514_1925081_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025297.1|1925296_1927030_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_005063152.1|1927206_1927695_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259572.1|1929161_1929500_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000455174.1|1932952_1933411_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_094108353.1|1933345_1934514_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	1.3e-182
>prophage 10
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	2004857	2068759	4591632	tail,transposase,holin,integrase	Stx2-converting_phage(23.33%)	51	1996234:1996247	2071619:2071632
1996234:1996247	attL	CTGACTGGTGGTTT	NA	NA	NA	NA
WP_094081536.1|2004857_2006005_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.5e-146
WP_111778310.1|2006843_2008072_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	9.8e-173
WP_000218218.1|2009715_2010567_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826719.1|2010674_2012033_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|2012032_2012704_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|2012836_2013250_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_149617750.1|2014363_2014999_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007781.1|2015256_2015907_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000937511.1|2016984_2017254_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
WP_000239881.1|2017310_2017979_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014532281.1|2018294_2019938_+	T3SS effector E3 ubiquitin-protein ligase IpaH4/H7	NA	NA	NA	NA	NA
WP_000594909.1|2022342_2022825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785377.1|2022892_2024842_-|tail	phage tail tape measure protein	tail	Q8W620	Enterobacteria_phage	98.2	0.0e+00
WP_001251340.1|2024926_2025262_-|tail	phage tail assembly protein	tail	Q8W621	Enterobacteria_phage	97.2	9.8e-51
WP_001062338.1|2025261_2025618_-|tail	phage tail tube protein	tail	Q8W622	Enterobacteria_phage	98.3	5.3e-63
WP_000155744.1|2025617_2027114_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8W623	Enterobacteria_phage	97.4	5.9e-273
WP_000497744.1|2027110_2027272_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	76.6	9.2e-15
WP_094081529.1|2027665_2028822_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
WP_005049241.1|2029696_2030047_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
WP_004967157.1|2030043_2030718_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_000839572.1|2030816_2031032_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_005049343.1|2031832_2032516_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
WP_000140020.1|2032512_2032878_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.1	7.1e-39
WP_001265248.1|2032878_2033937_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	2.6e-89
WP_011069426.1|2033938_2034217_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.0	4.5e-09
WP_000935258.1|2034384_2034597_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_005069274.1|2035191_2035608_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.5e-24
WP_004974968.1|2035774_2036812_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001325918.1|2037022_2037820_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_094081534.1|2039526_2040695_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	8.9e-184
WP_005063096.1|2040756_2041260_+	MFS transporter	NA	NA	NA	NA	NA
WP_094081533.1|2041321_2042477_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_001060217.1|2042829_2044284_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532920.1|2044626_2045343_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001010988.1|2047719_2048670_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011445.1|2048771_2049689_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986341.1|2050147_2051083_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001165576.1|2051144_2052224_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005049317.1|2052235_2052979_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000261572.1|2052975_2053485_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_094081558.1|2053496_2054653_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
WP_001016348.1|2056682_2056865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2056965_2057295_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_005088730.1|2057466_2057766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004967157.1|2057835_2058510_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_045177795.1|2060162_2061764_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	3.2e-147
WP_149617751.1|2063078_2064235_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.5e-66
WP_094081542.1|2064599_2065828_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_005049241.1|2066819_2067170_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
WP_004967157.1|2067166_2067841_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
WP_001007949.1|2067919_2068759_-|integrase	integrase family protein	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.6	1.3e-160
2071619:2071632	attR	AAACCACCAGTCAG	NA	NA	NA	NA
>prophage 11
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	2095783	2102090	4591632		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100804.1|2095783_2096329_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
WP_000857518.1|2096333_2097212_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
WP_001023623.1|2097270_2098170_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	4.4e-29
WP_000699404.1|2098169_2099255_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_000183041.1|2099627_2100521_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_001116126.1|2100695_2102090_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	1.8e-18
>prophage 12
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	2129811	2210757	4591632	tail,transposase,tRNA	Enterobacteria_phage(53.33%)	54	NA	NA
WP_005049144.1|2129811_2131008_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000275665.1|2134236_2135085_-	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_000489605.1|2136582_2136804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805244.1|2136999_2138523_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000119071.1|2138519_2139281_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_000003197.1|2139277_2139937_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_005049126.1|2140370_2141567_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000667591.1|2145743_2148809_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_000130872.1|2148809_2150225_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675144.1|2150221_2151625_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137862.1|2151621_2152344_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	3.7e-31
WP_000929408.1|2152534_2152867_+	YegP family protein	NA	NA	NA	NA	NA
WP_005049106.1|2153013_2154375_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	7.1e-217
WP_001295425.1|2154716_2155034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807346.1|2155439_2156339_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
WP_000178554.1|2156420_2157200_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844251.1|2157299_2158340_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490711.1|2159164_2160520_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823288.1|2160523_2160808_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182919.1|2160838_2161291_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853873.1|2161300_2162563_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_005049088.1|2162591_2163446_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129574.1|2163753_2164806_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000011982.1|2165845_2166811_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|2166784_2167531_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005092299.1|2167578_2168400_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	35.7	1.5e-20
WP_000822271.1|2168464_2169265_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195611.1|2169261_2170050_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2170272_2170545_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134566.1|2170666_2170996_+	nickel/cobalt efflux transporter RcnA	NA	NA	NA	NA	NA
WP_000546036.1|2171023_2171497_+	nickel/cobalt efflux transporter RcnA	NA	NA	NA	NA	NA
WP_000153074.1|2171715_2172054_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000945432.1|2173184_2175665_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677404.1|2175680_2176355_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830460.1|2176435_2176960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011110605.1|2178029_2178311_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005437.1|2178572_2179682_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_005049047.1|2179813_2181847_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.0e-54
WP_094081509.1|2182242_2183398_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_000636931.1|2191540_2191948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2192489_2193578_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294428.1|2193588_2195868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005049026.1|2195860_2196997_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001087240.1|2196993_2198997_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_005049020.1|2199897_2200359_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	1.6e-75
WP_005063442.1|2200399_2200870_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	98.7	2.6e-81
WP_005048999.1|2200916_2201636_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2201632_2203318_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000483772.1|2203525_2204872_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001261936.1|2205269_2205518_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	97.6	4.1e-38
WP_000937511.1|2205633_2205903_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
WP_000239881.1|2205959_2206628_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014532281.1|2206943_2208587_+	T3SS effector E3 ubiquitin-protein ligase IpaH4/H7	NA	NA	NA	NA	NA
WP_149617752.1|2209341_2210757_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	54.0	2.6e-76
>prophage 13
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	2672940	2727392	4591632	tail,transposase,tRNA	Enterobacteria_phage(26.67%)	43	NA	NA
WP_001295367.1|2672940_2673477_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|2673501_2674137_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013778.1|2674345_2675194_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011110613.1|2676577_2678404_+	invasion protein	NA	NA	NA	NA	NA
WP_134801165.1|2679137_2680427_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	42.6	4.9e-74
WP_000902877.1|2680450_2680996_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.1	2.5e-72
WP_011069472.1|2680998_2681517_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	53.0	3.5e-39
WP_148936977.1|2681580_2682808_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001181756.1|2683706_2684312_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.8	1.2e-30
WP_149617757.1|2685075_2686231_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	4.0e-67
WP_000054752.1|2687586_2687847_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_000128776.1|2688040_2688121_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986029.1|2688540_2688921_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004969731.1|2688920_2689652_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399400.1|2689663_2690392_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020747.1|2690403_2691309_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|2691305_2691986_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2692257_2693232_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|2693247_2695047_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589070.1|2695244_2695724_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812053.1|2695720_2696677_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168466.1|2696676_2697327_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|2697359_2697935_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|2697931_2698087_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001298974.1|2699949_2700687_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2700818_2702153_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_005051239.1|2702187_2703069_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000187873.1|2703171_2703759_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627802.1|2703814_2704198_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262715.1|2704502_2705192_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	5.5e-56
WP_000997396.1|2705239_2706277_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2706483_2706903_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001343689.1|2706971_2707670_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082966.1|2707701_2710362_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_005051257.1|2710475_2711831_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005085125.1|2711876_2712200_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2712196_2713495_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_000483772.1|2719328_2720675_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000197677.1|2720725_2721463_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079112.1|2721597_2722578_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040142.1|2722574_2723306_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_005051270.1|2723435_2726009_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.0e-127
WP_000483773.1|2726045_2727392_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	2818108	2828005	4591632	transposase	Pseudomonas_phage(50.0%)	6	NA	NA
WP_001272883.1|2818108_2820670_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_005051483.1|2821478_2822246_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.8e-69
WP_094092384.1|2823631_2824787_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	3.0e-67
WP_001192434.1|2824927_2827024_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	48.7	1.2e-173
WP_001249841.1|2827025_2827277_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	53.0	1.1e-17
WP_001224024.1|2827441_2828005_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	55.8	1.1e-35
>prophage 15
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	3010337	3069315	4591632	integrase,transposase,tRNA,protease	Enterobacteria_phage(33.33%)	41	3017003:3017018	3062135:3062150
WP_005051759.1|3010337_3011096_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|3011301_3012222_-	agmatinase	NA	NA	NA	NA	NA
WP_005096955.1|3013601_3015578_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_005051767.1|3015586_3015718_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_011110620.1|3015853_3016069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3016372_3017527_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
3017003:3017018	attL	ATTCTGCCCGCTGAAT	NA	NA	NA	NA
WP_001112298.1|3017963_3019358_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_005051770.1|3019434_3019932_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286517.1|3020026_3020734_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3020813_3021545_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593267.1|3021557_3022508_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3022616_3023180_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3023179_3023596_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055627.1|3023771_3024752_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997800.1|3024769_3025474_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094817.1|3025491_3026058_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3026054_3026345_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|3026352_3026946_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239924.1|3026938_3028075_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000577041.1|3029396_3029900_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378934.1|3030663_3031965_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745204.1|3032065_3033028_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394115.1|3033144_3034191_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984792.1|3034366_3035086_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107556.1|3035269_3035596_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3035595_3036315_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004972828.1|3036475_3037528_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3037555_3037831_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_005064048.1|3037895_3038975_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3039176_3040433_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_005099260.1|3040481_3042617_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234511.1|3043014_3043722_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218804.1|3044100_3045363_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
WP_000344102.1|3045815_3049331_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001034110.1|3051801_3055659_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
WP_000291751.1|3055705_3056287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001045650.1|3059101_3063220_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
3062135:3062150	attR	ATTCTGCCCGCTGAAT	NA	NA	NA	NA
WP_001189111.1|3063947_3065456_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001013320.1|3067150_3067576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271035.1|3067572_3067956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094108358.1|3068159_3069315_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	6.8e-67
>prophage 16
NZ_CP042980	Shigella flexneri Y strain PE577 chromosome, complete genome	4591632	4341160	4413648	4591632	integrase,transposase,tRNA,protease	Stx2-converting_phage(20.0%)	59	4337411:4337447	4411087:4411123
4337411:4337447	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACAT	NA	NA	NA	NA
WP_005063916.1|4341160_4342762_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.6	1.2e-146
WP_005048975.1|4342758_4343109_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
WP_001088287.1|4343105_4343780_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
WP_094081542.1|4343939_4345167_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
WP_011069602.1|4345366_4346053_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	1.1e-37
WP_005065417.1|4346200_4346884_+	YjiH family protein	NA	NA	NA	NA	NA
WP_000211962.1|4346880_4347342_+	membrane protein	NA	NA	NA	NA	NA
WP_000568430.1|4347354_4348527_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340761.1|4348591_4349503_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986206.1|4349495_4349888_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|4349884_4349968_-	iraD leader peptide	NA	NA	NA	NA	NA
WP_000062539.1|4351337_4352168_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000844157.1|4352308_4353082_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208167.1|4353296_4354757_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	2.1e-49
WP_000438582.1|4354837_4356022_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000558239.1|4356361_4357705_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_000816511.1|4357955_4358858_-	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000870598.1|4358877_4359381_-	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_001244836.1|4359393_4359924_-	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000066552.1|4363412_4364138_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000824103.1|4364174_4364714_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000695529.1|4364778_4365327_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000044711.1|4365807_4366404_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_001295734.1|4368937_4369654_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_005048917.1|4369673_4370780_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000991455.1|4370844_4371825_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.2	7.9e-101
WP_050597212.1|4373018_4373759_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094081518.1|4374581_4375737_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
WP_071829150.1|4376664_4376901_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000747032.1|4378062_4379230_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
WP_001218324.1|4379205_4380417_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.3	2.0e-77
WP_001299662.1|4380895_4381915_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_005054065.1|4382043_4383546_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	1.1e-82
WP_005054063.1|4383664_4384747_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|4384746_4385847_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397161.1|4386113_4387625_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.4	8.6e-46
WP_005054057.1|4387758_4388202_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416415.1|4388201_4391057_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000079652.1|4391110_4392307_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059407.1|4392499_4393003_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4393048_4393465_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012908.1|4393626_4394640_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000516533.1|4395419_4396148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000583469.1|4396270_4396723_-	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000256684.1|4396867_4397461_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500714.1|4397531_4398245_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230280.1|4398376_4398772_+	RidA family protein	NA	NA	NA	NA	NA
WP_011069607.1|4399052_4399187_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|4399190_4400126_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148585.1|4400138_4400600_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4400672_4401059_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471841.1|4401264_4403961_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	2.0e-45
WP_001387276.1|4404101_4404155_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181311.1|4404339_4405287_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001299664.1|4405405_4406827_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001344094.1|4406876_4408532_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187770.1|4408925_4411064_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.3	7.7e-266
WP_001106222.1|4411221_4411686_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
4411087:4411123	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACAT	NA	NA	NA	NA
WP_001162182.1|4412295_4413648_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
