The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043501	Bacillus paralicheniformis strain A4-3 chromosome, complete genome	4541365	1857538	1913969	4541365	terminase,capsid,plate,integrase,tRNA,tail,protease,holin,portal	Bacillus_phage(24.49%)	81	1867772:1867788	1920119:1920135
WP_043054090.1|1857538_1858015_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_020450324.1|1857995_1858685_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_023855532.1|1858697_1859156_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_026578976.1|1859145_1860171_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.2	3.5e-67
WP_096747896.1|1860409_1862335_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.1	7.1e-61
WP_048350303.1|1862481_1862988_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_020450329.1|1862991_1863636_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_020450330.1|1863674_1863848_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_095293002.1|1863854_1864631_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	25.6	1.4e-15
WP_020450332.1|1864675_1864870_-	YdiK family protein	NA	NA	NA	NA	NA
WP_020450333.1|1864866_1865601_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003179248.1|1865826_1866111_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	2.9e-19
WP_020450334.1|1866155_1867790_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	4.8e-159
1867772:1867788	attL	TATGGGCGGCATGATGT	NA	NA	NA	NA
WP_059231566.1|1867867_1869079_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	44.6	1.9e-88
WP_043927786.1|1869093_1869597_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	59.5	2.7e-52
WP_096747898.1|1869686_1870352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043927782.1|1870833_1871196_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	36.3	7.4e-12
WP_043927783.1|1871386_1871617_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003179259.1|1871667_1871973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043927784.1|1871969_1872659_+	antirepressor	NA	A0A0F6N3N8	Staphylococcus_phage	51.3	9.7e-37
WP_016886656.1|1872723_1873287_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.1	3.9e-60
WP_096747899.1|1873288_1873546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016886653.1|1873746_1873938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747900.1|1873934_1874846_+	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	62.1	2.1e-87
WP_073358662.1|1874865_1875603_+	hypothetical protein	NA	A0A0A7RVR3	Clostridium_phage	46.9	6.2e-58
WP_096747902.1|1876365_1877319_+	ATP-binding protein	NA	A0A0K2CPA5	Brevibacillus_phage	51.1	2.4e-57
WP_164906527.1|1877318_1877462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747903.1|1877769_1878036_+	hypothetical protein	NA	A0A1P8CWX5	Bacillus_phage	53.3	6.6e-18
WP_149208558.1|1878048_1878507_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	69.3	5.4e-52
WP_043929226.1|1878713_1878920_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	65.5	9.0e-15
WP_096747905.1|1878954_1879419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043929229.1|1879455_1879770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747906.1|1879944_1880319_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	36.6	1.8e-13
WP_096747907.1|1880315_1880684_+	hypothetical protein	NA	A0A2H4JDM0	uncultured_Caudovirales_phage	77.8	3.1e-26
WP_096747908.1|1880680_1880893_+	hypothetical protein	NA	R4JF30	Bacillus_phage	92.1	3.3e-28
WP_149208559.1|1880871_1881285_+	hypothetical protein	NA	O64129	Bacillus_phage	79.1	8.6e-57
WP_059231593.1|1881281_1881533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016886634.1|1881780_1882053_+	DUF5052 family protein	NA	F8WQ63	Bacillus_phage	70.3	9.4e-28
WP_043929357.1|1882067_1882334_+	hypothetical protein	NA	A0A0H3UYW6	Geobacillus_virus	61.1	2.7e-11
WP_016886631.1|1882416_1882569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164906528.1|1883077_1883221_+	hypothetical protein	NA	A0A2H4JCE7	uncultured_Caudovirales_phage	60.0	2.3e-09
WP_043929419.1|1883329_1883608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043929420.1|1883883_1884339_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	80.1	7.2e-65
WP_043929421.1|1884512_1884725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043929422.1|1885103_1885832_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	56.2	7.0e-62
WP_096747910.1|1885831_1887124_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	71.7	2.1e-162
WP_096747911.1|1887127_1888666_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.1	1.4e-144
WP_096747912.1|1888658_1889576_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	6.4e-52
WP_157765907.1|1889650_1889827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747913.1|1889879_1891055_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	52.6	2.6e-82
WP_075178039.1|1891067_1892003_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	63.8	8.6e-105
WP_096747914.1|1892013_1892418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747915.1|1892424_1892820_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	39.5	4.9e-17
WP_096747916.1|1892816_1893173_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_144619780.1|1893169_1893667_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.2	1.5e-39
WP_096747918.1|1893656_1894121_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_096747919.1|1894121_1894349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747920.1|1894349_1895750_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	41.8	4.3e-84
WP_059231625.1|1895751_1896195_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.6	1.2e-27
WP_016886607.1|1896544_1896628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096747921.1|1896767_1897217_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	31.2	1.5e-09
WP_085959894.1|1897246_1897396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149208560.1|1897399_1902661_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	40.9	3.8e-48
WP_017474907.1|1902653_1903313_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	33.3	1.3e-25
WP_017474908.1|1903334_1904318_+	hypothetical protein	NA	H7BV96	unidentified_phage	31.6	9.6e-38
WP_017474909.1|1904314_1904623_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.3	1.1e-05
WP_017474910.1|1904635_1905061_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	8.7e-12
WP_017474911.1|1905053_1906097_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.6	1.3e-72
WP_017474912.1|1906083_1906662_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	27.8	1.8e-15
WP_017474913.1|1906658_1906934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474914.1|1906934_1908038_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	63.4	2.1e-17
WP_017474915.1|1908049_1908379_+	hypothetical protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	39.4	1.1e-11
WP_017474916.1|1908375_1908558_+	XkdX family protein	NA	NA	NA	NA	NA
WP_149208561.1|1908658_1909492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474918.1|1909573_1909843_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	1.6e-24
WP_017474919.1|1909858_1910122_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	1.4e-31
WP_096747928.1|1910173_1911253_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM6	uncultured_phage	40.8	2.6e-44
WP_157765908.1|1911260_1911407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149208562.1|1911531_1912506_-	Abi family protein	NA	NA	NA	NA	NA
WP_096747930.1|1912938_1913112_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	90.9	3.1e-24
WP_096747931.1|1913159_1913969_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	62.8	4.0e-98
1920119:1920135	attR	TATGGGCGGCATGATGT	NA	NA	NA	NA
>prophage 2
NZ_CP043501	Bacillus paralicheniformis strain A4-3 chromosome, complete genome	4541365	1989180	1999105	4541365		Synechococcus_phage(50.0%)	9	NA	NA
WP_043054145.1|1989180_1990476_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	5.9e-19
WP_075213470.1|1990550_1991267_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.7	3.3e-48
WP_003179532.1|1991268_1991523_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_043054147.1|1991519_1992203_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_043054148.1|1992186_1994415_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.8	3.8e-159
WP_149208563.1|1994390_1995821_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	3.4e-52
WP_035337048.1|1995945_1996986_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_035337045.1|1996982_1997570_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.9	7.0e-28
WP_035337043.1|1997566_1999105_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	5.6e-77
>prophage 3
NZ_CP043501	Bacillus paralicheniformis strain A4-3 chromosome, complete genome	4541365	2229905	2294192	4541365	head,terminase,portal,capsid,plate,integrase,transposase,tRNA,tail,holin,coat,protease	Bacillus_phage(42.86%)	80	2229867:2229889	2272007:2272029
2229867:2229889	attL	TTTTTTGCACAAATTTTGCACAA	NA	NA	NA	NA
WP_043054197.1|2229905_2231024_-|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	60.8	7.6e-124
WP_043054198.1|2231038_2231485_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	54.1	2.5e-41
WP_043054199.1|2231488_2231830_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC14	Paenibacillus_phage	62.8	1.6e-32
WP_052500258.1|2231998_2232250_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SC17	Paenibacillus_phage	72.2	1.3e-26
WP_043054201.1|2232605_2233307_+	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	70.4	9.4e-88
WP_043054202.1|2233502_2234054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054203.1|2234111_2234330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054204.1|2234322_2235165_+	replication protein	NA	V9QKF6	Oenococcus_phage	43.9	4.5e-52
WP_043054205.1|2235124_2235973_+	ATP-binding protein	NA	Q9MBR8	Staphylococcus_prophage	32.3	5.2e-24
WP_155392279.1|2235962_2236121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052500259.1|2236272_2236821_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.3	4.0e-09
WP_113742868.1|2236925_2237075_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_043054206.1|2237146_2237347_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	3.6e-08
WP_043054207.1|2237382_2237616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155392280.1|2237827_2237965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054209.1|2238005_2238320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054210.1|2238316_2238565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054211.1|2238604_2238916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054212.1|2238947_2239160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054213.1|2239156_2239339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054214.1|2239520_2239787_+	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	39.1	3.5e-11
WP_043054215.1|2240072_2240513_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.8	1.4e-36
WP_043054216.1|2240512_2241055_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	4.3e-56
WP_043054217.1|2241288_2241480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075213432.1|2241885_2242110_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_043054218.1|2242363_2243032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054565.1|2243098_2243416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054219.1|2243442_2243817_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	6.9e-29
WP_043054220.1|2244047_2244563_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.2	9.8e-34
WP_043054221.1|2244559_2246269_+|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	64.1	2.5e-211
WP_035316082.1|2246281_2246473_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_043054222.1|2246473_2247784_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.1	2.4e-105
WP_035338281.1|2247728_2248460_+|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	56.9	2.4e-57
WP_043054223.1|2248499_2249780_+|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	43.5	6.3e-74
WP_052500260.1|2249803_2250247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054224.1|2250261_2250564_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	7.3e-13
WP_043054225.1|2250553_2250862_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	38.6	9.7e-13
WP_043054226.1|2250861_2251260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054227.1|2251256_2251640_+	phage protein	NA	NA	NA	NA	NA
WP_043054228.1|2251654_2252272_+|tail	tail protein	tail	NA	NA	NA	NA
WP_043054229.1|2252325_2252691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096747970.1|2252899_2257369_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.1	1.1e-69
WP_075213433.1|2257368_2258205_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	67.9	2.0e-108
WP_075213434.1|2258217_2259930_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	65.7	5.3e-217
WP_075213875.1|2259966_2262612_+	peptidase G2	NA	D6R401	Bacillus_phage	56.8	2.0e-292
WP_165688281.1|2262622_2263942_+|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	43.3	9.1e-68
WP_075213437.1|2263954_2264278_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	46.4	1.7e-12
WP_075213438.1|2264274_2264457_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.4e-06
WP_075213459.1|2264519_2264789_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	2.1e-24
WP_003185319.1|2264804_2265068_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	73.6	2.0e-30
WP_065644215.1|2265115_2266069_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	41.7	3.9e-60
WP_016886588.1|2266169_2266505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071583950.1|2266522_2268046_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	36.6	1.2e-07
WP_071583847.1|2268301_2269423_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
WP_071583848.1|2269645_2269966_-	YolD-like family protein	NA	O64030	Bacillus_phage	36.9	2.5e-11
WP_075213440.1|2270103_2270916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031305060.1|2271136_2271355_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_075213783.1|2271379_2271694_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_025811885.1|2272478_2273804_+	TGS domain-containing protein	NA	NA	NA	NA	NA
2272007:2272029	attR	TTTTTTGCACAAATTTTGCACAA	NA	NA	NA	NA
WP_043054245.1|2274025_2276833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080131295.1|2277054_2277570_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_023856463.1|2277679_2278249_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031305076.1|2278376_2279141_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_096748451.1|2279492_2281268_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_025811874.1|2281469_2282237_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	5.7e-30
WP_096747971.1|2282233_2283247_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020450657.1|2283243_2284080_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020450658.1|2284093_2285224_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_020450659.1|2285254_2285713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450660.1|2285709_2285916_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020450662.1|2286465_2286678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450663.1|2286784_2287531_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.3	5.4e-09
WP_031305077.1|2287496_2288966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450665.1|2288955_2289864_+	PqqD family protein	NA	NA	NA	NA	NA
WP_011197680.1|2289860_2290145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856470.1|2290251_2290521_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_149208565.1|2290846_2291476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450668.1|2291556_2292705_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_025811863.1|2292768_2293671_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_020450670.1|2293718_2294192_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043501	Bacillus paralicheniformis strain A4-3 chromosome, complete genome	4541365	2624213	2699697	4541365	terminase,capsid,plate,tail,holin,coat,portal	uncultured_Caudovirales_phage(25.64%)	95	NA	NA
WP_023856676.1|2624213_2624663_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180694.1|2624813_2625296_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180696.1|2625428_2625935_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180698.1|2626002_2626356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180700.1|2626404_2626791_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003180704.1|2626938_2627295_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003180706.1|2627581_2627791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450965.1|2627870_2628002_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003180710.1|2628128_2628386_+	sporulation protein	NA	NA	NA	NA	NA
WP_059261123.1|2628424_2630704_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.5	6.6e-90
WP_003180714.1|2630825_2631083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180716.1|2631122_2631710_-	DedA family protein	NA	NA	NA	NA	NA
WP_003180718.1|2631805_2632792_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	3.6e-53
WP_167511163.1|2632788_2633685_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	56.7	1.9e-85
WP_020450971.1|2633701_2634097_-	GtrA family protein	NA	NA	NA	NA	NA
WP_096748011.1|2634262_2634682_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003180728.1|2634691_2635201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180731.1|2635265_2635988_-	esterase family protein	NA	NA	NA	NA	NA
WP_003180732.1|2636099_2636555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180734.1|2636566_2637055_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_003180735.1|2637135_2638083_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180736.1|2638392_2639517_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	9.0e-16
WP_035338954.1|2639506_2640682_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	28.0	4.8e-20
WP_035338952.1|2640726_2641917_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_035338950.1|2642088_2642658_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180743.1|2642647_2642932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065643372.1|2643109_2644483_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	24.6	7.7e-09
WP_065643371.1|2645084_2646035_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_033155145.1|2646653_2646737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450980.1|2647064_2647397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450981.1|2647408_2648851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450982.1|2648904_2649243_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_044805482.1|2649320_2649497_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020450984.1|2649840_2650110_+	phage-like protein XhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	3.7e-24
WP_020450985.1|2650125_2650389_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	1.5e-30
WP_020450986.1|2650440_2651520_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM6	uncultured_phage	40.4	2.9e-43
WP_026579880.1|2651554_2651743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026579879.1|2651761_2652577_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_020450988.1|2652685_2652868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197793.1|2653309_2653489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020450989.1|2653526_2654105_+	maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
WP_020450990.1|2654187_2654475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450991.1|2654683_2655574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096748012.1|2655891_2657721_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_020450993.1|2657748_2659467_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_023856699.1|2659522_2660410_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023856700.1|2660501_2661374_+	DMT family transporter	NA	NA	NA	NA	NA
WP_023856701.1|2661422_2661800_+	glyoxalase	NA	NA	NA	NA	NA
WP_023856702.1|2661844_2662393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020450998.1|2662832_2663573_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	57.6	2.7e-29
WP_051143313.1|2663630_2665055_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_020451000.1|2665071_2665650_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023856707.1|2666025_2666439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035338945.1|2666811_2667294_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_020451003.1|2667782_2668430_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.5	2.6e-44
WP_020451004.1|2668442_2669099_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	6.8e-40
WP_020451005.1|2669286_2669640_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	3.6e-19
WP_023856709.1|2669812_2670073_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	43.8	3.0e-07
WP_033155144.1|2670062_2670359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856711.1|2670359_2671184_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	29.6	2.1e-25
WP_025811606.1|2671083_2671884_+	ATP-binding protein	NA	Q0H276	Geobacillus_phage	47.7	8.0e-59
WP_023856713.1|2671883_2672054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856714.1|2672153_2672495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451011.1|2672491_2672695_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.2	6.4e-13
WP_080131330.1|2672812_2673316_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	39.3	4.9e-22
WP_026579866.1|2673460_2674261_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	2.6e-65
WP_080131331.1|2674257_2675556_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	61.5	1.1e-150
WP_020451015.1|2675559_2677074_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.3	6.4e-142
WP_020451016.1|2677081_2677930_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	60.6	8.8e-56
WP_020451017.1|2677947_2678883_+|capsid	phage capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.1	3.6e-103
WP_023856716.1|2678998_2679373_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_026579862.1|2679369_2679726_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_080131332.1|2679722_2680211_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	43.3	1.1e-34
WP_035338940.1|2680223_2680664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451022.1|2680664_2680889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080131333.1|2680888_2682235_+|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	40.2	5.3e-79
WP_003180830.1|2682236_2682680_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_023856720.1|2682844_2683294_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_095290311.1|2683335_2683473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149208569.1|2683476_2687241_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	48.1	3.4e-43
WP_095290092.1|2687233_2687890_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_095290094.1|2687946_2688927_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	31.7	3.0e-39
WP_023856723.1|2688923_2689232_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.4e-06
WP_096748013.1|2689250_2689676_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	37.3	1.6e-13
WP_096748014.1|2689668_2690712_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	5.3e-71
WP_020451034.1|2691621_2692008_+	phage protein	NA	NA	NA	NA	NA
WP_096748016.1|2692023_2693232_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	42.9	1.2e-21
WP_096748017.1|2693273_2694233_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	26.0	1.8e-09
WP_035338928.1|2694276_2694546_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	65.2	9.6e-25
WP_026579849.1|2694560_2694824_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	3.1e-28
WP_096748018.1|2694876_2695941_+	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	52.0	5.1e-45
WP_023856728.1|2696039_2696726_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023856729.1|2696738_2697755_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_025811596.1|2697775_2698873_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_023856787.1|2698848_2699697_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
>prophage 5
NZ_CP043501	Bacillus paralicheniformis strain A4-3 chromosome, complete genome	4541365	2772542	2853074	4541365	head,terminase,capsid,integrase,transposase,tail,protease,holin,portal	Bacillus_phage(30.43%)	104	2766314:2766329	2821976:2821991
2766314:2766329	attL	TTTTTCGAGCGCTTCA	NA	NA	NA	NA
WP_144583092.1|2772542_2773682_-|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	39.4	3.3e-66
WP_069500420.1|2773713_2774193_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	41.9	2.3e-29
WP_025805709.1|2774303_2774954_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	48.9	1.7e-30
WP_149208570.1|2775033_2775300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149208571.1|2775536_2775899_-	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	45.2	7.4e-12
WP_149208572.1|2776050_2776269_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167511153.1|2776279_2776456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197842.1|2776698_2777025_+	hypothetical protein	NA	S6C476	Thermus_phage	53.2	2.8e-18
WP_125150311.1|2777064_2777475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197844.1|2777487_2778222_+	Rha family transcriptional regulator	NA	A0A2I7SCU0	Paenibacillus_phage	39.5	4.5e-32
WP_009328672.1|2778294_2778813_+	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	46.4	9.8e-34
WP_011197845.1|2778809_2779088_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	51.7	3.9e-21
WP_149208573.1|2779465_2780404_+	hypothetical protein	NA	S6C475	Thermus_phage	49.4	1.2e-82
WP_149208574.1|2780421_2781243_+	recombination protein RecT	NA	Q0H279	Geobacillus_phage	57.5	5.0e-80
WP_137736115.1|2781949_2782930_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.6	2.6e-59
WP_009328666.1|2783024_2783228_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	57.6	1.3e-13
WP_009328665.1|2783241_2783406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328664.1|2783405_2783624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077735854.1|2783616_2783907_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_016885851.1|2783903_2784116_+	hypothetical protein	NA	U5PTT2	Bacillus_phage	60.0	3.6e-11
WP_025805718.1|2784290_2784758_+	hypothetical protein	NA	R4JMS5	Bacillus_phage	95.0	4.1e-39
WP_025805719.1|2784754_2785153_+	hypothetical protein	NA	R4JKA5	Bacillus_phage	94.7	3.1e-72
WP_025805720.1|2785149_2785572_+	RusA family crossover junction endodeoxyribonuclease	NA	M4ZS69	Bacillus_phage	55.7	7.2e-35
WP_149208576.1|2785550_2785757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149208577.1|2785814_2786030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149208578.1|2786019_2786679_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	74.3	1.4e-21
WP_149208609.1|2786614_2786824_+	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	63.9	1.8e-15
WP_149208579.1|2786820_2787072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149208580.1|2787071_2787338_+	hypothetical protein	NA	A0A0H3UYW6	Geobacillus_virus	55.6	1.9e-09
WP_149208581.1|2787504_2787819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149208582.1|2787853_2788039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149208583.1|2788035_2788473_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	74.3	8.5e-55
WP_130569330.1|2788517_2788712_+	hypothetical protein	NA	A0A249XXE0	Clostridium_phage	51.9	2.0e-08
WP_167511154.1|2788740_2788899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075646937.1|2789115_2789571_+	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	61.2	1.1e-41
WP_021837352.1|2790373_2790604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145930134.1|2790797_2791613_+|terminase	terminase small subunit	terminase	Q5YA77	Bacillus_phage	64.3	3.5e-78
WP_035333902.1|2791609_2792887_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	69.0	3.4e-152
WP_149208584.1|2792883_2794299_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	61.4	2.7e-150
WP_149208585.1|2794282_2795200_+|capsid	minor capsid protein	capsid	A0A1Q1PVS0	Bacillus_phage	53.7	4.0e-86
WP_149208586.1|2795201_2795531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149208587.1|2795532_2796177_+	hypothetical protein	NA	U5PTS2	Bacillus_phage	51.7	2.0e-20
WP_155761920.1|2796218_2796371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075218721.1|2796481_2797063_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	52.8	9.3e-49
WP_149208588.1|2797076_2798000_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	64.8	8.8e-110
WP_009328639.1|2798003_2798342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328638.1|2798343_2798613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328637.1|2798626_2798935_+	hypothetical protein	NA	A0A1W6JQJ1	Staphylococcus_phage	44.0	2.5e-13
WP_149208589.1|2798934_2799276_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016885817.1|2799275_2799680_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	62.5	3.2e-40
WP_025807714.1|2799676_2800090_+	DUF3168 domain-containing protein	NA	A0A0C5AEH4	Paenibacillus_phage	38.3	2.7e-10
WP_021837398.1|2800102_2800648_+|tail	phage major tail protein, TP901-1 family	tail	Q597U9	Lactobacillus_virus	31.4	1.0e-17
WP_144602386.1|2800538_2800910_+	fibronectin type III domain-containing protein	NA	R4JF61	Bacillus_phage	71.1	4.1e-26
WP_003179339.1|2800977_2801475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328631.1|2801492_2801834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149208590.1|2801838_2804901_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	28.7	4.4e-49
WP_149208591.1|2804897_2805701_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_149208592.1|2805713_2809232_+	hypothetical protein	NA	Q5YA57	Bacillus_phage	46.2	8.8e-126
WP_009328627.1|2809245_2809545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328626.1|2809607_2809877_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	58.4	3.8e-21
WP_009328625.1|2809892_2810156_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	3.6e-32
WP_009328623.1|2811131_2811467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328622.1|2811492_2813007_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009328620.1|2813572_2813818_+	helix-turn-helix domain-containing protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	69.6	9.7e-24
WP_129093992.1|2813939_2814575_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_009328618.1|2814561_2814981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451114.1|2815277_2815610_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096748033.1|2815801_2815957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451116.1|2816061_2816241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451117.1|2816414_2816876_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075213199.1|2816881_2818732_-	DNA ligase D	NA	NA	NA	NA	NA
WP_026579818.1|2818735_2819608_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	34.3	1.0e-38
WP_075213200.1|2819756_2821409_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_149208593.1|2821697_2822339_+	DedA family protein	NA	NA	NA	NA	NA
2821976:2821991	attR	TGAAGCGCTCGAAAAA	NA	NA	NA	NA
WP_020451122.1|2822611_2823379_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	44.4	1.8e-31
WP_023856784.1|2823674_2824433_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_023856785.1|2824429_2825518_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_020451125.1|2825530_2825728_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	62.1	4.0e-12
WP_023856786.1|2825858_2826578_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_020451127.1|2826719_2827613_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_020451128.1|2827761_2829111_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_075213202.1|2829222_2831223_+	penicillin-binding transpeptidase domain-containing protein	NA	NA	NA	NA	NA
WP_149208594.1|2831244_2832675_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.7	9.4e-119
WP_023856450.1|2832818_2833034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020451131.1|2833030_2833213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025810280.1|2833475_2834501_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_020451133.1|2834810_2837021_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_020451134.1|2837028_2837526_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	51.4	2.4e-21
WP_023857318.1|2837737_2838799_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_096748035.1|2838804_2840001_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_020451137.1|2840310_2841090_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_096748036.1|2841185_2842376_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_142368374.1|2842608_2843826_+	2,3-diketo-5-methylthiopentyl-1-phosphate enolase	NA	NA	NA	NA	NA
WP_096748038.1|2843822_2844521_+	2-hydroxy-3-keto-5-methylthiopentenyl-1- phosphate phosphatase	NA	NA	NA	NA	NA
WP_023857315.1|2844481_2845108_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_096748039.1|2845123_2845660_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_096748040.1|2845687_2846152_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	53.4	2.4e-31
WP_020451144.1|2846138_2846459_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_020451145.1|2846674_2846917_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_020451146.1|2846975_2848487_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_020451147.1|2848724_2849180_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020451148.1|2849203_2849983_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_020451149.1|2849975_2850779_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_096748041.1|2850977_2853074_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.8	6.2e-127
>prophage 6
NZ_CP043501	Bacillus paralicheniformis strain A4-3 chromosome, complete genome	4541365	3804894	3816538	4541365		Staphylococcus_phage(55.56%)	14	NA	NA
WP_023857488.1|3804894_3805488_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	2.6e-14
WP_023857489.1|3805477_3806233_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.7	6.1e-08
WP_003183108.1|3806415_3806511_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_096748206.1|3806630_3807152_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_020452011.1|3807162_3807537_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|3807638_3808103_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_020452012.1|3808137_3809334_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.2	1.6e-116
WP_020452013.1|3809355_3810003_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.4	5.2e-40
WP_023857492.1|3810014_3811103_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.2	6.2e-62
WP_020452015.1|3811464_3811809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096748207.1|3812075_3814265_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.9	1.3e-154
WP_023857494.1|3814481_3814751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023857495.1|3814740_3815871_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	41.2	1.8e-72
WP_020452019.1|3816100_3816538_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	9.2e-17
>prophage 7
NZ_CP043501	Bacillus paralicheniformis strain A4-3 chromosome, complete genome	4541365	4001077	4056254	4541365	terminase,capsid,plate,integrase,tail,holin,coat,portal	Bacillus_phage(32.5%)	79	4012498:4012512	4042813:4042827
WP_048349970.1|4001077_4001872_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_065644169.1|4001944_4002529_-	signal peptidase I	NA	NA	NA	NA	NA
WP_020452169.1|4002525_4003254_-	amyloid fiber anchoring/assembly protein TapA	NA	NA	NA	NA	NA
WP_023855188.1|4003531_4003852_+	YqzG/YhdC family protein	NA	NA	NA	NA	NA
WP_025811164.1|4003881_4004064_-	YqzE family protein	NA	NA	NA	NA	NA
WP_025811163.1|4004152_4004518_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_025811162.1|4004529_4004910_-	ComGF family competence protein	NA	NA	NA	NA	NA
WP_025811161.1|4004926_4005274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026579312.1|4005257_4005695_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_096748222.1|4005700_4005964_-	competence protein ComG	NA	NA	NA	NA	NA
WP_080624021.1|4006089_4006779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624022.1|4006945_4007686_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080624023.1|4007785_4008850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096748465.1|4008875_4009232_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	38.3	3.9e-13
WP_080624025.1|4009475_4010333_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_016886590.1|4010412_4011273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624026.1|4011312_4012386_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM6	uncultured_phage	41.2	1.5e-44
WP_080624027.1|4012437_4012701_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	2.0e-30
4012498:4012512	attL	ATAGTTGTTTTTAAA	NA	NA	NA	NA
WP_020450984.1|4012716_4012986_-	phage-like protein XhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	3.7e-24
WP_080624028.1|4013065_4013899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043929126.1|4014000_4014183_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	57.4	3.7e-12
WP_017474915.1|4014179_4014509_-	hypothetical protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	39.4	1.1e-11
WP_017474914.1|4014520_4015624_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	63.4	2.1e-17
WP_017474913.1|4015624_4015900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474912.1|4015896_4016475_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	27.8	1.8e-15
WP_017474911.1|4016461_4017505_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.6	1.3e-72
WP_017474910.1|4017497_4017923_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	8.7e-12
WP_149208604.1|4017935_4018244_-	DUF2577 family protein	NA	S6C459	Thermus_phage	36.3	1.5e-05
WP_080624033.1|4018240_4019224_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	31.3	3.6e-37
WP_080624034.1|4019245_4019905_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.8	3.7e-25
WP_080624035.1|4019897_4025162_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	40.9	5.0e-48
WP_096748223.1|4025165_4025315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624036.1|4025344_4025794_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	31.9	5.0e-10
WP_080624038.1|4026508_4026592_+	hydrophobic toxin	NA	NA	NA	NA	NA
WP_080624039.1|4026864_4027308_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.6	1.2e-27
WP_080624040.1|4027309_4028710_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	42.0	1.1e-84
WP_080624041.1|4028710_4028938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624042.1|4028938_4029403_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_080624043.1|4029392_4029890_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.5	1.5e-39
WP_080624044.1|4029886_4030243_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_080624045.1|4030239_4030635_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	39.5	6.4e-17
WP_080624046.1|4030641_4031055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624047.1|4031065_4032001_-|capsid	major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.4	7.8e-106
WP_080624048.1|4032013_4033189_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	51.0	1.9e-80
WP_080624049.1|4033194_4034067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624050.1|4034115_4035033_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	38.9	1.1e-51
WP_080624051.1|4035025_4036564_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	50.7	7.7e-143
WP_080624052.1|4036567_4037863_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.9	2.6e-160
WP_080624053.1|4037859_4038729_-|terminase	terminase	terminase	D2IYW0	Enterococcus_phage	43.3	1.3e-38
WP_080624054.1|4038915_4039206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624055.1|4039496_4039700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157765913.1|4039753_4039927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624230.1|4040203_4040665_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_080624056.1|4040688_4042566_-|integrase	integrase	integrase	A0A1P8CWI7	Bacillus_phage	23.6	6.8e-16
WP_096748224.1|4042847_4043951_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	31.1	3.7e-46
4042813:4042827	attR	TTTAAAAACAACTAT	NA	NA	NA	NA
WP_080624058.1|4044131_4044515_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	57.9	9.8e-31
WP_080624059.1|4044605_4045259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624060.1|4045255_4045456_-	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	63.6	2.8e-13
WP_080624061.1|4045474_4045708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624062.1|4045782_4046340_+	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	53.4	3.1e-49
WP_149208611.1|4046332_4046545_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	61.4	5.1e-13
WP_080624063.1|4046612_4046879_-	DUF3850 domain-containing protein	NA	A8E2L6	Enterococcus_phage	59.2	1.0e-18
WP_167511159.1|4047121_4047799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624064.1|4047768_4048227_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	69.8	2.2e-53
WP_080624065.1|4048363_4048624_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_080624233.1|4048731_4048908_-	Fur-regulated basic protein FbpA	NA	M4ZS77	Bacillus_phage	50.9	1.0e-06
WP_080624066.1|4048943_4050248_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	42.5	9.0e-92
WP_080624067.1|4050222_4050504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624068.1|4050506_4051319_-	hypothetical protein	NA	S6BFM4	Thermus_phage	50.0	3.7e-11
WP_080624069.1|4051486_4052437_-	recombination protein RecT	NA	S6AVW6	Thermus_phage	60.8	1.2e-88
WP_080624070.1|4052429_4053380_-	hypothetical protein	NA	S6C475	Thermus_phage	61.7	2.3e-105
WP_017474946.1|4053379_4053559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624071.1|4053679_4053892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624072.1|4053904_4054099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624073.1|4054226_4054415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624074.1|4054415_4054682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080624075.1|4054678_4055206_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080624077.1|4055504_4055708_-	helix-turn-helix transcriptional regulator	NA	B5LPU7	Bacillus_virus	50.8	1.1e-09
WP_080624234.1|4055906_4056254_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	50.0	3.1e-15
>prophage 8
NZ_CP043501	Bacillus paralicheniformis strain A4-3 chromosome, complete genome	4541365	4327008	4383953	4541365	tRNA,transposase,coat,protease	Bacillus_phage(36.36%)	60	NA	NA
WP_020452419.1|4327008_4328154_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.2	2.1e-84
WP_020452420.1|4328182_4329211_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003183984.1|4329251_4329452_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_023855398.1|4329444_4330449_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.3	1.2e-06
WP_023855399.1|4330458_4331064_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_023855400.1|4331187_4331709_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_035338454.1|4331940_4332588_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_035338455.1|4333067_4333259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035338155.1|4333787_4335218_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.8	1.2e-121
WP_035338349.1|4335250_4336588_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_035338348.1|4336584_4337256_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.0	6.3e-25
WP_023855402.1|4337434_4337614_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_023855403.1|4337722_4338187_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_023855404.1|4338246_4338957_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	54.9	1.9e-48
WP_003183993.1|4339351_4339531_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	76.3	1.5e-21
WP_035338347.1|4339620_4339941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023855406.1|4340078_4340801_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023855407.1|4340925_4341561_-	spore cortex protein	NA	NA	NA	NA	NA
WP_023855408.1|4341733_4342786_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_035338345.1|4342901_4344011_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_025811047.1|4344032_4344872_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_025811046.1|4344852_4346427_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_020452436.1|4346527_4347706_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	26.0	1.1e-32
WP_020452437.1|4347674_4348217_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_020452438.1|4348258_4349128_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_023855415.1|4349137_4349581_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_020452440.1|4349698_4350985_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_020452441.1|4351017_4351596_-	sporulation initiation phosphotransferase Spo0B	NA	NA	NA	NA	NA
WP_003184023.1|4351822_4352104_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_020452442.1|4352116_4352458_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|4352470_4352779_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_096748261.1|4352939_4353806_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_023855419.1|4353798_4354590_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_025811043.1|4354735_4355164_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_023855421.1|4355163_4355487_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020452447.1|4355533_4356340_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_096748468.1|4356342_4357023_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_020452449.1|4357076_4357595_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_020452450.1|4357591_4358500_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|4358530_4359541_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_020452451.1|4359628_4360303_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_020452452.1|4360357_4360930_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_096748262.1|4361080_4362115_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_023855425.1|4362320_4363070_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_096748263.1|4363222_4364527_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_020452456.1|4364603_4367246_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	9.8e-162
WP_020452457.1|4367705_4367897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096748264.1|4367915_4368938_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_096748265.1|4368965_4370597_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023855430.1|4370745_4372041_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_020452461.1|4372066_4373041_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_026579130.1|4373044_4373836_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_020452463.1|4373825_4374767_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_020452464.1|4374806_4375637_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_020452465.1|4375642_4377004_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_020452466.1|4377192_4377678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075752023.1|4377725_4378313_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_023855433.1|4378309_4380634_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.0	1.7e-186
WP_096748266.1|4380850_4382506_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	34.7	1.4e-17
WP_003184083.1|4382687_4383953_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
