The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034725	Pseudomonas brassicacearum strain 3Re2-7 chromosome, complete genome	6738544	1274618	1352842	6738544	protease,holin,bacteriocin,plate,tRNA,tail	Pseudomonas_phage(65.22%)	77	NA	NA
WP_013692379.1|1274618_1275437_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.9	1.7e-08
WP_003198207.1|1275554_1275959_-	SufE family protein	NA	NA	NA	NA	NA
WP_003198209.1|1275955_1277161_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	35.8	1.1e-67
WP_003198211.1|1277273_1278308_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_003198212.1|1278340_1278703_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_003198215.1|1278879_1280235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003198216.1|1280418_1282065_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_003198218.1|1282752_1283112_+	hypothetical protein	NA	B5TK57	Pseudomonas_phage	56.8	9.2e-23
WP_003198220.1|1283292_1283595_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_003198223.1|1283605_1283974_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	O64357	Escherichia_phage	42.5	6.8e-05
WP_003198225.1|1284120_1285320_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_003198227.1|1285456_1288159_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_003198229.1|1288203_1288986_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003198231.1|1289418_1290156_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003198233.1|1290350_1291214_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003198235.1|1291426_1292170_+	UMP kinase	NA	NA	NA	NA	NA
WP_003198238.1|1292166_1292724_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003198241.1|1292737_1293493_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	36.6	9.3e-17
WP_003198242.1|1293492_1294299_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003198244.1|1294295_1295486_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003198246.1|1295538_1296891_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003198248.1|1296965_1299341_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_003184901.1|1299386_1299890_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_003198250.1|1299893_1300949_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_003184897.1|1301054_1301495_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003198252.1|1301491_1302268_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_003198254.1|1302270_1303401_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_013692385.1|1303397_1304042_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.2	3.8e-27
WP_003198259.1|1304225_1307747_+	DNA polymerase III subunit alpha	NA	A0A1C9LWZ5	Streptomyces_phage	36.5	1.3e-198
WP_003198261.1|1307896_1308844_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_003198262.1|1308977_1310306_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_003198266.1|1310580_1312212_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.1	1.0e-156
WP_003198268.1|1312216_1313062_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	2.3e-48
WP_013692387.1|1313224_1314514_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.0	7.7e-136
WP_003184873.1|1314685_1314964_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_003198271.1|1314960_1315668_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003198274.1|1315835_1316732_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003198276.1|1316839_1317952_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.3	3.1e-32
WP_003198277.1|1317960_1318806_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003184863.1|1318849_1319323_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_003198280.1|1319319_1320378_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_003198282.1|1320365_1321115_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	5.2e-68
WP_003198285.1|1321114_1321792_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	8.0e-44
WP_003198287.1|1322003_1322849_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	8.3e-06
WP_149632268.1|1322955_1323963_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	8.6e-34
WP_003198291.1|1325385_1325709_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003198294.1|1325851_1328431_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.0	1.5e-26
WP_003198296.1|1329102_1329456_-	hypothetical protein	NA	B5TK57	Pseudomonas_phage	100.0	1.5e-57
WP_003198297.1|1330004_1330739_+	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	100.0	4.7e-138
WP_080561018.1|1331199_1331382_+	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	100.0	5.7e-29
WP_003198300.1|1331402_1332047_+	hypothetical protein	NA	B5TK60	Pseudomonas_phage	100.0	5.5e-119
WP_003198302.1|1332094_1332445_+|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	100.0	1.4e-60
WP_080560949.1|1332353_1332668_+	Com family DNA-binding transcriptional regulator	NA	B5TK59	Pseudomonas_phage	77.4	2.4e-06
WP_003198305.1|1332669_1333485_+|bacteriocin	lipid II-degrading bacteriocin	bacteriocin	B5TK62	Pseudomonas_phage	100.0	6.7e-154
WP_147282110.1|1333625_1334039_+	hypothetical protein	NA	B5TK63	Pseudomonas_phage	100.0	6.6e-65
WP_003198309.1|1335333_1335918_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	100.0	3.7e-106
WP_003198311.1|1335914_1336097_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	100.0	6.3e-28
WP_003198312.1|1336096_1337593_+|tail	tail sheath protein	tail	B5TK67	Pseudomonas_phage	100.0	4.2e-279
WP_003198314.1|1337659_1338007_+|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	100.0	5.7e-62
WP_003198316.1|1338003_1338300_+|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	100.0	1.1e-45
WP_003198318.1|1338430_1340005_+	hypothetical protein	NA	B5TK70	Pseudomonas_phage	100.0	1.4e-171
WP_003198319.1|1339991_1341230_+	2-hydroxyacid dehydrogenase	NA	B5TK71	Pseudomonas_phage	100.0	4.6e-231
WP_013692396.1|1341233_1342274_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	99.7	9.1e-196
WP_003198323.1|1342673_1343183_+|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	99.4	4.4e-87
WP_003198324.1|1343182_1343581_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	100.0	1.2e-71
WP_003198326.1|1343570_1344611_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	100.0	2.8e-189
WP_003198328.1|1344598_1345198_+	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	100.0	8.5e-114
WP_003198329.1|1345209_1346364_+	hypothetical protein	NA	B5TK77	Pseudomonas_phage	100.0	2.2e-219
WP_003198332.1|1346360_1346870_+	hypothetical protein	NA	B5TK78	Pseudomonas_phage	100.0	1.3e-86
WP_003198334.1|1346897_1347992_+	hypothetical protein	NA	B5TK79	Pseudomonas_phage	100.0	6.4e-208
WP_028237193.1|1347999_1348560_+|tail	phage tail protein	tail	B5TK80	Pseudomonas_phage	100.0	2.9e-108
WP_003198340.1|1348671_1349583_+	hypothetical protein	NA	B5TK81	Pseudomonas_phage	99.7	1.5e-157
WP_003198342.1|1349596_1350028_+	hypothetical protein	NA	B5TK82	Pseudomonas_phage	100.0	8.3e-79
WP_003198344.1|1350052_1350616_+	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	100.0	1.2e-104
WP_003198346.1|1350597_1351134_+	lysozyme	NA	B5TK84	Pseudomonas_phage	100.0	3.2e-88
WP_003198349.1|1351205_1351706_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	100.0	3.9e-88
WP_003198351.1|1351789_1352842_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.4	2.9e-109
>prophage 2
NZ_CP034725	Pseudomonas brassicacearum strain 3Re2-7 chromosome, complete genome	6738544	4214700	4220966	6738544	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
WP_003203307.1|4214700_4215093_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	79.8	3.2e-53
WP_003203309.1|4215092_4215455_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	70.8	3.4e-41
WP_003203312.1|4215454_4215748_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	66.7	6.3e-30
WP_003203314.1|4215744_4216080_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	80.2	1.0e-44
WP_003203316.1|4216076_4217078_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	83.2	4.8e-162
WP_003203319.1|4217166_4218171_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003203321.1|4218290_4219685_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003203323.1|4219685_4220966_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.2	7.4e-99
>prophage 3
NZ_CP034725	Pseudomonas brassicacearum strain 3Re2-7 chromosome, complete genome	6738544	4384003	4393404	6738544	integrase	Pseudomonas_phage(37.5%)	15	4377887:4377901	4393645:4393659
4377887:4377901	attL	CTGGCCGACCGTGAC	NA	NA	NA	NA
WP_149632592.1|4384003_4384444_+	hypothetical protein	NA	A0A1B0VMB1	Pseudomonas_phage	47.9	1.0e-31
WP_003203598.1|4384513_4384882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632430.1|4384878_4385481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003203599.1|4385592_4386324_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_003203601.1|4386401_4387181_+	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	28.7	5.5e-12
WP_003203603.1|4387218_4388142_+	DNA cytosine methyltransferase	NA	A0A142KB20	Gordonia_phage	35.7	1.2e-21
WP_033028132.1|4388138_4388369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157280295.1|4388482_4389001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003203609.1|4389140_4389470_+	hypothetical protein	NA	A0A1B0VM42	Pseudomonas_phage	71.6	3.9e-44
WP_003203611.1|4389466_4390255_+	hypothetical protein	NA	A0A2H4IY33	uncultured_phage	45.9	3.9e-58
WP_003203613.1|4390304_4390775_+	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	66.9	1.3e-61
WP_003203614.1|4390822_4391029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003203618.1|4391349_4392528_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	67.3	1.5e-154
WP_003179985.1|4392764_4393121_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002553164.1|4393101_4393404_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
4393645:4393659	attR	GTCACGGTCGGCCAG	NA	NA	NA	NA
>prophage 4
NZ_CP034725	Pseudomonas brassicacearum strain 3Re2-7 chromosome, complete genome	6738544	4498103	4563605	6738544	terminase,integrase,head,transposase,tail	Pseudomonas_phage(47.17%)	84	4509277:4509336	4563652:4563763
WP_003203804.1|4498103_4498370_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003203806.1|4498431_4498767_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_028236712.1|4500693_4501539_-	pirin family protein	NA	NA	NA	NA	NA
WP_027912984.1|4501549_4502143_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_003203815.1|4502180_4502789_-	azoreductase	NA	NA	NA	NA	NA
WP_003203818.1|4502905_4503805_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003203821.1|4504098_4504371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003203824.1|4504617_4505235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003203827.1|4506097_4506964_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003203829.1|4507324_4508410_+	type I restriction-modification system subunit R	NA	A0A1S5SAB0	Streptococcus_phage	39.0	1.4e-66
WP_003203831.1|4508611_4509256_-	hypothetical protein	NA	NA	NA	NA	NA
4509277:4509336	attL	CAACAAAAAAGGGCCCACCTTTCGGTGAGCCCTTCTAGACCGCCCAGCAGAGCGGATTTT	NA	NA	NA	NA
WP_028236799.1|4509635_4510016_+	hypothetical protein	NA	A0A2D1GNN8	Pseudomonas_phage	36.9	9.5e-10
WP_149632434.1|4510033_4510726_+	DUF159 family protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	79.6	6.2e-108
WP_028236797.1|4510703_4511219_-	lysozyme	NA	A0A2H4IZW4	uncultured_Caudovirales_phage	63.2	2.4e-48
WP_028236796.1|4511215_4511641_-	cell wall hydrolase	NA	A0A2D1GNI1	Pseudomonas_phage	82.3	2.3e-65
WP_149632435.1|4511876_4513202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050591616.1|4513250_4513580_-|tail	phage tail protein	tail	A0A059VFX9	Pseudomonas_phage	61.8	5.7e-27
WP_080756076.1|4515077_4515752_-	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	42.2	1.2e-42
WP_039012502.1|4515751_4516075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632436.1|4516071_4519641_-	DUF1983 domain-containing protein	NA	A0A2H4J8Z6	uncultured_Caudovirales_phage	62.1	0.0e+00
WP_042956541.1|4519698_4520295_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	72.1	3.4e-70
WP_149632593.1|4520856_4521135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632438.1|4521143_4521449_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	49.4	1.4e-11
WP_149632439.1|4521445_4522213_-|tail	phage tail protein	tail	A0A2H4J1J7	uncultured_Caudovirales_phage	82.4	2.0e-131
WP_149632440.1|4522215_4522965_-|tail	phage minor tail protein L	tail	A0A2H4J4Q5	uncultured_Caudovirales_phage	82.7	7.1e-126
WP_039012512.1|4522974_4523313_-|tail	phage tail protein	tail	A0A2H4JI07	uncultured_Caudovirales_phage	75.0	3.9e-47
WP_149632441.1|4523312_4526360_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	45.5	9.8e-182
WP_149632442.1|4526387_4526660_-	hypothetical protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	47.1	1.3e-16
WP_149632443.1|4526707_4527091_-	hypothetical protein	NA	A0A2H4J9Y6	uncultured_Caudovirales_phage	45.7	8.9e-24
WP_149632444.1|4527100_4527748_-|tail	phage tail protein	tail	A0A2H4J6K6	uncultured_Caudovirales_phage	62.8	4.0e-69
WP_013693852.1|4527833_4528094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013693853.1|4528145_4528562_-	DUF4128 domain-containing protein	NA	A0A2H4J130	uncultured_Caudovirales_phage	58.4	4.9e-36
WP_042956532.1|4528558_4529155_-	hypothetical protein	NA	A0A1B0VMI1	Pseudomonas_phage	53.7	2.2e-53
WP_149632445.1|4529151_4529520_-	hypothetical protein	NA	A0A1B0VRJ4	Pseudomonas_phage	76.7	4.2e-47
WP_149632446.1|4529566_4529770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632447.1|4529808_4530312_-	hypothetical protein	NA	A0A1B0VND3	Pseudomonas_phage	90.4	2.9e-83
WP_149632448.1|4530359_4530947_-	hypothetical protein	NA	A0A1B0VMF7	Pseudomonas_phage	50.3	4.4e-38
WP_149632449.1|4530994_4531945_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	70.3	4.6e-130
WP_042956525.1|4531956_4532685_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	81.0	7.4e-104
WP_149632450.1|4532758_4533292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632594.1|4533296_4534385_-|head	phage head morphogenesis protein	head	A0A1B0VMF3	Pseudomonas_phage	89.8	6.6e-181
WP_149632451.1|4534359_4535775_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	87.0	1.3e-242
WP_149632452.1|4535771_4537094_-|terminase	terminase	terminase	A0A1B0VP58	Pseudomonas_phage	97.3	2.4e-262
WP_149632453.1|4537068_4537545_-	DUF2280 domain-containing protein	NA	A0A1B0VMH2	Pseudomonas_phage	83.5	3.3e-68
WP_149632454.1|4537576_4538200_-	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	87.0	3.4e-105
WP_149632455.1|4538165_4538636_-	proteasome subunit beta	NA	A0A1B0VNC4	Pseudomonas_phage	63.9	1.7e-48
WP_149632456.1|4538632_4538824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632457.1|4539080_4539401_-	hypothetical protein	NA	A0A193GYR7	Enterobacter_phage	40.0	1.3e-07
WP_028236772.1|4539397_4539727_-	hypothetical protein	NA	A0A088FVG2	Escherichia_phage	50.9	2.2e-23
WP_149632458.1|4540186_4540939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632459.1|4541046_4541718_-	hypothetical protein	NA	A0A1B0YZZ3	Pseudomonas_phage	44.6	5.2e-43
WP_149632460.1|4541714_4542326_-	ninG protein	NA	A0A0U1VZM0	Pseudomonas_phage	64.0	1.2e-65
WP_149632461.1|4542322_4542574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632462.1|4542570_4543041_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	62.8	2.3e-53
WP_149632463.1|4543037_4543424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632464.1|4543420_4544209_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	69.3	1.1e-92
WP_149632465.1|4544195_4545167_-	phage replication protein	NA	A0A1B0VME0	Pseudomonas_phage	71.2	2.8e-114
WP_149632595.1|4545168_4545891_-	Rha family transcriptional regulator	NA	A0A2H4J111	uncultured_Caudovirales_phage	75.2	6.5e-100
WP_149632466.1|4546040_4546463_-	Rha family transcriptional regulator	NA	A0A2D1GNM7	Pseudomonas_phage	47.1	1.4e-30
WP_013693885.1|4546545_4546758_-	Rha family transcriptional regulator	NA	H2BD64	Pseudomonas_phage	74.2	2.4e-18
WP_149632596.1|4546846_4547506_+	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	46.3	4.2e-45
WP_149632467.1|4547645_4548335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632468.1|4548726_4548972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632469.1|4549119_4549359_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_149632470.1|4549783_4550026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632471.1|4550094_4550874_+	hypothetical protein	NA	A0A1B0YZY3	Pseudomonas_phage	65.1	1.6e-91
WP_149632472.1|4551376_4551763_+	hypothetical protein	NA	A0A2H4J9E7	uncultured_Caudovirales_phage	64.9	6.9e-32
WP_149632597.1|4551765_4551957_+	hypothetical protein	NA	A0A1B0VMB8	Pseudomonas_phage	50.8	1.1e-09
WP_149632473.1|4551953_4552157_+	hypothetical protein	NA	A0A2H4J1S2	uncultured_Caudovirales_phage	60.3	2.1e-16
WP_160148029.1|4552138_4552489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632474.1|4552809_4553622_+	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	50.6	1.1e-68
WP_149632475.1|4553618_4555241_+	Heme peroxidase	NA	A0A2H4J6F0	uncultured_Caudovirales_phage	77.1	5.6e-192
WP_149632476.1|4555237_4555831_+	hypothetical protein	NA	A0A1B0VMB1	Pseudomonas_phage	52.3	4.3e-49
WP_149632477.1|4555900_4556221_+	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	88.3	1.2e-45
WP_149632478.1|4556217_4556433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632479.1|4556791_4557151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632480.1|4557246_4557435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632481.1|4557512_4559549_+	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	61.9	1.4e-240
WP_149632482.1|4559586_4560567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632599.1|4560900_4561176_+	hypothetical protein	NA	A0A2H4J7B8	uncultured_Caudovirales_phage	64.0	8.6e-29
WP_149632483.1|4561172_4561574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632484.1|4561992_4562199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013693914.1|4562235_4562469_+	hypothetical protein	NA	A0A2H4JA17	uncultured_Caudovirales_phage	87.0	4.6e-31
WP_149632485.1|4562468_4563605_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	90.2	3.3e-199
4563652:4563763	attR	CAACAAAAAAGGGCCCACCTTTCGGTGAGCCCTTCTAGACCGCCCAGCAGAGCGGATTTTGTTTGGTAGGCGCGATTGGACTCGAACCAACGACCCCCACCATGTCAAGGTG	NA	NA	NA	NA
>prophage 5
NZ_CP034725	Pseudomonas brassicacearum strain 3Re2-7 chromosome, complete genome	6738544	4926510	4993555	6738544	lysis,holin,terminase,integrase,plate,head,transposase,tail,capsid,portal	uncultured_Caudovirales_phage(38.46%)	74	4937409:4937436	4994625:4994652
WP_003204457.1|4926510_4926969_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003204460.1|4927181_4927622_-	heme-binding protein	NA	NA	NA	NA	NA
WP_003204462.1|4927890_4929666_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	28.7	2.5e-44
WP_003204464.1|4929802_4930585_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_003204466.1|4930743_4931634_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_003204468.1|4931719_4933000_+	glycerate kinase	NA	NA	NA	NA	NA
WP_003204469.1|4932989_4934405_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_003204470.1|4934528_4935431_+	urea transporter	NA	NA	NA	NA	NA
WP_003204472.1|4935451_4936276_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	34.9	1.1e-05
WP_003204473.1|4936371_4937370_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
4937409:4937436	attL	CTGTGGGAGCAAAGCTTGCTCGCGATGA	NA	NA	NA	NA
WP_003204475.1|4937678_4938881_+	MFS transporter	NA	NA	NA	NA	NA
WP_003204476.1|4938940_4939132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003204477.1|4939203_4939734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003204479.1|4939916_4940435_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_013694036.1|4940529_4942368_-	long-chain-acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	24.1	9.3e-10
WP_003204481.1|4942724_4943003_+	DUF3509 domain-containing protein	NA	NA	NA	NA	NA
WP_003204483.1|4943890_4944424_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_003204484.1|4944458_4945604_-	MFS transporter	NA	NA	NA	NA	NA
WP_003204486.1|4945638_4946730_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.3	8.9e-77
WP_003204487.1|4946872_4947838_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003204489.1|4947945_4948734_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003204491.1|4948874_4949783_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003204493.1|4950037_4950628_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_003204495.1|4950758_4951079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003204497.1|4951153_4951711_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	33.1	5.3e-17
WP_149632494.1|4952019_4952235_+	hypothetical protein	NA	A0A2H4J177	uncultured_Caudovirales_phage	69.7	1.7e-16
WP_149632495.1|4953283_4953937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632496.1|4954046_4954781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632497.1|4955010_4956432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632498.1|4956549_4957827_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	51.0	2.9e-111
WP_043041970.1|4957819_4958245_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	43.0	4.0e-17
WP_149632499.1|4958343_4959045_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	48.7	1.9e-56
WP_149632500.1|4959041_4959233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632501.1|4959316_4960117_-	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	64.9	5.1e-98
WP_149632502.1|4960266_4960809_-|lysis	lysis protein	lysis	B5TK84	Pseudomonas_phage	65.5	4.6e-50
WP_149632503.1|4960790_4961354_-	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	77.0	5.4e-78
WP_149632504.1|4961421_4962468_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	73.6	1.5e-145
WP_053124044.1|4962531_4962738_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	70.1	1.7e-21
WP_149632600.1|4962712_4963477_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	70.0	5.4e-97
WP_149632505.1|4963567_4966213_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	37.6	1.4e-70
WP_149632506.1|4966313_4966640_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_043041982.1|4966704_4967214_-|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	71.3	3.0e-67
WP_149632507.1|4967226_4968390_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	83.2	7.3e-186
WP_149632508.1|4968477_4968897_-|tail	phage tail protein	tail	B5TK82	Pseudomonas_phage	37.1	9.4e-19
WP_149632509.1|4968905_4970831_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	40.7	2.4e-69
WP_149632510.1|4970823_4971435_-|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	62.3	3.1e-63
WP_149632511.1|4971434_4972316_-|plate	baseplate assembly protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	67.6	1.6e-108
WP_069971005.1|4972312_4972639_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	65.7	1.4e-33
WP_149632512.1|4972643_4972892_-	hypothetical protein	NA	A0A2H4J885	uncultured_Caudovirales_phage	46.3	8.6e-12
WP_149632513.1|4972951_4973515_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	63.3	1.3e-52
WP_149632514.1|4973511_4974042_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	51.4	1.7e-44
WP_149632515.1|4974034_4974697_-	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	62.4	4.7e-73
WP_079302228.1|4974693_4975014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632516.1|4975013_4975202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632517.1|4975203_4976235_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	41.7	3.1e-71
WP_149632518.1|4976247_4976598_-|head	head decoration protein	head	A0A2D1GMY6	Marinobacter_phage	36.5	5.3e-07
WP_149632519.1|4976610_4977831_-	S49 family peptidase	NA	A0A2H4EXF7	Aeromonas_phage	42.9	1.1e-48
WP_149632520.1|4977833_4979441_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	42.4	2.2e-95
WP_149632521.1|4979443_4979659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632522.1|4979670_4981560_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	50.2	7.7e-169
WP_149632523.1|4981603_4982128_-|terminase	terminase small subunit	terminase	A0A2D1GMW4	Marinobacter_phage	37.8	2.8e-20
WP_149632524.1|4982251_4982593_-|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	85.7	2.6e-43
WP_149632525.1|4983105_4983465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632526.1|4983457_4985677_-	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	46.8	2.6e-192
WP_149632527.1|4985666_4985894_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	38.7	1.3e-06
WP_149632528.1|4985886_4986447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632601.1|4987080_4987812_+	peptidase S24	NA	A5VW98	Enterobacteria_phage	39.2	1.3e-31
WP_149632530.1|4987798_4988785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632531.1|4989150_4989735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632532.1|4989745_4990030_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_149632533.1|4990189_4990519_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_149632534.1|4991164_4991386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149632535.1|4991382_4991925_+	phosphohydrolase	NA	A0A1W6JP41	Morganella_phage	43.4	1.7e-28
WP_149632536.1|4992346_4993555_+|integrase	tyrosine-type recombinase/integrase	integrase	J7HXC4	Pseudomonas_phage	59.4	5.3e-131
4994625:4994652	attR	TCATCGCGAGCAAGCTTTGCTCCCACAG	NA	NA	NA	NA
>prophage 6
NZ_CP034725	Pseudomonas brassicacearum strain 3Re2-7 chromosome, complete genome	6738544	6206093	6257589	6738544	holin,protease	Burkholderia_phage(33.33%)	44	NA	NA
WP_003206282.1|6206093_6206600_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_003206284.1|6206779_6207673_+	acyltransferase	NA	NA	NA	NA	NA
WP_003206286.1|6207843_6208185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028237472.1|6208225_6208804_-	DUF2780 domain-containing protein	NA	NA	NA	NA	NA
WP_003206290.1|6209103_6209526_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_003206292.1|6209532_6210204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003206294.1|6210563_6210776_+	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.8	7.9e-14
WP_003206297.1|6210879_6212079_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	29.7	2.9e-12
WP_003206299.1|6212260_6213118_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_003206301.1|6213300_6213933_-	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_003206303.1|6214093_6217111_-	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_003206305.1|6217107_6217437_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_003206307.1|6217451_6218702_-	sarcosine oxidase subunit beta	NA	NA	NA	NA	NA
WP_003206308.1|6218723_6219977_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	2.5e-99
WP_003206311.1|6220292_6220997_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_003206313.1|6221231_6222272_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_003206314.1|6222486_6223587_-	glycine-betaine demethylase subunit GbcB	NA	NA	NA	NA	NA
WP_003206316.1|6223870_6225166_+	glycine-betaine demethylase subunit GbcA	NA	NA	NA	NA	NA
WP_003206318.1|6225294_6226539_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003206319.1|6226566_6228435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003206320.1|6228581_6232034_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
WP_003206321.1|6233155_6233926_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_003206323.1|6233939_6235160_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_003206324.1|6235159_6237109_-	dimethylglycine demethylation protein DgcB	NA	NA	NA	NA	NA
WP_003206325.1|6237279_6239340_-	dimethylglycine demethylation protein DgcA	NA	NA	NA	NA	NA
WP_003177589.1|6239355_6239886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003206328.1|6239966_6240944_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_003206332.1|6241179_6241581_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_003206334.1|6241669_6241924_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	60.7	1.1e-22
WP_003206335.1|6241907_6242231_+	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	66.7	1.8e-30
WP_003206337.1|6242263_6242680_+	DUF3010 family protein	NA	NA	NA	NA	NA
WP_003206338.1|6242855_6244040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003206339.1|6244108_6245068_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003206341.1|6245254_6246199_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003206342.1|6246270_6247158_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_003206344.1|6247316_6248282_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_003206346.1|6248411_6248888_+	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003206347.1|6248908_6250072_+	gamma-butyrobetaine dioxygenase	NA	NA	NA	NA	NA
WP_003206350.1|6250451_6250715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003177576.1|6251063_6252167_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003206352.1|6252748_6254125_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_003206353.1|6254549_6255497_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003206355.1|6255568_6256414_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_003206357.1|6256410_6257589_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.6	5.9e-26
>prophage 7
NZ_CP034725	Pseudomonas brassicacearum strain 3Re2-7 chromosome, complete genome	6738544	6603160	6681889	6738544	plate,protease	uncultured_Caudovirales_phage(22.22%)	54	NA	NA
WP_003206934.1|6603160_6603673_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003206936.1|6603669_6605529_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003206938.1|6605492_6606545_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_003206940.1|6606537_6609228_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	32.3	9.8e-85
WP_003206941.1|6609398_6611336_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.5	1.5e-42
WP_003206943.1|6611354_6611789_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_003206945.1|6611801_6616241_+	RES domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	51.2	3.7e-28
WP_149632575.1|6616242_6616521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003206949.1|6616605_6621012_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.4	4.8e-28
WP_003206952.1|6621017_6621641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003206954.1|6622769_6623129_+	hypothetical protein	NA	B5TK57	Pseudomonas_phage	58.8	1.6e-27
WP_042956402.1|6623416_6624481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149632576.1|6624583_6626284_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003206957.1|6626964_6627996_+	histone deacetylase family protein	NA	A0A2K9L0J7	Tupanvirus	35.5	4.0e-34
WP_003206959.1|6628007_6629108_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003206961.1|6629353_6633955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003206962.1|6633991_6635536_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003206964.1|6635636_6636278_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_003206966.1|6636280_6636727_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003206968.1|6636737_6637409_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_149632606.1|6637568_6642557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003206973.1|6643157_6644057_-	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
WP_003206974.1|6644170_6644992_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003206976.1|6644988_6645822_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003206978.1|6646104_6648129_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_003206980.1|6648192_6650001_-	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003206982.1|6650013_6651429_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_033028163.1|6651616_6652579_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033028164.1|6652520_6652730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003187110.1|6652892_6653759_-	transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_027912848.1|6654082_6656956_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003206988.1|6657217_6659401_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.5	1.4e-118
WP_003206990.1|6659630_6660506_+	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_003187120.1|6660646_6661054_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_003206991.1|6661067_6662831_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003206993.1|6663109_6663595_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003206995.1|6663733_6664606_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_003206997.1|6664725_6665148_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_003207000.1|6665160_6666126_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_003207001.1|6666153_6666507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033028165.1|6666503_6667154_-	DUF1826 domain-containing protein	NA	NA	NA	NA	NA
WP_003207005.1|6667153_6668362_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_080684748.1|6668505_6668898_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_003207007.1|6669014_6669911_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_003207009.1|6669907_6670576_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_003207012.1|6670575_6671442_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003207014.1|6671452_6672328_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003207015.1|6672453_6672975_-	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_003207017.1|6673117_6674557_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003207018.1|6674553_6675741_-	class I SAM-dependent methyltransferase	NA	A0A2K9L0U7	Tupanvirus	34.4	3.6e-39
WP_003207020.1|6675925_6677845_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.3	1.8e-48
WP_003207022.1|6677841_6678894_-|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_149632577.1|6678890_6679931_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_003207030.1|6679927_6681889_-|protease	protease modulator HflK	protease	NA	NA	NA	NA
