The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040392	Kosakonia radicincitans strain DSM 107547 chromosome, complete genome	5656428	1357662	1424340	5656428	plate,tail,lysis,tRNA,holin,integrase	Escherichia_phage(24.39%)	70	1369110:1369127	1411229:1411246
WP_007370710.1|1357662_1358430_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1358474_1358822_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_071531981.1|1358977_1359169_-	late control protein B	NA	Q37973	Salmonella_virus	71.9	1.3e-20
WP_071921213.1|1359243_1360386_-	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	53.1	1.1e-106
WP_007370713.1|1360382_1360844_-|tail	tail assembly protein	tail	A0A0F7LBX3	Escherichia_phage	64.1	5.6e-49
WP_149288438.1|1360840_1362553_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	39.1	5.2e-31
WP_061493592.1|1362545_1362665_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	7.5e-14
WP_007370715.1|1362697_1362979_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.5	2.7e-30
WP_007370716.1|1363041_1363560_-|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	90.1	4.5e-87
WP_007370717.1|1363572_1364754_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	88.3	1.3e-201
WP_149288439.1|1364883_1365477_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	49.5	6.4e-45
WP_144136255.1|1365476_1366598_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	48.9	1.2e-116
WP_144136256.1|1366795_1367392_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	58.4	6.8e-63
WP_072439244.1|1367391_1368447_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	47.5	3.5e-110
WP_149288440.1|1368601_1369552_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	77.2	1.4e-78
1369110:1369127	attL	GTCGCCAGCACCACTGCC	NA	NA	NA	NA
WP_007370724.1|1369706_1370315_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	76.0	4.5e-86
WP_144136258.1|1370307_1371216_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	79.5	1.2e-130
WP_007370726.1|1371220_1371568_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	73.0	2.8e-40
WP_144136259.1|1371564_1372200_-|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	78.7	2.4e-90
WP_072439247.1|1372287_1372755_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	60.1	4.8e-48
WP_149288441.1|1372850_1373276_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	53.1	5.6e-27
WP_149288442.1|1373272_1373782_-	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	75.5	4.3e-66
WP_064564426.1|1373765_1373987_-|holin	holin	holin	A0A218M4L5	Erwinia_phage	43.8	5.0e-11
WP_035888416.1|1373977_1374181_-|tail	tail protein X	tail	Q858W3	Yersinia_virus	66.7	3.5e-19
WP_035888419.1|1374379_1374565_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	55.7	6.0e-10
WP_149288443.1|1374636_1376610_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	72.4	5.4e-266
WP_007370737.1|1376610_1376832_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	69.0	6.9e-21
WP_007370738.1|1376831_1377059_-	DUF2732 family protein	NA	A0A218M4I9	Erwinia_phage	40.0	4.2e-05
WP_035888424.1|1377126_1377465_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	68.5	3.3e-38
WP_007370740.1|1377503_1377881_-	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	69.2	6.0e-41
WP_149288444.1|1377996_1378845_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	61.7	4.8e-94
WP_149288445.1|1378851_1379901_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	73.9	1.1e-153
WP_149288446.1|1380089_1380500_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_035888433.1|1380562_1381927_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_149288447.1|1382107_1383178_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	3.7e-91
WP_149288448.1|1383187_1384309_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_149288449.1|1384375_1385248_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_007370749.1|1385244_1386405_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_007370750.1|1386652_1386991_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_007370751.1|1387256_1387994_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_007370752.1|1388125_1389106_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_149288450.1|1389102_1389834_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_007370754.1|1389963_1392537_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.6	1.9e-125
WP_149288451.1|1398247_1399546_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.8	6.9e-44
WP_035888232.1|1399542_1399866_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_007370760.1|1399911_1401267_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_144136352.1|1401380_1404041_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_035888226.1|1404073_1404772_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_007370763.1|1404841_1405261_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	41.5	2.0e-13
WP_007370764.1|1405467_1406565_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_007370765.1|1406610_1407300_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.4	4.6e-55
WP_007370766.1|1407612_1407996_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	3.1e-32
WP_149288452.1|1408039_1409368_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.4	1.3e-42
WP_007370768.1|1409497_1410235_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_007370769.1|1410219_1411842_-	L-aspartate oxidase	NA	NA	NA	NA	NA
1411229:1411246	attR	GTCGCCAGCACCACTGCC	NA	NA	NA	NA
WP_007370770.1|1412262_1412838_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_035888221.1|1412869_1413523_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_071921197.1|1413522_1414476_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_007370773.1|1414472_1414952_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_035888216.1|1415097_1416897_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	7.2e-23
WP_035888214.1|1416912_1417887_+	signal peptidase I	NA	NA	NA	NA	NA
WP_007370776.1|1418099_1418780_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	1.3e-20
WP_007370777.1|1418776_1419688_+	GTPase Era	NA	NA	NA	NA	NA
WP_079518375.1|1419795_1420503_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_071921195.1|1420568_1421300_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_007370780.1|1421299_1421680_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_007370781.1|1421676_1421937_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_007370782.1|1421993_1422842_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035888209.1|1423127_1423763_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_007370784.1|1423821_1424340_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	42.2	7.3e-05
>prophage 2
NZ_CP040392	Kosakonia radicincitans strain DSM 107547 chromosome, complete genome	5656428	1608971	1675771	5656428	plate,holin	Tetraselmis_virus(20.0%)	56	NA	NA
WP_035889017.1|1608971_1610513_+|holin	choline-sulfatase	holin	A0A2P0VMN7	Tetraselmis_virus	21.5	8.6e-09
WP_149288480.1|1610515_1611460_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_071921140.1|1611766_1612855_+	YncE family protein	NA	NA	NA	NA	NA
WP_072440008.1|1612906_1615120_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_007370960.1|1615116_1616016_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144134913.1|1616112_1616637_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_149288481.1|1616647_1618051_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_007370964.1|1618340_1618601_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_035889025.1|1618888_1620829_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_007370967.1|1620843_1621230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035889029.1|1621375_1622773_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_007370969.1|1622980_1623850_+	DMT family transporter	NA	NA	NA	NA	NA
WP_144134787.1|1623838_1624636_-	PhzF family phenazine biosynthesis isomerase	NA	NA	NA	NA	NA
WP_007370971.1|1624701_1626120_-	MFS transporter	NA	NA	NA	NA	NA
WP_007370972.1|1626228_1627101_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007370973.1|1627075_1627462_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_007370974.1|1627451_1628042_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079517599.1|1628234_1629335_+	RomA family MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_007370976.1|1629373_1629715_+	RamA family antibiotic efflux transcriptional regulator	NA	NA	NA	NA	NA
WP_007370977.1|1629753_1630146_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_035889037.1|1630147_1630507_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_144134791.1|1631129_1633319_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007370980.1|1633362_1634550_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_035889039.1|1634904_1636143_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_007370984.1|1636219_1636540_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_149288482.1|1636662_1637661_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_149288483.1|1637841_1639497_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_007370987.1|1639500_1640736_-	ion channel protein	NA	NA	NA	NA	NA
WP_007370988.1|1640914_1641880_+	glucokinase	NA	NA	NA	NA	NA
WP_007370989.1|1641876_1642605_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.4	1.9e-14
WP_090396379.1|1642617_1644300_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_007370991.1|1644687_1645929_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099458783.1|1645979_1646051_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_007370992.1|1646623_1648147_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	36.9	5.8e-82
WP_007370993.1|1648243_1648891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007370994.1|1649475_1649973_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_149288484.1|1650007_1651555_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_035889045.1|1651573_1652911_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_149288485.1|1652907_1653561_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_149288486.1|1653660_1655289_+	OmpA family protein	NA	NA	NA	NA	NA
WP_007370999.1|1655294_1655786_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_149288487.1|1655953_1658602_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.9	1.6e-95
WP_007371002.1|1658603_1659209_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_007371003.1|1659205_1659433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149288488.1|1659513_1662054_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_149288489.1|1662055_1663993_+	lipase family protein	NA	G9E505	Ostreococcus_lucimarinus_virus	30.0	5.4e-08
WP_072440029.1|1663985_1664753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083596759.1|1664967_1665516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072440031.1|1665541_1665808_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_149288490.1|1665811_1666972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149288491.1|1666958_1670372_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_071921125.1|1670371_1671967_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_149288492.1|1671987_1673751_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_149288493.1|1673705_1674809_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_149288494.1|1674783_1675326_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_007371013.1|1675318_1675771_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP040392	Kosakonia radicincitans strain DSM 107547 chromosome, complete genome	5656428	2005751	2015089	5656428		Enterobacteria_phage(37.5%)	9	NA	NA
WP_149288580.1|2005751_2006816_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	7.3e-100
WP_072439753.1|2006831_2007707_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	68.4	2.2e-110
WP_144135070.1|2007745_2008636_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.3	3.9e-30
WP_144135068.1|2008650_2009199_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	1.4e-54
WP_007371293.1|2009342_2010749_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.1e-38
WP_007371295.1|2011014_2012181_+	UDP-glucose 6-dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	55.0	1.1e-112
WP_007371296.1|2012219_2013224_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.8	6.8e-31
WP_149289354.1|2013426_2014410_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_007371298.1|2014477_2015089_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.1	5.8e-17
>prophage 4
NZ_CP040392	Kosakonia radicincitans strain DSM 107547 chromosome, complete genome	5656428	2095604	2170425	5656428	transposase,tRNA,tail,integrase	Escherichia_phage(18.75%)	67	2141520:2141579	2172026:2172394
WP_149288617.1|2095604_2096876_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.9	4.5e-72
WP_149288618.1|2097304_2098753_+	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_149288619.1|2099089_2100376_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	8.0e-77
WP_149288620.1|2100630_2101858_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	90.4	9.5e-160
WP_149289356.1|2101890_2103273_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_019843901.1|2103552_2104209_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_149288621.1|2104347_2105467_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	5.1e-51
WP_019843902.1|2105902_2106517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149288622.1|2106511_2106766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149288623.1|2108863_2110429_-	carotenoid oxygenase family protein	NA	NA	NA	NA	NA
WP_072440334.1|2110438_2111911_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_149288624.1|2111907_2113743_-	FUSC family protein	NA	NA	NA	NA	NA
WP_149288625.1|2113874_2114498_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149288626.1|2114652_2116428_-	M24 family metallopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	32.8	1.6e-75
WP_149288627.1|2116444_2117899_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_107146599.1|2118029_2119007_-	oxidoreductase	NA	NA	NA	NA	NA
WP_007371377.1|2119069_2119714_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007371378.1|2119872_2120061_-	putative motility protein	NA	NA	NA	NA	NA
WP_107146600.1|2121348_2122173_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_007371381.1|2122169_2123390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149288628.1|2123631_2124975_-	allantoin permease	NA	NA	NA	NA	NA
WP_149288629.1|2125033_2126014_-	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_072440321.1|2125994_2126885_-	allophanate hydrolase subunit 1	NA	NA	NA	NA	NA
WP_079517730.1|2126874_2128275_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_007371386.1|2128291_2128543_-	biotin carboxyl carrier domain-containing protein	NA	NA	NA	NA	NA
WP_007371387.1|2128572_2129337_-	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_149288630.1|2129481_2130399_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007371389.1|2131375_2132293_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_007371390.1|2132394_2133345_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_149288631.1|2133599_2133809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149288632.1|2133769_2135299_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_149288633.1|2135288_2136308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149288634.1|2136369_2137698_-	shikimate transporter	NA	NA	NA	NA	NA
WP_107146604.1|2137762_2138014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007371396.1|2138548_2139175_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007371397.1|2139230_2140388_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
2141520:2141579	attL	GTGACCCGCCCCCAGTGTTAGATACAACTATCAGTTAGTAATGTCGGTTTGTTTACCTTC	NA	NA	NA	NA
WP_149288635.1|2142501_2142792_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_149288636.1|2142857_2143367_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_149288637.1|2143521_2143941_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_149288638.1|2143963_2145187_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_149288639.1|2145226_2145439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149288640.1|2145441_2146485_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_149288264.1|2146557_2147340_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.9e-135
WP_149288265.1|2147336_2148359_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.5e-174
WP_149288641.1|2148422_2149052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149288642.1|2149062_2150193_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_149288643.1|2150268_2151651_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.5	3.9e-45
WP_149289357.1|2151739_2152135_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_149288644.1|2152293_2153493_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_149288645.1|2153562_2153985_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_149289358.1|2154088_2154988_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_149288646.1|2154977_2155538_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_149288647.1|2155666_2156533_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_149288648.1|2156703_2158656_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.9	1.6e-121
WP_149288649.1|2158648_2159500_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_149288650.1|2159496_2160843_+	dihydroorotase	NA	NA	NA	NA	NA
WP_007371403.1|2161831_2162629_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_149288651.1|2162892_2163789_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	56.8	2.7e-87
WP_007371405.1|2163853_2164138_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_149288652.1|2165901_2166141_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	50.8	2.7e-10
WP_149288653.1|2166262_2166457_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	58.7	2.5e-14
WP_149288654.1|2166453_2166822_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.0	1.3e-40
WP_149288655.1|2166806_2167859_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	54.3	6.7e-106
WP_149288656.1|2167871_2168492_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	54.7	1.7e-61
WP_149288657.1|2168810_2169140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149289359.1|2169249_2169432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149288658.1|2170026_2170425_+|tail	tail fiber domain-containing protein	tail	K7PGY2	Enterobacteria_phage	57.8	4.8e-20
2172026:2172394	attR	GAAGGTAAACAAACCGACATTACTAACTGATAGTTGTATCTAACACTGGGGGCGGGTCACAGCGAACCGATACCGTCTTGGAAAGATCCTGCCGCAGGAATGTAAGAGGGCACAACGTTTTTTTCATCCCCTGGCTTTGATCGTGATGGATGTTGATGATTTCAAATTAATTAATGATCTATATGGTCATGCTCAGGGTGATACTACGTTGGTGATGATTGTATCCCATATACGTGACTGTCTGCGTATAAACGATTTACTGGCCCGGTGGGGAGGAGATGAGTTCATCATTGTTATGCCTCATACCACTAAGGAAGAGGCAGTTAGTGTGGCAATGAATATCCAGTTGGCTCTGACTCATATCAATAT	NA	NA	NA	NA
>prophage 5
NZ_CP040392	Kosakonia radicincitans strain DSM 107547 chromosome, complete genome	5656428	2398895	2465837	5656428	plate,protease	Tupanvirus(25.0%)	52	NA	NA
WP_035887401.1|2398895_2399465_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_007371688.1|2399467_2401339_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_149288692.1|2401335_2402379_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_149288693.1|2402423_2405036_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.1	6.4e-81
WP_007371691.1|2405062_2406499_+	protein kinase	NA	M1HXR9	Acanthocystis_turfacea_Chlorella_virus	27.3	3.6e-09
WP_035887397.1|2406648_2407029_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_149288694.1|2407087_2409013_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.9	6.4e-46
WP_149288695.1|2409025_2409832_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_149288696.1|2409824_2411156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090396665.1|2411155_2412226_+	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	41.6	4.7e-54
WP_149288697.1|2412646_2413033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149288698.1|2413389_2413650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007371712.1|2413947_2415597_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_007371713.1|2415648_2417160_-	anion permease	NA	NA	NA	NA	NA
WP_149288699.1|2417796_2420574_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.1	1.1e-70
WP_064565802.1|2420737_2421700_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_007371716.1|2421680_2422400_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_107146668.1|2422396_2424013_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_035887378.1|2424189_2425104_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_007371719.1|2425385_2427038_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_035887374.1|2427078_2428428_-	MFS transporter	NA	NA	NA	NA	NA
WP_007371723.1|2428838_2429537_+	glutamine amidotransferase	NA	A0A2K9L2L9	Tupanvirus	26.7	7.3e-08
WP_035888626.1|2429764_2430592_+	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_007371726.1|2430636_2432208_+	nitrogenase iron-iron protein, alpha chain	NA	NA	NA	NA	NA
WP_007371727.1|2432204_2432549_+	Fe-only nitrogenase subunit delta	NA	NA	NA	NA	NA
WP_149288700.1|2432560_2433949_+	Fe-only nitrogenase subunit beta	NA	NA	NA	NA	NA
WP_035888623.1|2433992_2434415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035888621.1|2434411_2434906_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_149288701.1|2434918_2435530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083566005.1|2435710_2437315_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_007371733.1|2437742_2438615_+|protease	serine protease	protease	NA	NA	NA	NA
WP_071920934.1|2438646_2440383_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_007371735.1|2440656_2442177_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_079517798.1|2442204_2443236_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.1	8.0e-35
WP_071920933.1|2443277_2444162_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007371738.1|2444245_2444599_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035888616.1|2444639_2445650_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_090396681.1|2445728_2446709_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007371742.1|2446886_2447096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035888614.1|2447441_2449625_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_007371744.1|2449946_2450735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149288702.1|2451277_2451832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149288703.1|2452353_2454864_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	34.1	2.3e-83
WP_149288704.1|2454883_2458312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007371748.1|2458318_2458939_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_007371749.1|2458935_2460297_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_072439907.1|2460298_2460928_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_071920930.1|2460927_2461980_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_035888596.1|2461986_2462286_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_007371753.1|2462285_2462732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149288705.1|2462742_2464881_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_149288706.1|2464895_2465837_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP040392	Kosakonia radicincitans strain DSM 107547 chromosome, complete genome	5656428	4070053	4078184	5656428		uncultured_Caudovirales_phage(33.33%)	11	NA	NA
WP_007373725.1|4070053_4070308_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	49.1	6.1e-05
WP_007373724.1|4070411_4070768_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	36.9	3.2e-07
WP_090397363.1|4071011_4071350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007373721.1|4071633_4072761_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	51.3	8.5e-99
WP_007373720.1|4072971_4073226_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	49.1	9.4e-06
WP_072438322.1|4073312_4073738_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	8.6e-52
WP_007373718.1|4073750_4075040_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.3	2.0e-168
WP_007373717.1|4075083_4075404_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	48.0	7.7e-21
WP_007373716.1|4075578_4076985_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_007373715.1|4076996_4077689_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	5.5e-32
WP_007373714.1|4077851_4078184_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	29.5	6.1e-05
>prophage 7
NZ_CP040392	Kosakonia radicincitans strain DSM 107547 chromosome, complete genome	5656428	4142838	4215831	5656428	plate,tail,protease,portal,tRNA,terminase,integrase,capsid,head	Enterobacteria_phage(32.56%)	78	4178355:4178374	4211799:4211818
WP_035889769.1|4142838_4143726_+|tail	tail fiber protein	tail	E3T4R8	Cafeteria_roenbergensis_virus	35.4	2.0e-10
WP_149289048.1|4143830_4149767_+	DUF4347 domain-containing protein	NA	NA	NA	NA	NA
WP_007373639.1|4149864_4151373_+	TolC family protein	NA	NA	NA	NA	NA
WP_007373630.1|4152991_4153858_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.2	3.8e-30
WP_007373629.1|4153859_4154072_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_071920392.1|4154358_4155858_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_007373627.1|4155939_4156956_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_043954539.1|4157184_4157706_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_035887331.1|4157831_4159217_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	33.2	1.4e-42
WP_007373624.1|4159390_4159885_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_149289049.1|4159887_4160610_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_149289050.1|4160699_4161533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149289051.1|4161529_4162471_+	DUF1848 family protein	NA	NA	NA	NA	NA
WP_007373622.1|4162588_4163098_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_007373621.1|4163094_4164162_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_144134252.1|4164260_4164809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149289052.1|4165147_4166233_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_149289053.1|4166304_4166964_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_007373617.1|4166956_4167979_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	A0A1V0SGN0	Hokovirus	28.1	5.7e-09
WP_149289054.1|4168036_4168873_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_149289055.1|4169174_4170326_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_149289056.1|4170522_4172937_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_149289057.1|4172933_4173620_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	2.3e-06
WP_007373612.1|4173590_4174214_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_007373611.1|4174243_4175014_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007373610.1|4175076_4175931_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_035887325.1|4176015_4176933_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_007373608.1|4176929_4177388_+	NfeD family protein	NA	NA	NA	NA	NA
WP_007373607.1|4177391_4177799_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_007373606.1|4177970_4178267_+	NINE protein	NA	M4ZS56	Bacillus_phage	65.6	1.8e-16
4178355:4178374	attL	CTTGACCTTCCCCTTGATGG	NA	NA	NA	NA
WP_074776716.1|4178432_4179455_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	48.6	8.3e-93
WP_074776715.1|4179524_4179824_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	65.7	1.2e-31
WP_149289058.1|4179949_4180168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074776713.1|4180172_4180436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074776712.1|4180434_4180668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071921834.1|4180881_4181217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074776711.1|4181249_4181453_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	75.4	8.9e-23
WP_149289059.1|4181442_4181673_+	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	78.9	2.6e-31
WP_074776709.1|4181757_4181964_+	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	57.8	4.0e-15
WP_074776708.1|4181968_4182208_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	50.7	1.3e-09
WP_149289060.1|4182207_4182426_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	63.9	7.5e-20
WP_149289377.1|4182432_4183296_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	64.6	2.8e-102
WP_149289061.1|4183327_4185778_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	38.5	8.8e-141
WP_149289062.1|4185931_4186633_+	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	72.6	7.4e-93
WP_149289063.1|4186697_4186970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149289064.1|4186953_4187499_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_149289065.1|4187652_4188156_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_149289066.1|4188826_4189879_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.7	8.1e-144
WP_079518311.1|4189881_4191603_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.3	5.6e-227
WP_071920372.1|4191762_4192596_+|capsid	GPO family capsid scaffolding protein	capsid	B9A7B4	Serratia_phage	66.8	2.3e-101
WP_071920371.1|4192619_4193669_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.4	2.7e-107
WP_149289067.1|4193717_4194626_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	74.0	2.3e-86
WP_149289068.1|4194728_4195226_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	70.9	6.9e-61
WP_149289069.1|4195225_4195426_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	8.7e-15
WP_149289070.1|4195477_4195780_+	hypothetical protein	NA	O64361	Escherichia_phage	67.3	1.6e-31
WP_090137603.1|4195779_4196265_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	56.9	3.5e-49
WP_149289071.1|4196261_4196825_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	55.8	9.0e-41
WP_149289072.1|4196821_4197283_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	50.0	3.9e-34
WP_149289073.1|4197279_4197921_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	50.0	6.2e-46
WP_149289074.1|4197920_4198505_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	63.0	5.1e-63
WP_149289075.1|4198501_4198870_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	62.6	2.7e-33
WP_149289076.1|4198856_4199753_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	67.4	7.8e-103
WP_071920359.1|4199745_4200354_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	64.4	1.5e-70
WP_149289077.1|4200350_4201661_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	58.0	1.2e-149
WP_149289078.1|4201660_4202251_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	53.1	1.4e-47
WP_149289079.1|4202381_4203488_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_149289080.1|4203910_4204399_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.3	8.1e-54
WP_149289081.1|4204410_4207374_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	41.9	4.3e-190
WP_143468281.1|4207354_4207525_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	59.1	7.9e-09
WP_074776683.1|4207521_4207821_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	75.8	2.8e-33
WP_071920348.1|4207877_4208393_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	60.4	1.2e-52
WP_090137616.1|4208393_4209575_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	67.8	3.7e-153
WP_149289082.1|4209725_4210877_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	78.6	6.3e-174
WP_149289083.1|4210925_4211174_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_149289084.1|4211211_4211601_-	hypothetical protein	NA	B9A7A8	Serratia_phage	55.8	2.7e-36
WP_149289085.1|4211874_4214373_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.1e-111
4211799:4211818	attR	CTTGACCTTCCCCTTGATGG	NA	NA	NA	NA
WP_144134244.1|4214462_4215272_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_007373603.1|4215351_4215831_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP040392	Kosakonia radicincitans strain DSM 107547 chromosome, complete genome	5656428	5489985	5585109	5656428	plate,tRNA,protease,tail	Escherichia_phage(42.86%)	93	NA	NA
WP_071921770.1|5489985_5491086_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_007369204.1|5491123_5491489_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_035889190.1|5491488_5492142_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_035889188.1|5492337_5493738_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_007369207.1|5493720_5494638_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_007369208.1|5494898_5496272_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_090398622.1|5496389_5497166_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_007369210.1|5497176_5498181_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_035889183.1|5498349_5499501_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_035889182.1|5499765_5502417_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_007369213.1|5502511_5503363_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071921769.1|5503580_5504243_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.4	1.9e-29
WP_007369215.1|5504254_5505358_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_071921768.1|5505443_5506334_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_007369218.1|5506539_5508972_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_007369219.1|5508974_5510135_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_007369220.1|5510398_5510716_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_139201294.1|5510774_5510984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007369223.1|5511019_5511232_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_071921767.1|5511439_5513632_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_149289300.1|5513756_5514782_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_035889181.1|5514875_5515877_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_007369227.1|5515969_5516500_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_079517135.1|5516509_5517841_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.7	5.4e-44
WP_035889179.1|5517907_5518837_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_007369230.1|5518929_5519415_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_007369231.1|5519587_5519833_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_149289301.1|5520259_5521108_+	MIP family channel protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.7	4.4e-15
WP_149289302.1|5521129_5522638_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_007369234.1|5522739_5523750_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_007369235.1|5523846_5524593_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_007369236.1|5524593_5525013_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_007369237.1|5525125_5525725_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_007369238.1|5525832_5526600_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_072441548.1|5526740_5528045_-	citrate transporter	NA	NA	NA	NA	NA
WP_007369240.1|5528118_5528877_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_149289303.1|5529001_5529991_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_007369242.1|5530139_5531102_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_071921762.1|5531301_5532186_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_072441551.1|5532382_5532607_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_149289392.1|5532947_5533166_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	87.5	3.0e-32
WP_149289304.1|5534395_5534872_-|tail	phage tail protein	tail	O64315	Escherichia_phage	72.6	1.3e-61
WP_149289305.1|5534887_5537329_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	70.7	3.5e-246
WP_071531957.1|5537321_5537441_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	3.3e-14
WP_007370054.1|5537473_5537749_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	86.8	3.3e-36
WP_007370053.1|5537810_5538329_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	91.9	1.8e-88
WP_149289306.1|5538341_5539532_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	88.9	3.0e-203
WP_144136388.1|5539802_5540657_+	benzoate transporter	NA	A0A0N9QAD0	Chrysochromulina_ericina_virus	32.5	6.6e-27
WP_072441519.1|5540681_5541188_-|tail	phage tail protein	tail	A0A1S6KZZ1	Salmonella_phage	30.6	8.5e-14
WP_149289307.1|5541190_5542756_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	78.0	1.7e-89
WP_149289308.1|5542766_5543297_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	85.7	3.8e-89
WP_149289309.1|5543289_5544198_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	81.1	6.0e-135
WP_149289310.1|5544202_5544547_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	69.6	8.8e-39
WP_149289311.1|5545278_5545821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149289312.1|5545817_5546219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149289393.1|5547282_5547777_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_035889119.1|5547928_5548627_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	3.1e-06
WP_007369293.1|5548623_5549997_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.1	4.2e-15
WP_007369294.1|5550028_5550703_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_035889202.1|5550863_5551757_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_007369296.1|5551832_5552816_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_007369297.1|5553074_5553695_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_035889113.1|5553984_5555019_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_107147506.1|5555019_5555868_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_072441494.1|5555941_5556778_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_107147508.1|5556837_5556921_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_149289313.1|5557077_5558547_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_149289314.1|5558543_5559803_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_007369303.1|5559951_5560782_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_072441486.1|5560906_5561893_+	rhamnose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_149289315.1|5561944_5563456_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	1.5e-18
WP_107147516.1|5563455_5564460_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_071921752.1|5564456_5565461_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007369309.1|5565586_5566735_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_007369310.1|5566731_5567046_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_007369311.1|5567079_5567820_-	molecular chaperone	NA	NA	NA	NA	NA
WP_007369312.1|5567816_5569136_-	fimbrial protein	NA	NA	NA	NA	NA
WP_007369313.1|5569151_5571677_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_072441477.1|5571725_5572448_-	molecular chaperone	NA	NA	NA	NA	NA
WP_051644045.1|5572494_5573034_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_007369317.1|5573463_5574012_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035889098.1|5574115_5574778_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_007369319.1|5574777_5575101_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_007369320.1|5575141_5575354_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_007369321.1|5575468_5576308_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_139201295.1|5576547_5579598_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.4	2.1e-06
WP_035890345.1|5579610_5580513_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_007369325.1|5580509_5581145_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_007369326.1|5581141_5582071_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_035890346.1|5582370_5583282_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035890347.1|5583299_5583638_+	steroid Delta-isomerase	NA	NA	NA	NA	NA
WP_090398653.1|5583685_5584675_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_007369330.1|5584671_5585109_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP040393	Kosakonia radicincitans strain DSM 107547 plasmid pKrDSM107547, complete sequence	118312	0	11972	118312	integrase,transposase	Macacine_betaherpesvirus(50.0%)	10	67:80	4557:4570
67:80	attL	CCAGAAACTGACGA	NA	NA	NA	NA
WP_149289494.1|73_295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149289394.1|377_1031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149289395.1|1060_1807_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_149289396.1|2269_3046_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.4	1.1e-25
WP_149289397.1|3066_4299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149289398.1|4426_5515_+	hsdR	NA	NA	NA	NA	NA
4557:4570	attR	TCGTCAGTTTCTGG	NA	NA	NA	NA
WP_149289399.1|5673_6820_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	2.5e-146
WP_149289400.1|7051_8419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149289401.1|8795_9542_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	88.3	9.9e-128
WP_149289402.1|10997_11972_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	45.4	2.6e-67
>prophage 2
NZ_CP040393	Kosakonia radicincitans strain DSM 107547 plasmid pKrDSM107547, complete sequence	118312	17115	17769	118312		Faecalibacterium_phage(100.0%)	1	NA	NA
WP_149289407.1|17115_17769_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	39.8	2.0e-31
>prophage 3
NZ_CP040393	Kosakonia radicincitans strain DSM 107547 plasmid pKrDSM107547, complete sequence	118312	26227	32534	118312	transposase	uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_004187019.1|26227_26512_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	6.4e-19
WP_004187025.1|26501_26750_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_149288265.1|28251_29274_+|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.5e-174
WP_149288264.1|29270_30053_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.9e-135
WP_149289418.1|30989_32534_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	1.2e-10
>prophage 4
NZ_CP040393	Kosakonia radicincitans strain DSM 107547 plasmid pKrDSM107547, complete sequence	118312	38233	39055	118312		Cronobacter_phage(100.0%)	1	NA	NA
WP_149289427.1|38233_39055_+	DUF932 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	4.2e-47
>prophage 5
NZ_CP040393	Kosakonia radicincitans strain DSM 107547 plasmid pKrDSM107547, complete sequence	118312	45561	46428	118312		Cronobacter_phage(100.0%)	1	NA	NA
WP_149289488.1|45561_46428_+	prohibitin family protein	NA	K4F6D5	Cronobacter_phage	54.8	7.1e-53
>prophage 6
NZ_CP040393	Kosakonia radicincitans strain DSM 107547 plasmid pKrDSM107547, complete sequence	118312	53870	54218	118312		Escherichia_phage(100.0%)	1	NA	NA
WP_149289444.1|53870_54218_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	37.5	6.8e-15
>prophage 7
NZ_CP040393	Kosakonia radicincitans strain DSM 107547 plasmid pKrDSM107547, complete sequence	118312	83891	86252	118312		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_149289465.1|83891_84659_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	29.0	1.7e-21
WP_149289466.1|84998_86252_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	30.9	2.7e-45
>prophage 8
NZ_CP040393	Kosakonia radicincitans strain DSM 107547 plasmid pKrDSM107547, complete sequence	118312	94364	116374	118312	integrase,transposase	Escherichia_phage(22.22%)	18	97184:97198	117027:117041
WP_149289470.1|94364_95495_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.2	7.4e-18
WP_149289471.1|96040_96619_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.6	1.9e-22
WP_149289472.1|97049_97241_-	hypothetical protein	NA	NA	NA	NA	NA
97184:97198	attL	TCAACCGGGTCAGCG	NA	NA	NA	NA
WP_149289473.1|97670_99329_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	1.1e-12
WP_149289493.1|100360_100579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149289474.1|101196_101976_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	1.3e-50
WP_149289475.1|101975_102794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149289476.1|102846_103149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149289477.1|103636_104512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149288265.1|104670_105693_+|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.3	1.5e-174
WP_149288264.1|105689_106472_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.9e-135
WP_149289478.1|106562_107693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149289479.1|107889_110694_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	45.0	1.7e-07
WP_072441258.1|111072_111342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149289480.1|112000_112789_+	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
WP_149289481.1|113040_113370_-	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_149289482.1|113512_114412_-	DNA adenine methylase	NA	A0A2K9R7J9	Dishui_lake_phycodnavirus	25.7	2.0e-13
WP_149289483.1|115825_116374_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	79.1	2.7e-74
117027:117041	attR	CGCTGACCCGGTTGA	NA	NA	NA	NA
