The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031500	Deinococcus radiodurans strain R1 dM1 chromosome I, complete sequence	2647538	2140127	2149328	2647538	protease	Roseobacter_phage(16.67%)	9	NA	NA
WP_010886939.1|2140127_2141516_-	nicotinate phosphoribosyltransferase	NA	A0A1B0V392	Roseobacter_phage	51.1	5.0e-125
WP_010886940.1|2141568_2142417_-	phosphoprotein phosphatase	NA	A0A2H4PRN7	Proteus_phage	25.0	2.0e-07
WP_010886941.1|2142413_2142710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886942.1|2142753_2144226_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_010886943.1|2144301_2144925_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	31.3	9.7e-20
WP_010886944.1|2144924_2145542_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	24.5	5.0e-08
WP_027480282.1|2145624_2146725_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	22.7	5.2e-08
WP_010886946.1|2146721_2147018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886947.1|2147399_2149328_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	40.5	2.3e-112
>prophage 2
NZ_CP031500	Deinococcus radiodurans strain R1 dM1 chromosome I, complete sequence	2647538	2454035	2463229	2647538		Bacillus_phage(50.0%)	10	NA	NA
WP_010887241.1|2454035_2455037_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	31.6	4.4e-06
WP_010887242.1|2455094_2455763_-	SCO family protein	NA	NA	NA	NA	NA
WP_010887243.1|2455819_2456413_+	M23 family metallopeptidase	NA	A0A0Y0AH42	Bacillus_phage	39.1	7.4e-09
WP_010887244.1|2456513_2457353_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	50.0	1.8e-61
WP_010887245.1|2457492_2457732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081816010.1|2457997_2459728_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.2	4.9e-53
WP_010887247.1|2459729_2460326_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	31.2	3.1e-07
WP_010887248.1|2460322_2461969_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_010887249.1|2461965_2462532_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010887250.1|2462545_2463229_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.2	5.9e-10
>prophage 1
NZ_CP031502	Deinococcus radiodurans strain R1 dM1 plasmid pMP1, complete sequence	177339	18415	150428	177339	transposase,integrase	Bacillus_phage(27.59%)	109	19535:19572	92832:92869
WP_010884022.1|18415_19399_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
19535:19572	attL	AACAGTCGGCCCCATCAAGCTTGATGGGGCCGACTGTT	NA	NA	NA	NA
WP_010884035.1|19763_20477_+	DUF2259 domain-containing protein	NA	NA	NA	NA	NA
WP_010884077.1|20575_20923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082865520.1|20884_22087_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010884071.1|23567_24167_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_010883967.1|24347_26708_-	glycerophosphoryl diester phosphodiesterase	NA	A0A2P1N091	Streptomyces_phage	36.0	3.2e-07
WP_010884021.1|26715_26979_-	thioredoxin	NA	NA	NA	NA	NA
WP_010883966.1|26971_28036_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A142F1R6	Bacillus_phage	50.8	7.8e-86
WP_010883965.1|28023_30132_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	47.5	6.8e-190
WP_010883964.1|30095_30521_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S5MA49	Bacillus_phage	33.3	5.1e-12
WP_010883963.1|30677_31121_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010884065.1|31100_31292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010883962.1|31593_32628_-|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	33.3	1.3e-08
WP_063653103.1|32785_33961_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010884020.1|34186_35170_+|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
WP_081816080.1|35593_36475_+	hypothetical protein	NA	A0A1V0SK86	Klosneuvirus	27.6	6.6e-30
WP_010884034.1|36667_37300_+	RNA ligase family protein	NA	A0A248SJ81	Salicola_phage	49.0	5.5e-55
WP_010884064.1|37296_38154_+	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	38.4	7.6e-39
WP_010884033.1|38129_39371_+	AAA family ATPase	NA	D5GVP0	Campylobacter_virus	31.4	7.2e-06
WP_010884032.1|39454_40414_-	alpha/beta hydrolase	NA	A0A218MNI3	uncultured_virus	40.8	6.0e-61
WP_010884031.1|40412_40751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884030.1|41505_42534_-	RNA ligase (ATP)	NA	D4N471	Pseudomonas_phage	24.3	9.4e-12
WP_010883960.1|42774_43869_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.0	1.3e-14
WP_010883959.1|44051_44777_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	24.6	1.4e-06
WP_010883958.1|44976_45636_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.0	2.8e-25
WP_010883957.1|45632_46988_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.0	4.0e-10
WP_010884029.1|47141_48557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010883956.1|48903_50001_-	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
WP_010883955.1|50006_50660_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_010883954.1|50789_52496_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_010884066.1|52498_52714_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_010884028.1|52902_53106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010883953.1|53102_55130_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	25.6	3.2e-35
WP_034351346.1|55270_56818_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_010883952.1|56810_57440_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010883951.1|57474_58242_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010883950.1|58462_59650_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_027480350.1|59668_60439_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010884061.1|60408_61194_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010884014.1|61262_62081_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.4	2.5e-15
WP_027480352.1|62340_64821_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A2D2W2B1	Stenotrophomonas_phage	40.5	3.2e-05
WP_010884013.1|64822_65770_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_010884012.1|65908_67705_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_010884011.1|67752_68094_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_010884060.1|68184_68436_+	PqqD family protein	NA	NA	NA	NA	NA
WP_010884063.1|68432_69296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884010.1|69331_71566_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	29.7	4.9e-21
WP_010884059.1|71583_74244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884009.1|74956_78160_-	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_010884058.1|78312_79737_+	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_010884057.1|79796_83234_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_010884056.1|83582_83909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884055.1|83913_86103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884054.1|86080_86812_-	molecular chaperone	NA	NA	NA	NA	NA
WP_010884053.1|86853_87276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884052.1|87384_87762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884008.1|87999_89250_-|transposase	IS4 family transposase	transposase	A0A218MNH3	uncultured_virus	28.1	1.8e-36
WP_063653099.1|89464_90640_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_010884019.1|90644_91628_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_149358002.1|92155_92671_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010884051.1|93514_94045_-	hypothetical protein	NA	NA	NA	NA	NA
92832:92869	attR	AACAGTCGGCCCCATCAAGCTTGATGGGGCCGACTGTT	NA	NA	NA	NA
WP_027480379.1|94504_95503_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_081816081.1|95457_96096_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_010884007.1|96092_96494_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_010884050.1|96784_98929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884049.1|99138_100347_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010884017.1|100343_100991_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.4e-23
WP_010884048.1|100987_101446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027480382.1|101865_103632_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_010884076.1|103704_103980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884006.1|104035_105586_-	sensor domain-containing diguanylate cyclase	NA	A0A2D0W9B6	Bordetella_phage	48.7	4.6e-10
WP_010884005.1|106044_107343_-	MFS transporter	NA	NA	NA	NA	NA
WP_010884004.1|107355_109092_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051618918.1|109120_111934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884046.1|112381_114652_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_010884044.1|115257_117333_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_010884043.1|118745_119702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884003.1|119861_120521_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.5	7.9e-12
WP_010884002.1|120542_123044_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_010884075.1|123181_123502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884001.1|123716_124853_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A240F4U1	Ochrobactrum_phage	32.5	1.4e-11
WP_010884016.1|124849_125761_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	32.1	2.8e-07
WP_010884000.1|125898_127149_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.0	3.5e-16
WP_010883999.1|127126_128860_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.5	1.0e-26
WP_010883998.1|128856_129912_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_010883997.1|130006_130420_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_010883996.1|130400_130826_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_010883995.1|130831_131731_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_010884042.1|131819_132929_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010884041.1|133100_133652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884074.1|133723_134032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010884015.1|134263_135247_+|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
WP_149358003.1|135535_135880_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_149358004.1|135840_136542_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	3.2e-35
WP_082865519.1|136617_137820_-|transposase	IS4-like element ISDra7 family transposase	transposase	NA	NA	NA	NA
WP_010884024.1|137955_138696_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_010883994.1|138703_139489_-	heme ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	4.2e-12
WP_010883993.1|139485_140550_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_010883992.1|140546_141455_-	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081816091.1|141783_142044_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027480395.1|142044_142425_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_010883991.1|142713_144192_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_010883990.1|144145_145153_-	histidinol-phosphate aminotransferase family protein	NA	NA	NA	NA	NA
WP_010883989.1|145145_146048_-	cobalamin biosynthesis protein CobD	NA	NA	NA	NA	NA
WP_010883988.1|146038_147364_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_010883987.1|147353_147977_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_010883986.1|147973_149032_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010884067.1|149074_149257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010884020.1|149444_150428_-|transposase	IS4-like element ISDra1 family transposase	transposase	NA	NA	NA	NA
