The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043511	Enterobacter kobei strain EB_P8_L5_01.19 chromosome, complete genome	4801031	607806	666788	4801031	tRNA,holin,tail,plate	Erwinia_phage(34.38%)	61	NA	NA
WP_014885329.1|607806_608205_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_008503141.1|608206_608512_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_014885328.1|608541_608910_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_014885327.1|609053_609437_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_014885326.1|609439_610102_-	DedA family protein	NA	NA	NA	NA	NA
WP_014885325.1|610445_611222_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_023331362.1|611362_612661_-	MFS transporter	NA	NA	NA	NA	NA
WP_014885323.1|613136_614549_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_023337835.1|614566_616054_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_058690908.1|616147_617389_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_047344557.1|617600_618566_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.8	1.2e-35
WP_014885319.1|618817_619816_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023331357.1|619886_620390_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014885317.1|620473_621610_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_058690909.1|621692_623714_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_014885315.1|623899_625480_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_023338807.1|625514_626483_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_149410351.1|626698_628186_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	3.4e-18
WP_058690910.1|628182_629214_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_058690911.1|629214_630192_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_014885310.1|630193_631195_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_014885309.1|631206_632094_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_023331350.1|632090_632384_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_023331349.1|632439_633288_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_058690913.1|633300_633987_-	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_058690914.1|634029_634632_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032635487.1|634704_636084_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	5.8e-33
WP_023331345.1|636519_638040_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	34.4	1.0e-30
WP_058690916.1|638376_639936_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.9	7.6e-13
WP_014885300.1|639932_640427_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023331344.1|640574_641339_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_023331343.1|641339_642509_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_058690917.1|642702_643278_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	60.6	3.1e-65
WP_032635496.1|643505_643844_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	75.7	2.1e-40
WP_029741400.1|643912_644140_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	9.9e-15
WP_047344543.1|644139_644361_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	75.0	5.5e-26
WP_072205401.1|644362_646552_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	72.9	0.0e+00
WP_032635502.1|646661_647102_+	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	78.8	2.5e-54
WP_032635504.1|647281_647485_+|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	68.7	1.7e-21
WP_029741404.1|647475_647697_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	75.0	4.6e-25
WP_047344540.1|647680_648190_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.7	3.3e-74
WP_058690918.1|648186_648612_+	protein lysB	NA	A0A218M4K2	Erwinia_phage	55.9	1.4e-30
WP_058690919.1|648707_649175_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	59.7	1.7e-48
WP_032635510.1|649287_649929_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	5.9e-89
WP_032635513.1|649925_650276_+	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	71.6	2.4e-39
WP_058690920.1|650281_651190_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	79.1	2.9e-129
WP_058690921.1|651182_651713_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.4	2.9e-89
WP_047625661.1|653517_654033_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	39.4	1.2e-18
WP_058690396.1|654179_655373_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.9	4.7e-188
WP_023309235.1|655384_655903_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.8	7.7e-79
WP_032635522.1|655959_656268_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	7.6e-26
WP_023616176.1|656300_656420_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	9.7e-14
WP_078309782.1|656412_658674_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	44.8	4.7e-112
WP_047624984.1|658685_659150_+|tail	phage tail protein	tail	O80317	Escherichia_phage	68.6	1.1e-57
WP_050861927.1|659146_660301_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	61.7	7.3e-130
WP_032635529.1|660368_660569_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	79.6	8.2e-21
WP_014885286.1|660853_661360_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_014885285.1|661462_663307_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_014885284.1|663461_665207_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	3.2e-76
WP_001144069.1|665322_665538_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014885283.1|665774_666788_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.8e-108
>prophage 2
NZ_CP043511	Enterobacter kobei strain EB_P8_L5_01.19 chromosome, complete genome	4801031	1732142	1739890	4801031		Ostreococcus_lucimarinus_virus(16.67%)	7	NA	NA
WP_047625678.1|1732142_1733549_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	3.1e-37
WP_058691064.1|1733644_1734730_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	51.9	4.1e-98
WP_047625676.1|1734729_1735611_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	3.1e-104
WP_047625675.1|1735839_1737006_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	4.5e-111
WP_047625674.1|1737057_1738062_-	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	29.9	2.9e-34
WP_058691063.1|1738254_1739235_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_014884472.1|1739278_1739890_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	28.8	7.8e-14
>prophage 3
NZ_CP043511	Enterobacter kobei strain EB_P8_L5_01.19 chromosome, complete genome	4801031	1838799	1845706	4801031	integrase	Pectobacterium_phage(28.57%)	8	1833507:1833566	1844653:1844765
1833507:1833566	attL	TTAGGGAGGGTGCGAATAAGTACCCTCCGCAACGAAAATGAAACTTTTAGTCAATTAAAT	NA	NA	NA	NA
WP_149410166.1|1838799_1839813_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	68.5	8.1e-133
WP_032619466.1|1839812_1840034_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	42.9	1.8e-08
WP_149410167.1|1840093_1840336_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	50.0	4.2e-11
WP_149410168.1|1840322_1842227_-	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	37.3	4.3e-26
WP_045324791.1|1842449_1842722_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	41.9	5.9e-14
WP_149410169.1|1843834_1844320_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	61.0	1.8e-29
WP_072060371.1|1844231_1844516_-	ash family protein	NA	NA	NA	NA	NA
WP_014884373.1|1844830_1845706_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.7	1.5e-10
1844653:1844765	attR	TTAGGGAGGGTGCGAATAAGTACCCTCCGCAACGAAAATGAAACTTTTAGTCAATTAAATTCAATCACTTACATAGGCGTTTTTTTGCGTTTGGTGACTTATTCGCACCTTCC	NA	NA	NA	NA
>prophage 4
NZ_CP043511	Enterobacter kobei strain EB_P8_L5_01.19 chromosome, complete genome	4801031	2339609	2362296	4801031	transposase,integrase,plate	Escherichia_phage(50.0%)	22	2343301:2343316	2361814:2361829
WP_149410183.1|2339609_2340764_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	6.4e-41
2343301:2343316	attL	GGCATCGACACCAATG	NA	NA	NA	NA
WP_149410184.1|2344114_2344675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042718067.1|2344772_2345105_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057059098.1|2345302_2345746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172971178.1|2345745_2346006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172971207.1|2348478_2349648_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_149410186.1|2349695_2350676_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_149410188.1|2352353_2352680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410189.1|2352688_2353216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410190.1|2353217_2353940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410191.1|2353953_2354238_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_149410192.1|2354237_2354501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410193.1|2354487_2354859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410194.1|2355230_2355524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410195.1|2355750_2356086_+	hypothetical protein	NA	Q5G8V1	Enterobacteria_phage	60.3	4.7e-13
WP_149410196.1|2356075_2356960_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_149410197.1|2356956_2357214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410198.1|2358297_2359248_+	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	25.4	3.8e-07
WP_149410199.1|2359244_2359958_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_149410200.1|2359960_2360338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410202.1|2360552_2360900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410203.1|2360886_2362296_+|plate	baseplate protein	plate	NA	NA	NA	NA
2361814:2361829	attR	GGCATCGACACCAATG	NA	NA	NA	NA
>prophage 5
NZ_CP043511	Enterobacter kobei strain EB_P8_L5_01.19 chromosome, complete genome	4801031	2369249	2380128	4801031	terminase,head	Erwinia_phage(37.5%)	13	NA	NA
WP_149410214.1|2369249_2370659_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2I7RTP3	Vibrio_phage	34.5	1.6e-57
WP_149410215.1|2370655_2372035_+	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_149410216.1|2372021_2373383_+|head	phage head morphogenesis protein	head	E5AGA5	Erwinia_phage	28.3	1.1e-15
WP_149410353.1|2373354_2374371_+	DUF2213 domain-containing protein	NA	A0A291LCH5	Klebsiella_phage	33.5	5.8e-14
WP_149410217.1|2374370_2375162_+	Ig-like domain-containing protein	NA	A0A1S5R5Y7	Pseudomonas_phage	59.3	7.8e-14
WP_149410218.1|2375176_2376115_+	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	29.5	3.9e-28
WP_149410219.1|2376118_2376373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410220.1|2376382_2376742_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_149410221.1|2376864_2377092_+	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	55.1	1.1e-16
WP_149410222.1|2377151_2377625_+	hypothetical protein	NA	A0A291LCI6	Klebsiella_phage	34.6	6.1e-06
WP_172971208.1|2377720_2377975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410224.1|2377974_2378760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410225.1|2378760_2380128_+	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	25.9	2.3e-29
>prophage 6
NZ_CP043511	Enterobacter kobei strain EB_P8_L5_01.19 chromosome, complete genome	4801031	3073862	3124264	4801031	transposase,protease,tail	Escherichia_phage(20.0%)	43	NA	NA
WP_013097244.1|3073862_3074522_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	8.9e-48
WP_032637041.1|3074577_3075054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032637043.1|3075050_3075806_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032637044.1|3076114_3076858_+	fimbrial protein	NA	NA	NA	NA	NA
WP_149410250.1|3077136_3078117_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	9.8e-184
WP_058690689.1|3078690_3081408_+	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
WP_058690688.1|3081409_3082567_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_058690687.1|3082577_3083129_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023332621.1|3083198_3083528_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_023332620.1|3083524_3083806_-	acylphosphatase	NA	NA	NA	NA	NA
WP_032637047.1|3083817_3084606_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_058690686.1|3084616_3085174_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_058690685.1|3085348_3086539_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_008499919.1|3086599_3086917_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_014883259.1|3086953_3087367_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_058690684.1|3087540_3088203_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_008499922.1|3088283_3088742_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_058690683.1|3088800_3090855_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	2.1e-18
WP_058690682.1|3090978_3091425_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_058690681.1|3091444_3093607_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_058690680.1|3093563_3094190_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_058690679.1|3094407_3094917_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_014883252.1|3095272_3096328_+	porin OmpA	NA	NA	NA	NA	NA
WP_023332611.1|3096392_3096845_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_047028048.1|3097031_3098792_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227926.1|3098860_3099379_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_013097261.1|3099450_3099618_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_058690678.1|3099874_3100441_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_014883248.1|3100437_3102078_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_032637056.1|3102082_3103336_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_058690677.1|3103349_3105257_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.1	4.7e-49
WP_023332608.1|3105269_3107378_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_149410251.1|3107476_3108586_+	MOSC domain-containing protein	NA	V5UTY8	Synechococcus_phage	39.1	4.1e-05
WP_014883243.1|3108582_3109125_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_014883241.1|3110549_3111125_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_058690676.1|3111117_3112080_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058690675.1|3112076_3113222_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_014883238.1|3113231_3114023_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_058690674.1|3114019_3114790_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	6.4e-29
WP_023332604.1|3114892_3117505_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.2	1.2e-18
WP_149410252.1|3117768_3117984_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	43.9	1.2e-06
WP_149410253.1|3118022_3119276_-|tail	phage tail protein	tail	A0A220NRP2	Escherichia_phage	41.0	2.8e-74
WP_001158650.1|3123655_3124264_-|tail	tail assembly protein	tail	K7PM69	Enterobacteria_phage	100.0	1.4e-103
>prophage 7
NZ_CP043511	Enterobacter kobei strain EB_P8_L5_01.19 chromosome, complete genome	4801031	3130060	3148153	4801031	transposase,holin	Escherichia_phage(25.0%)	26	NA	NA
WP_149410254.1|3130060_3131041_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
WP_149410255.1|3131081_3131423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119312044.1|3132809_3133085_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_119312043.1|3133081_3133624_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	72.1	1.3e-76
WP_049110993.1|3133601_3133907_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	90.3	2.9e-41
WP_032624437.1|3133893_3134289_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	3.4e-63
WP_058691151.1|3134936_3135752_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	77.5	2.4e-111
WP_045619504.1|3135748_3136060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045619506.1|3136061_3137933_-	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	61.2	1.0e-229
WP_023150201.1|3138036_3139047_-	hypothetical protein	NA	A0A2I7RGI7	Vibrio_phage	45.3	2.5e-17
WP_023150200.1|3139033_3139399_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_045404153.1|3139391_3139601_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_072051414.1|3139602_3139833_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_072203567.1|3139795_3140668_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	36.1	2.6e-34
WP_006811077.1|3140843_3141275_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058691153.1|3141341_3141728_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.0	4.9e-38
WP_058691154.1|3141834_3142059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058691155.1|3142051_3142459_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	88.4	2.5e-48
WP_149410256.1|3142648_3143062_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	63.2	2.6e-45
WP_013097280.1|3143061_3143640_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	68.2	9.8e-75
WP_149410257.1|3143651_3144395_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	88.3	8.6e-124
WP_058691184.1|3144397_3144814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058691159.1|3144816_3145188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410258.1|3145171_3145429_+	excisionase family protein	NA	S4TND0	Salmonella_phage	88.8	1.8e-36
WP_149410259.1|3145473_3146766_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	94.0	7.4e-240
WP_047343765.1|3146950_3148153_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.4	6.4e-44
>prophage 8
NZ_CP043511	Enterobacter kobei strain EB_P8_L5_01.19 chromosome, complete genome	4801031	3666243	3697304	4801031	transposase,lysis,holin,integrase	Salmonella_phage(29.41%)	49	3649738:3649756	3699460:3699478
3649738:3649756	attL	TCACGTTGTCGATGCCTGC	NA	NA	NA	NA
WP_149410283.1|3666243_3667635_-	phage DNA ejection protein	NA	C6ZR17	Salmonella_phage	60.1	1.5e-129
WP_149410284.1|3667644_3668316_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	68.5	2.2e-38
WP_149410285.1|3668290_3668770_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	70.8	1.0e-61
WP_149410286.1|3670439_3671891_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	77.4	9.0e-234
WP_149410287.1|3671850_3672351_-	DNA-packaging protein	NA	C6ZR06	Salmonella_phage	74.5	1.4e-61
WP_149410288.1|3672359_3672692_-	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
WP_149410289.1|3672709_3672943_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	56.6	1.6e-15
WP_149410290.1|3672945_3673317_-	hypothetical protein	NA	C6ZR72	Salmonella_phage	52.5	1.3e-35
WP_172971197.1|3673414_3673693_-	DUF2829 domain-containing protein	NA	A0A0A0P251	Enterobacteria_phage	78.8	2.6e-33
WP_149410292.1|3673836_3674304_-|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	77.4	3.8e-61
WP_149410293.1|3674300_3674777_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	87.7	8.6e-77
WP_149410294.1|3674763_3675081_-|holin	holin	holin	E7C9S8	Salmonella_phage	61.5	6.4e-28
WP_149410295.1|3675715_3676339_-	hypothetical protein	NA	A0A2H4FND2	Salmonella_phage	73.0	2.1e-83
WP_149410296.1|3676335_3676530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149410297.1|3676526_3677108_-	recombination protein NinG	NA	E7C9S3	Salmonella_phage	45.5	4.2e-41
WP_149410298.1|3677100_3677268_-	NinE family protein	NA	G8C7V4	Escherichia_phage	60.8	3.2e-10
WP_149410299.1|3677251_3677710_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	50.7	2.9e-37
WP_172971198.1|3678104_3678650_-	hypothetical protein	NA	G8C7V0	Escherichia_phage	69.2	1.4e-46
WP_149410301.1|3679326_3679515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149410302.1|3680053_3680365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149410303.1|3680387_3681752_-	AAA family ATPase	NA	Q9MCP7	Enterobacteria_phage	80.8	5.0e-210
WP_149410304.1|3681748_3682561_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	59.7	5.8e-81
WP_149410306.1|3682740_3683055_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	44.8	2.5e-16
WP_131486797.1|3683161_3683380_-	helix-turn-helix domain-containing protein	NA	M9NZA8	Enterobacteria_phage	74.0	9.5e-23
WP_149410360.1|3683497_3684205_+	helix-turn-helix domain-containing protein	NA	K7P7I4	Enterobacteria_phage	66.4	1.8e-86
WP_095282143.1|3684299_3684836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095282144.1|3684832_3685591_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_149410307.1|3685616_3685823_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	92.6	2.2e-29
WP_149410308.1|3686129_3686429_+	transcriptional regulator	NA	A0A2H4J657	uncultured_Caudovirales_phage	38.8	7.2e-05
WP_149410309.1|3686449_3686710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410310.1|3686744_3686990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049041165.1|3687135_3687384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410311.1|3687380_3687689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410312.1|3687688_3687949_+	hypothetical protein	NA	K7PHN6	Enterobacterial_phage	63.4	7.9e-24
WP_149410313.1|3688025_3688304_+	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	68.8	5.1e-29
WP_172971199.1|3688481_3688817_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	36.6	2.6e-11
WP_149410315.1|3688813_3689434_+	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	49.3	8.7e-45
WP_149410316.1|3689461_3689770_+	sigma-70 family RNA polymerase sigma factor	NA	A0A192Y7Y0	Salmonella_phage	54.8	1.4e-24
WP_149410317.1|3689766_3689958_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	78.0	2.8e-18
WP_149410318.1|3689954_3690176_+	TraR/DksA C4-type zinc finger protein	NA	A0A0N7C211	Escherichia_phage	47.1	2.6e-12
WP_149410319.1|3690175_3691267_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	65.4	3.9e-141
WP_149410320.1|3691229_3691472_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023234529.1|3691481_3691805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410361.1|3691994_3692195_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	60.6	4.3e-14
WP_149410321.1|3692205_3692535_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_149410362.1|3692417_3693575_+|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	90.6	1.0e-211
WP_047344456.1|3693945_3694644_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_023336844.1|3694668_3695385_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_149410322.1|3696323_3697304_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
3699460:3699478	attR	GCAGGCATCGACAACGTGA	NA	NA	NA	NA
>prophage 1
NZ_CP043512	Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed1, complete sequence	142503	36575	102340	142503	transposase,tail,integrase,plate,capsid	Burkholderia_virus(36.59%)	85	49218:49243	100247:100272
WP_149410369.1|36575_37580_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_107835450.1|37664_37826_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_004729622.1|38019_38772_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023287190.1|40016_41240_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004729618.1|41425_42199_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001194072.1|42264_42966_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_047064068.1|43031_44138_-	alkene reductase	NA	NA	NA	NA	NA
WP_021242987.1|44351_44681_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	7.4e-11
WP_021242988.1|44710_45049_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_020277920.1|45053_45635_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|45776_46334_-	OsmC family protein	NA	NA	NA	NA	NA
WP_012695450.1|46518_47103_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	2.0e-22
49218:49243	attL	GCGGCACTGGCCGAGCTGGTCAACGC	NA	NA	NA	NA
WP_021243021.1|51830_52094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021243020.1|52124_52304_-	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_021243019.1|52372_52738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021243018.1|52799_53099_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000072676.1|53088_53352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131797681.1|53489_53948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021243016.1|54490_54985_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_021243015.1|54974_55436_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_021243014.1|55459_55597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567380.1|55670_56177_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_149410370.1|56207_56495_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_149410372.1|56525_57107_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	1.2e-67
WP_050885414.1|57520_57946_+|tail	tail fiber assembly protein	tail	S5FXM8	Shigella_phage	45.9	2.9e-23
WP_117090149.1|57926_58160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104774702.1|59088_59667_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	8.9e-68
WP_149410374.1|59659_60763_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	53.3	2.7e-105
WP_149410375.1|60753_61101_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	7.8e-35
WP_149410376.1|61155_61668_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	44.0	6.1e-20
WP_149410377.1|61667_62837_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	49.1	3.5e-87
WP_021544461.1|62824_63037_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	57.1	6.9e-18
WP_149410378.1|63036_63921_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	46.2	3.9e-54
WP_149410379.1|63920_66386_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.8	7.4e-172
WP_001148841.1|66478_66616_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084225.1|66581_66896_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000215406.1|66994_67276_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	42.3	4.0e-13
WP_162837902.1|67278_67803_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.8	4.7e-68
WP_000729861.1|67799_69227_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	78.6	3.4e-217
WP_000666495.1|69216_69468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101809.1|69467_69932_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	4.1e-39
WP_000271666.1|69931_70378_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.1e-33
WP_000537462.1|70379_70736_-	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	51.3	3.4e-17
WP_029464126.1|70746_71700_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.3	9.9e-64
WP_011410687.1|71713_72811_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	49.6	5.0e-96
WP_011410686.1|73025_73484_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.6	1.3e-29
WP_011410685.1|73486_74308_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	61.5	5.8e-97
WP_096147854.1|74288_75785_-	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	59.8	1.5e-170
WP_096147855.1|75784_77308_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	8.9e-184
WP_096147856.1|77304_77850_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_006122433.1|77849_78161_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_058676526.1|78153_78486_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_023214056.1|78482_79133_-	lipoprotein	NA	A0A0S4L1H0	Pseudomonas_phage	32.0	6.2e-09
WP_149410380.1|79116_79845_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.7	2.0e-64
WP_048994561.1|79847_80198_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	2.6e-22
WP_072001293.1|80416_80653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410381.1|80573_81140_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_126493916.1|81383_82154_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.9	1.0e-98
WP_126493915.1|82201_82735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045355449.1|82770_83181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001041677.1|83269_83494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042842.1|83490_83796_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
WP_126493914.1|83805_84714_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	52.7	2.5e-72
WP_057060533.1|84717_86487_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.8	9.0e-228
WP_020803496.1|86497_87664_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	60.9	1.3e-121
WP_000835317.1|87666_87936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803510.1|87953_88565_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	7.2e-76
WP_045621879.1|88643_88832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032636367.1|88828_89125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032636366.1|89111_89591_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	61.0	2.1e-06
WP_032636365.1|89587_89818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057517839.1|89807_90023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803523.1|90437_90827_+	DNA-binding protein RdgB	NA	Q6QIE8	Burkholderia_phage	52.5	6.5e-30
WP_023304082.1|90846_91176_+	DUF3486 family protein	NA	H7BVL1	unidentified_phage	40.7	1.4e-06
WP_001567382.1|91554_92112_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001567383.1|92208_92475_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_003100847.1|95184_95742_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|95735_96107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|96103_96604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|96600_96927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|97181_97538_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|97527_97929_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|97925_98216_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100881.1|98290_101257_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
100247:100272	attR	GCGGCACTGGCCGAGCTGGTCAACGC	NA	NA	NA	NA
WP_149410382.1|101335_102340_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP043514	Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed3, complete sequence	16427	7122	14820	16427	integrase	Escherichia_phage(50.0%)	8	NA	NA
WP_006796638.1|7122_7554_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_032656724.1|7553_8816_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	2.9e-148
WP_000064119.1|8897_9872_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_006797591.1|9871_11077_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.1	1.2e-162
WP_023302476.1|12073_12940_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.6e-23
WP_032427600.1|13474_13588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|13716_13974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631000.1|14031_14820_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.5e-52
>prophage 1
NZ_CP043515	Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence	125849	43567	81994	125849	transposase,protease	Escherichia_phage(50.0%)	23	NA	NA
WP_149410391.1|43567_44548_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	4.4e-184
WP_164972931.1|44601_45072_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_047747539.1|45224_54563_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	24.7	6.0e-12
WP_000019450.1|54749_55730_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_023304016.1|58161_59313_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_023304017.1|59337_60303_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_001514138.1|60280_60778_-	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_023304018.1|60774_62490_-	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000786816.1|62493_62934_-	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	2.6e-11
WP_023304019.1|62923_64069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001090779.1|64148_64760_-	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_019077722.1|64849_65737_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_016154559.1|65839_66754_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001275372.1|66776_67235_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_023205099.1|67322_67463_-|protease	ATP-dependent metalloprotease FtsH	protease	NA	NA	NA	NA
WP_149410392.1|68210_68402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304020.1|68401_71251_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	2.6e-128
WP_004118809.1|71356_71926_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_013307885.1|71960_72242_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	6.8e-05
WP_032667972.1|72464_72728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023307218.1|76631_77018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149410393.1|78962_79943_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_080339306.1|80650_81994_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
