The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	878342	940534	5074423	tRNA,transposase,plate,protease	Emiliania_huxleyi_virus(12.5%)	52	NA	NA
WP_001295561.1|878342_879695_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|879724_882157_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|882278_882764_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|882767_883793_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|883897_884353_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|884356_885145_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|885144_886293_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|886289_886886_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|886922_890405_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|890417_891377_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|891475_893617_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|893673_894063_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|894127_895426_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|895474_895735_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|895721_895922_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|896087_896633_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|896629_897052_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|897065_897776_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_077251589.1|897782_898034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|898025_899006_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_149508869.1|900086_901805_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|901916_902624_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202335.1|902620_903025_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|903142_903958_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|903997_904651_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|904643_905675_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140163.1|905862_906435_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|912195_912999_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648606.1|912995_913910_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|914150_914951_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211690.1|915028_915799_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|915846_917205_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|917276_918032_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|918065_918788_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|918784_919252_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|919316_920048_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_149508870.1|920588_921374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|921510_921990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|921999_922914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|922957_923440_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_149508871.1|923463_924816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985538.1|924826_928261_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240530.1|928369_929782_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088859.1|929786_930530_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_149508872.1|930526_933286_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.4	1.8e-81
WP_000343293.1|933294_934056_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|934060_935392_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|935394_935919_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113703.1|935915_937196_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|937220_938303_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|938266_940117_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|940120_940534_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	1250500	1320037	5074423	terminase,head,tRNA,transposase,tail,capsid,portal,integrase,protease,lysis	Enterobacteria_phage(53.23%)	81	1260230:1260289	1310106:1311436
WP_000912345.1|1250500_1251886_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1251921_1252443_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1252550_1252763_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|1252764_1253631_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001369891.1|1254111_1254654_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|1254873_1255566_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_149508878.1|1258217_1259225_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_032197797.1|1259235_1259751_+	fimbria assembly protein	NA	NA	NA	NA	NA
1260230:1260289	attL	TAGACTGGCCCCCTGAATCTCCAGACAACCAATATCACTTAAATAAGTGATAGTCTTAAT	NA	NA	NA	NA
WP_085947917.1|1260275_1261548_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000051902.1|1262056_1263220_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|1263075_1263447_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|1263418_1263697_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|1263744_1263963_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|1264061_1264343_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|1264353_1264545_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1264517_1264700_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|1264696_1265377_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|1265373_1266159_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995453.1|1266164_1266461_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.8e-48
WP_023143023.1|1266536_1266827_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.6	4.2e-26
WP_000858975.1|1267338_1268028_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|1268132_1268363_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182893.1|1268432_1268972_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	66.5	2.2e-60
WP_001378761.1|1269058_1269988_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	67.6	1.0e-110
WP_000788786.1|1269984_1270686_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.3e-129
WP_000145915.1|1270682_1270985_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070442.1|1271052_1271385_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|1271476_1271584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|1271641_1273168_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_001567061.1|1273279_1273597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|1273801_1274731_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001309322.1|1274829_1274931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053033.1|1274927_1275383_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224919.1|1275382_1275553_+	NinE family protein	NA	NA	NA	NA	NA
WP_000774488.1|1275545_1275836_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099700.1|1275832_1276195_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_000971068.1|1276191_1276332_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|1276417_1276801_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|1276990_1278088_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|1278676_1278892_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|1278891_1279389_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1279605_1279788_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1279878_1280172_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|1280531_1280726_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_032152690.1|1280741_1280999_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	97.1	2.0e-11
WP_063082806.1|1281114_1281660_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027283.1|1281634_1283560_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1283556_1283763_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001369921.1|1283759_1285361_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000123309.1|1285341_1286661_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
WP_001378764.1|1286670_1287003_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	4.2e-54
WP_000063221.1|1287058_1288084_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_000158880.1|1288125_1288521_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
WP_000752994.1|1288532_1288886_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975110.1|1288897_1289476_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	5.0e-79
WP_000683142.1|1289472_1289868_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_001378767.1|1289875_1290616_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000479193.1|1290631_1291054_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|1291035_1291470_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001774776.1|1291462_1294042_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.5	0.0e+00
WP_000847379.1|1294038_1294368_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|1294367_1295066_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194783.1|1295071_1295815_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090895.1|1295751_1296384_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_061091987.1|1296444_1299858_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
WP_149508879.1|1299928_1300528_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	2.8e-109
WP_000279163.1|1300592_1303553_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|1303552_1304128_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|1304225_1304816_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|1305132_1305366_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1305434_1305548_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|1305913_1306582_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|1306638_1306944_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226378.1|1307127_1308612_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|1308798_1309752_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_085947917.1|1310151_1311424_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_149508880.1|1311600_1312362_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1310106:1311436	attR	TAGACTGGCCCCCTGAATCTCCAGACAACCAATATCACTTAAATAAGTGATAGTCTTAATACTAGTTTTTAGACTAGTCATTGGAGAACAGATGATTGATGTCTTAGGGCCGGAGAAACGCAGACGGCGTACCACACAGGAAAAGATCGCAATTGTTCAGCAGAGCTTTGAACCGGGGATGACGGTCTCCCTCGTTGCCCGGCAACATGGTGTAGCAGCCAGCCAGTTATTTCTCTGGCGTAAGCAATACCAGGAAGGAAGTCTTACTGCTGTCGCCGCCGGAGAACAGGTTGTTCCTGCCTCTGAACTTGCTGCCGCCATGAAGCAGATTAAAGAACTCCAGCGCCTGCTCGGCAAGAAAACGATGGAAAATGAACTCCTCAAAGAAGCCGTTGAATATGGACGGGCAAAAAAGTGGATAGCGCACGCGCCCTTATTGCCCGGGGATGGGGAGTAAGCTTAGTCAGCCGTTGTCTCCGGGTGTCGCGTGCGCAGTTGCACGTCATTCTCAGACGAACCGATGACTGGATGGATGGCCGCCGCAGTCGTCACACTGATGATACGGATGTGCTTCTCCGTATACACCATGTTATCGGAGAGCTGCCCACGTATGGTTATCGTCGGGTATGGGCGCTGCTTCGCAGACAGGCAGAACTTGATGGTATGCCTGCGATCAATGCCAAACGTGTTTACCGGATCATGCGCCAGAATGCGCTGTTGCTTGAGCGAAAACCTGCTGTACCGCCATCGAAACGGGCACATACAGGCAGAGTGGCCGTGAAAGAAAGCAATCAGCGATGGTGCTCTGACGGGTTCGAGTTCTGCTGTGATAACGGAGAGAGACTGCGTGTCACGTTCGCGCTGGACTGCTGTGATCGTGAGGCACTGCACTGGGCGGTCACTACCGGCGGCTTCAACAGTGAAACAGTACAGGACGTCATGCTGGGAGCGGTGGAACGCCGCTTCGGCAACGATCTTCCGTCGTCTCCAGTGGAGTGGCTGACGGATAATGGTTCATGCTACCGGGCTAATGAAACACGCCAGTTCGCCCGGATGTTGGGACTTGAACCGAAGAACACGGCGGTGCGGAGTCCGGAGAGTAACGGAATAGCAGAGAGCTTCGTGAAAACGATAAAGCGTGACTACATCAGTATCATGCCCAAACCAGACGGGTTAACGGCAGCAAAGAACCTTGCAGAGGCGTTCGAGCATTATAACGAATGGCATCCGCATAGTGCGCTGGGTTATCGCTCGCCACGGGAATATCTGCGGCAGCGGGCTTGTAATGGGTTAAGTGATAACAGATGTCTGGAAATATAGGGGCAAATCCA	NA	NA	NA	NA
WP_001224569.1|1312544_1313435_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662376.1|1313435_1316408_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383954.1|1316394_1318632_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000394594.1|1318900_1320037_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	1590018	1655567	5074423	terminase,head,plate,transposase,capsid,tail,portal,integrase,lysis	Salmonella_phage(76.09%)	72	1581944:1581959	1658644:1658659
1581944:1581959	attL	CAGCGCCACCGCCAGT	NA	NA	NA	NA
WP_000399648.1|1590018_1590999_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168779.1|1591259_1592525_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|1592676_1593492_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209359.1|1593637_1596070_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|1596075_1596975_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000829261.1|1597946_1598696_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397381.1|1598695_1599931_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|1600134_1601100_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001315369.1|1601086_1602958_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090136.1|1602977_1604516_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|1604533_1605454_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|1605456_1606368_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001349442.1|1606545_1608894_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_149508892.1|1608901_1610230_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000049367.1|1610276_1611602_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|1611814_1612198_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_149508893.1|1612308_1613424_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_001295292.1|1613420_1614047_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000195961.1|1614292_1615495_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450133.1|1615541_1616300_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|1616357_1616954_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180076.1|1617238_1618471_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|1618511_1618796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|1618881_1619697_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|1619696_1620905_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|1620988_1621525_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000290937.1|1621629_1622682_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001513672.1|1622870_1623062_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047320.1|1623077_1623647_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001247707.1|1623772_1623994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|1624026_1624536_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|1624543_1624744_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001352070.1|1624707_1625049_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_001244216.1|1625116_1625350_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752613.1|1625349_1625577_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104157.1|1625573_1626431_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_059241718.1|1626427_1628842_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.4	0.0e+00
WP_001154434.1|1628995_1629184_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1629194_1629428_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_149508894.1|1629715_1631293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059241720.1|1631694_1633434_+	AIPR family protein	NA	NA	NA	NA	NA
WP_059241723.1|1633466_1634495_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	1.2e-171
WP_001098431.1|1634494_1636261_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216238.1|1636403_1637237_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_000742511.1|1637253_1638312_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|1638315_1638966_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|1639061_1639526_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868192.1|1639525_1639729_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_000171568.1|1639732_1639948_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001442491.1|1639967_1640441_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_059241725.1|1640442_1640820_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001337513.1|1640816_1641245_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_001177677.1|1641174_1641378_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	6.1e-24
WP_001608130.1|1641340_1641772_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	8.4e-71
WP_000829141.1|1641764_1642211_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_149508895.1|1642279_1642858_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
WP_000177590.1|1642854_1643214_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_001608132.1|1643200_1644109_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	9.2e-144
WP_001086844.1|1644101_1644707_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	9.8e-110
WP_021542073.1|1644703_1646233_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	72.5	3.6e-201
WP_149508896.1|1646232_1646835_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	4.6e-99
WP_021542075.1|1646806_1647250_-|tail	phage tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	94.6	1.0e-79
WP_059241729.1|1647270_1647681_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	91.9	3.4e-61
WP_000905031.1|1647711_1648278_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	2.9e-87
WP_000046141.1|1648420_1649593_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_001207660.1|1649602_1650118_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281004.1|1650172_1650475_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
WP_000763311.1|1650489_1650609_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_059241730.1|1650601_1653679_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980413.1|1653675_1654161_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_059241733.1|1654157_1655258_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	6.5e-176
WP_000972391.1|1655348_1655567_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1658644:1658659	attR	ACTGGCGGTGGCGCTG	NA	NA	NA	NA
>prophage 4
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	1784419	1849494	5074423	terminase,tail,portal,integrase,holin,protease,lysis	Escherichia_phage(41.51%)	79	1799515:1799574	1844760:1844821
WP_000156526.1|1784419_1786180_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877158.1|1786365_1786818_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750419.1|1786892_1787945_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1788301_1788811_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1789029_1789659_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875044.1|1789621_1791784_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1791793_1792240_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001315388.1|1792362_1794417_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|1794448_1794907_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1795002_1795665_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1795837_1796251_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1796295_1796613_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1796670_1797861_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048250.1|1797955_1798234_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1798230_1798560_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1798650_1799310_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1799515:1799574	attL	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGAC	NA	NA	NA	NA
WP_149508900.1|1799717_1800737_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.0	7.5e-86
WP_000273163.1|1800705_1800957_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_149508901.1|1801023_1803459_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	54.4	4.0e-53
WP_000092786.1|1803554_1803743_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1803739_1803928_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_028985610.1|1804451_1804826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050457572.1|1804837_1804990_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_028985609.1|1805256_1805973_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	45.0	1.1e-54
WP_000471550.1|1806022_1806238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693925.1|1806234_1806660_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262404.1|1806728_1807760_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	70.0	5.8e-86
WP_001376360.1|1807791_1808214_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	7.4e-72
WP_088376919.1|1808247_1808964_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	1.5e-72
WP_097469817.1|1808996_1809278_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_044808599.1|1809274_1809580_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.1	2.2e-49
WP_001289674.1|1809566_1809878_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	1.1e-48
WP_001369935.1|1809878_1810205_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	88.5	2.0e-24
WP_000559545.1|1810140_1810539_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	96.6	2.2e-57
WP_000137950.1|1810634_1811006_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_105475137.1|1811002_1811485_+	hypothetical protein	NA	A0A0N7KZ94	Stx2-converting_phage	92.0	2.9e-19
WP_062863467.1|1811969_1812182_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	75.7	4.4e-17
WP_074015431.1|1812350_1812623_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.6e-11
WP_135301135.1|1812624_1813674_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_000904153.1|1813686_1814046_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	5.6e-36
WP_000640044.1|1814054_1814615_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.6e-67
WP_000917768.1|1814831_1815029_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_088888714.1|1815179_1816238_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.6	4.3e-193
WP_001380362.1|1816699_1817131_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000216624.1|1817127_1817292_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
WP_149508902.1|1817795_1819742_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	98.5	0.0e+00
WP_000142781.1|1819877_1820057_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	93.2	7.1e-24
WP_001447570.1|1820097_1820343_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	82.7	8.5e-20
WP_000284506.1|1820420_1820636_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_047081887.1|1820639_1821197_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	2.1e-50
WP_149508903.1|1821233_1821776_+	glycoside hydrolase family protein	NA	S5MQK2	Escherichia_phage	94.4	4.5e-98
WP_149508904.1|1821763_1822231_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	86.5	5.7e-65
WP_033802784.1|1822218_1822434_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	81.1	1.6e-17
WP_149508905.1|1822684_1823161_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	99.4	2.3e-82
WP_050878052.1|1823157_1825281_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|1825277_1825490_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1825489_1826992_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_022581877.1|1826936_1828961_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_149508906.1|1829048_1829375_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	98.1	3.1e-49
WP_001281347.1|1829367_1829649_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_047082262.1|1829651_1830275_+|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_000682716.1|1830287_1830686_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235129.1|1830693_1831443_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	2.1e-130
WP_032330778.1|1831462_1831894_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	1.5e-40
WP_047081971.1|1831920_1832325_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	77.5	4.5e-42
WP_149508907.1|1832314_1834924_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.0	0.0e+00
WP_000847279.1|1834920_1835250_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_032209675.1|1835249_1835948_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	100.0	1.3e-134
WP_149508908.1|1835958_1836702_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	1.7e-148
WP_149509065.1|1836647_1837280_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	1.8e-101
WP_149508909.1|1837747_1841224_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	93.0	0.0e+00
WP_149508910.1|1841291_1841915_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	2.4e-66
WP_149508911.1|1842065_1844024_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.8	9.1e-173
WP_105475085.1|1844008_1844353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105475084.1|1844291_1844621_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001058323.1|1845275_1846394_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1844760:1844821	attR	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107384.1|1846390_1848184_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1848202_1848910_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1848906_1849494_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	1995358	2065738	5074423	terminase,head,tRNA,tail,capsid,portal,integrase,holin,protease,lysis	Escherichia_phage(50.82%)	95	2023898:2023919	2046155:2046176
WP_000074972.1|1995358_1996477_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.5e-82
WP_000003742.1|1996445_1996715_-	excisionase	NA	NA	NA	NA	NA
WP_137565774.1|1996776_1999221_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.1	1.1e-175
WP_000092782.1|1999313_1999502_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_149508919.1|1999498_1999687_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001302137.1|2000084_2000249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2000252_2000471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2000630_2000786_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000379972.1|2000952_2001360_-	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000920571.1|2001443_2001674_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705369.1|2001657_2002209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020570.1|2002180_2003221_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_001302109.1|2003252_2003675_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	97.1	2.2e-76
WP_149508920.1|2003709_2004468_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	5.8e-75
WP_000215514.1|2004527_2004713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211435.1|2005060_2005609_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
WP_022581295.1|2005823_2006036_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.1	7.6e-17
WP_000042395.1|2006138_2006456_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001217944.1|2006448_2006820_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001452497.1|2007043_2007271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|2007324_2007594_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_149508921.1|2007595_2008645_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	2.2e-109
WP_149508922.1|2008657_2009017_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	4.3e-36
WP_000640044.1|2009025_2009586_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.6e-67
WP_000917750.1|2009803_2010001_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000483502.1|2010151_2011210_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	2.0e-206
WP_001365678.1|2011593_2012553_+	Shiga toxin Stx2a subunit A	NA	A0A0P0ZDQ7	Stx2-converting_phage	99.7	3.6e-175
WP_000738080.1|2012564_2012834_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_071531850.1|2013090_2013276_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	92.9	2.8e-15
WP_149508923.1|2013346_2015293_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	98.9	0.0e+00
WP_001385761.1|2015428_2015611_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	100.0	2.0e-26
WP_001385760.1|2015636_2015882_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	100.0	1.9e-19
WP_000284506.1|2015958_2016174_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087456.1|2016178_2016712_+	lysozyme	NA	S5MQK2	Escherichia_phage	100.0	7.9e-103
WP_001255340.1|2016708_2017176_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	87.2	4.4e-65
WP_000373411.1|2017588_2018065_+	DUF1441 family protein	NA	S5MQK0	Escherichia_phage	100.0	1.9e-84
WP_149508924.1|2018061_2020185_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.9	0.0e+00
WP_000102415.1|2020181_2020394_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|2020393_2021896_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_149508925.1|2021840_2023865_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
2023898:2023919	attL	GCTTTTTTTATGCCTGAAAAAC	NA	NA	NA	NA
WP_001097058.1|2023952_2024279_+	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	100.0	6.1e-50
WP_001281344.1|2024271_2024553_+	hypothetical protein	NA	S5MDP9	Escherichia_phage	100.0	7.2e-47
WP_000974964.1|2024555_2025182_+	hypothetical protein	NA	S5MBY4	Escherichia_phage	100.0	7.8e-102
WP_000682704.1|2025191_2025590_+	hypothetical protein	NA	S5MW30	Escherichia_phage	100.0	2.7e-71
WP_149508926.1|2025597_2026347_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	3.6e-130
WP_032330778.1|2026362_2026794_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	1.5e-40
WP_044809160.1|2026820_2027225_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	9.0e-43
WP_149508927.1|2027214_2029821_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000847280.1|2029817_2030147_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_149508928.1|2030146_2030845_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	1.7e-129
WP_062867322.1|2030855_2031599_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.2	5.0e-148
WP_122993618.1|2031544_2032177_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	1.9e-100
WP_149508929.1|2032417_2036104_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_000078855.1|2036302_2036443_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_149508930.1|2036587_2037856_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.2	1.5e-54
WP_001049903.1|2037924_2038596_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	84.8	3.0e-107
WP_022581964.1|2038760_2039090_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|2039255_2040119_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|2040102_2041239_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359432.1|2041488_2042718_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|2042863_2043985_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085265.1|2044233_2045463_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	1.5e-133
WP_000953271.1|2045837_2046026_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000182306.1|2046269_2046473_-	hypothetical protein	NA	NA	NA	NA	NA
2046155:2046176	attR	GTTTTTCAGGCATAAAAAAAGC	NA	NA	NA	NA
WP_000103621.1|2046530_2046710_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000184034.1|2046930_2047158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190551.1|2047215_2047395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442352.1|2047587_2048145_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_000609225.1|2048137_2048350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135300960.1|2048339_2048582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032308184.1|2048574_2048808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204975.1|2048800_2049034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2049039_2049339_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833612.1|2049335_2050733_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.2	1.5e-113
WP_024200918.1|2050935_2051187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032317163.1|2051300_2051498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136753079.1|2051507_2051918_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233314.1|2051928_2052177_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_101766855.1|2052179_2052278_+	trigger factor	NA	NA	NA	NA	NA
WP_001142405.1|2052318_2052543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028985258.1|2052834_2053992_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	4.8e-137
WP_000504062.1|2054031_2054604_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	2.7e-61
WP_021292933.1|2054641_2055817_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	1.8e-184
WP_001020660.1|2055813_2056152_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|2056148_2056445_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|2056444_2056885_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|2056868_2057051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2057173_2057530_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_032326831.1|2057513_2059175_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	6.8e-278
WP_000133415.1|2059188_2059470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|2060281_2061742_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|2061741_2062413_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2062580_2063951_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|2063954_2064596_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|2064631_2065738_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	2170076	2239282	5074423	terminase,head,capsid,tail,portal,integrase,holin,protease,lysis	Escherichia_phage(29.63%)	82	2169887:2169914	2225477:2225504
2169887:2169914	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113693.1|2170076_2171207_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.0e-104
WP_000113183.1|2171184_2171433_-	excisionase	NA	NA	NA	NA	NA
WP_000034484.1|2171497_2173969_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.3e-54
WP_000092839.1|2174064_2174253_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2174249_2174438_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_038812338.1|2174986_2175289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001365839.1|2175212_2175581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|2175592_2175745_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|2175934_2176342_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|2176419_2176647_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|2176630_2177152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054521.1|2177132_2178110_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	3.8e-55
WP_000790460.1|2178116_2178857_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000450859.1|2178886_2179648_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	5.4e-73
WP_000215513.1|2179707_2179902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|2180243_2180795_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|2181009_2181222_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_000042395.1|2181324_2181642_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001452497.1|2182230_2182458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|2182511_2182781_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_050877448.1|2182782_2183832_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000904164.1|2183844_2184207_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|2184199_2184865_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342737.1|2185118_2185832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|2186005_2186203_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_106889558.1|2186354_2187413_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	1.5e-206
WP_000271631.1|2187893_2188322_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382067.1|2189018_2189744_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024166055.1|2189833_2190112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071532096.1|2190725_2190950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149508934.1|2191609_2193574_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	78.2	1.8e-293
WP_000142780.1|2193708_2193888_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290208.1|2193928_2194174_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
WP_000284510.1|2194251_2194467_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001378945.1|2194470_2195139_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	77.4	3.5e-60
WP_001063216.1|2195118_2195439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992039.1|2195564_2196098_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	96.6	3.6e-100
WP_072024677.1|2196254_2196437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024210595.1|2196585_2197053_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.7	3.6e-67
WP_000881332.1|2197164_2197779_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	1.1e-63
WP_042187665.1|2197806_2198007_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	76.9	1.1e-09
WP_044696931.1|2197928_2198180_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	98.6	2.2e-31
WP_000828070.1|2198115_2198442_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|2198573_2198774_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829191.1|2198815_2199181_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
WP_000958387.1|2199470_2200034_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_039264401.1|2200030_2201692_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.8	0.0e+00
WP_146709891.1|2201755_2203693_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.5	0.0e+00
WP_001063099.1|2203737_2203959_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_149508935.1|2203904_2206490_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.1	0.0e+00
WP_000125990.1|2206486_2206813_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2206822_2207173_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2207169_2207616_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2207612_2207957_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275432.1|2208022_2208739_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	6.2e-127
WP_000710934.1|2208753_2209128_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_122993267.1|2209223_2209433_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_047087069.1|2209480_2212747_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.5	0.0e+00
WP_000343409.1|2212739_2213081_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	81.2	1.7e-50
WP_000738904.1|2213279_2214443_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_001365876.1|2214653_2215352_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_024210611.1|2215362_2216106_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.8	3.1e-150
WP_047087102.1|2216003_2216648_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	73.5	8.6e-88
WP_149508936.1|2217578_2221274_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.6	0.0e+00
WP_001270059.1|2221342_2221966_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_149508937.1|2222115_2223303_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	1.5e-53
WP_149508938.1|2223371_2224043_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	82.5	8.1e-105
WP_149508939.1|2225654_2226161_-	DUF892 family protein	NA	NA	NA	NA	NA
2225477:2225504	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|2226206_2226707_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2226792_2226972_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|2227352_2228159_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209516.1|2228158_2229352_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_024177467.1|2229363_2230722_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763511.1|2230725_2232321_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194592.1|2232320_2233883_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2233974_2234019_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|2234156_2235038_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2235034_2235655_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|2235755_2236628_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_064560392.1|2236667_2237258_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|2237254_2238013_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|2238232_2239282_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	2774796	2866097	5074423	head,terminase,tRNA,capsid,tail,portal,holin,protease,lysis	Escherichia_phage(35.44%)	117	NA	NA
WP_000984517.1|2774796_2775678_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001326055.1|2775869_2777918_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.2e-85
WP_000431370.1|2777937_2778636_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_149508957.1|2778732_2779230_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207283.1|2779359_2780643_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001299674.1|2780611_2783245_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|2783324_2784764_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2784881_2785118_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2785222_2785414_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|2785414_2786071_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|2786466_2786808_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|2786820_2787693_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2787696_2788071_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2788209_2788440_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011652.1|2788541_2789198_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2789221_2789884_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936936.1|2789880_2791941_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2792149_2792809_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2793135_2793492_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2793558_2793849_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|2793982_2795161_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2795216_2795858_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|2795894_2797706_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|2797940_2799416_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056706.1|2799753_2800623_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091148.1|2800750_2802193_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2802323_2803295_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2803414_2804737_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2804752_2805685_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2805763_2806519_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|2806515_2807301_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2807447_2808458_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2808466_2809078_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2809216_2809282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|2809352_2809955_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2809956_2810478_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2810512_2811253_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077221229.1|2811281_2811734_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2811726_2813499_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891610.1|2813808_2814375_+	hydrolase	NA	NA	NA	NA	NA
WP_001217534.1|2814692_2814941_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	87.8	8.0e-34
WP_050939615.1|2815210_2815882_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.9	1.1e-106
WP_050939614.1|2815950_2817219_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.2	1.9e-54
WP_000078855.1|2817363_2817504_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_050939610.1|2817702_2821389_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.4	0.0e+00
WP_122993618.1|2821629_2822262_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	1.9e-100
WP_001365808.1|2822207_2822951_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	93.9	9.2e-142
WP_001499019.1|2822961_2823660_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_000847279.1|2823659_2823989_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_149508958.1|2823985_2826559_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.2	0.0e+00
WP_071532372.1|2826539_2826953_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	2.3e-41
WP_000479116.1|2826979_2827411_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235046.1|2827424_2828177_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.0e-132
WP_149508959.1|2828184_2828580_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	5.7e-58
WP_024213759.1|2828576_2829152_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	9.8e-51
WP_001204554.1|2829167_2829521_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_149508960.1|2829513_2829897_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2829948_2830977_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2831034_2831382_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_097516823.1|2831418_2832924_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	8.7e-99
WP_047091549.1|2832913_2834506_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	2.2e-185
WP_000259002.1|2834502_2834709_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_137557281.1|2834692_2836663_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.8e-262
WP_001102145.1|2836592_2837141_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	6.1e-58
WP_001109015.1|2837803_2838346_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_032295775.1|2838548_2838986_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.2	1.8e-68
WP_000443009.1|2838988_2839138_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.6	6.7e-12
WP_001056888.1|2839137_2839710_-	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
WP_000992036.1|2839984_2840518_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	97.2	7.4e-101
WP_001063217.1|2840643_2840964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149508961.1|2840943_2841612_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	76.7	3.5e-60
WP_000284506.1|2841615_2841831_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001447570.1|2841908_2842154_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	82.7	8.5e-20
WP_000142781.1|2842194_2842374_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	93.2	7.1e-24
WP_149508962.1|2842509_2844474_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	78.8	8.5e-296
WP_134793002.1|2844599_2844836_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	81.0	8.7e-22
WP_000752026.1|2844977_2845247_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2845256_2846204_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_072095549.1|2846476_2846722_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	7.1e-35
WP_001204859.1|2846710_2847145_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144764.1|2847137_2847332_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|2847328_2847934_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_001004008.1|2847933_2848656_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_050940070.1|2848730_2849465_-	antirepressor	NA	A0A0N7C203	Escherichia_phage	99.2	1.8e-121
WP_001254256.1|2849739_2849922_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_050940068.1|2849918_2850446_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	3.6e-100
WP_000736913.1|2850442_2850883_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_149508963.1|2850956_2851247_-	protein ren	NA	O48423	Enterobacteria_phage	99.0	3.7e-46
WP_149508964.1|2851243_2851945_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	99.6	3.8e-129
WP_149508965.1|2851941_2852841_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.0	2.7e-172
WP_032247584.1|2852873_2853170_-	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	99.0	8.9e-48
WP_000067727.1|2853311_2853527_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2853601_2854297_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001074607.1|2854343_2854886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528776.1|2854873_2855650_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_149508966.1|2856084_2856357_+	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	96.7	6.3e-40
WP_112050340.1|2856485_2856542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106421809.1|2856511_2856583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149508967.1|2856765_2857134_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	96.7	1.9e-63
WP_001198861.1|2857206_2857371_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372939.1|2857339_2857504_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.2	3.0e-21
WP_000995439.1|2857557_2857854_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|2857859_2858645_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_149508968.1|2858641_2859322_+	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	99.1	7.9e-132
WP_000682311.1|2859318_2859501_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
WP_000548531.1|2859473_2859665_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077250124.1|2859675_2859957_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	7.9e-46
WP_000763363.1|2860055_2860277_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_149508969.1|2860273_2860903_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	97.8	1.7e-43
WP_001167293.1|2860905_2861397_+	hypothetical protein	NA	G9L661	Escherichia_phage	93.3	2.0e-84
WP_000224227.1|2861398_2861662_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000457723.1|2862110_2862353_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001193437.1|2862509_2862764_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_149508970.1|2862797_2864084_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	96.7	4.1e-246
WP_096096185.1|2864100_2864865_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.0e-72
WP_000252979.1|2864917_2865313_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|2865353_2866097_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 8
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	3096875	3152999	5074423	head,terminase,tRNA,transposase,plate,tail,capsid,portal,integrase,holin,lysis	Escherichia_phage(48.94%)	70	3101933:3101960	3132874:3132901
WP_000675150.1|3096875_3098279_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|3098275_3098998_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|3099188_3099521_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|3099729_3100026_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|3100027_3100324_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|3100426_3101788_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
3101933:3101960	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|3102060_3102279_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_064579175.1|3102360_3103524_-	phage late control D family protein	NA	A0A0F7LDR0	Escherichia_phage	99.0	4.5e-204
WP_001540336.1|3103523_3104003_-|tail	phage tail protein	tail	Q858U6	Yersinia_virus	100.0	2.3e-85
WP_149508981.1|3104017_3106465_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.7	0.0e+00
WP_000785970.1|3106457_3106577_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|3106609_3106885_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|3106942_3107461_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_050867472.1|3107473_3108664_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	9.0e-224
WP_085947917.1|3108837_3110111_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_149508982.1|3110141_3110594_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	41.8	9.2e-20
WP_050867471.1|3110560_3112291_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	64.3	3.1e-84
WP_096942735.1|3112287_3112899_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_001121473.1|3112891_3113800_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_000127163.1|3113804_3114152_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001001795.1|3114849_3115302_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.1e-76
WP_000917193.1|3115294_3115762_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	5.7e-81
WP_001440152.1|3115724_3115898_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_033549336.1|3115869_3116295_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	8.0e-66
WP_149508983.1|3116282_3116708_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	93.6	6.1e-58
WP_001144101.1|3116722_3117220_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|3117219_3117501_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|3117504_3117708_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|3117707_3118217_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_149508984.1|3118316_3119060_-|terminase	terminase endonuclease subunit	terminase	Q94MF8	Enterobacteria_phage	99.6	2.8e-122
WP_088563374.1|3119063_3120137_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	4.8e-200
WP_001085953.1|3120195_3121050_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156847.1|3121223_3122996_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_061093409.1|3122995_3124030_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	5.5e-201
WP_071987867.1|3124373_3125528_-	DNA cytosine methyltransferase	NA	Q83VT0	Escherichia_phage	99.4	3.2e-210
WP_071526056.1|3125548_3125818_+	helix-turn-helix transcriptional regulator	NA	Q83VS9	Escherichia_phage	100.0	3.6e-40
WP_000866882.1|3125795_3126851_+	restriction endonuclease, SacI family	NA	Q83VS8	Escherichia_phage	100.0	2.2e-197
WP_050877419.1|3126944_3129215_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_000027664.1|3129204_3129480_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|3129476_3129701_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277897.1|3129700_3130003_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_000557705.1|3130002_3130227_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
WP_000217670.1|3130290_3130791_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001081582.1|3130968_3131244_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|3131365_3131665_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|3131780_3132794_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000716757.1|3133058_3133376_-	hypothetical protein	NA	NA	NA	NA	NA
3132874:3132901	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_149508985.1|3133790_3134690_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.5	2.8e-12
WP_000178552.1|3134771_3135551_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844200.1|3135650_3136691_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490714.1|3136738_3138094_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823272.1|3138097_3138382_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|3138412_3138865_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853892.1|3138874_3140137_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|3140165_3141020_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_122653560.1|3141022_3141256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129551.1|3141329_3142382_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|3142638_3143916_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000846219.1|3143912_3144917_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000011973.1|3144913_3145879_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|3145852_3146599_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001315719.1|3146650_3147469_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000822274.1|3147533_3148334_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195590.1|3148330_3149119_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_149508986.1|3149740_3149926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149508987.1|3149882_3150071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149508988.1|3150229_3150511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115199398.1|3151170_3151584_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_044860985.1|3151596_3151932_-|head	head decoration protein	head	NA	NA	NA	NA
WP_062895690.1|3151943_3152999_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.1	1.3e-69
>prophage 9
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	3183687	3193129	5074423		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|3183687_3184824_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|3184820_3186821_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|3186945_3187407_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3187447_3187918_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3187964_3188684_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3188680_3190366_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3190587_3191319_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3191378_3191486_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3191466_3192198_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|3192202_3193129_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 10
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	3813893	3821033	5074423		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3813893_3816455_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|3816560_3817217_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001297141.1|3817267_3818035_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3818230_3819139_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_149509021.1|3819135_3820398_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	7.0e-134
WP_001278994.1|3820394_3821033_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 11
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	4065761	4147601	5074423	integrase,tRNA,transposase	Stx2-converting_phage(25.0%)	58	4064926:4064941	4078851:4078866
4064926:4064941	attL	CTCCTGAACGATAATT	NA	NA	NA	NA
WP_053891991.1|4065761_4066481_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001295382.1|4066641_4067694_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4067721_4067997_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|4068061_4069141_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4069342_4070599_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839764.1|4070648_4072784_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|4073181_4073889_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218813.1|4074267_4075533_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	2.0e-80
WP_000147021.1|4075788_4076832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033815229.1|4077190_4078693_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_062896446.1|4080047_4081874_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.9	9.8e-20
4078851:4078866	attR	AATTATCGTTCAGGAG	NA	NA	NA	NA
WP_149509026.1|4083450_4084113_+	acetate CoA-transferase subunit alpha	NA	NA	NA	NA	NA
WP_000339054.1|4084112_4084763_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_000580275.1|4084759_4086082_+	TIGR00366 family protein	NA	NA	NA	NA	NA
WP_000786522.1|4086112_4087297_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_149509027.1|4089057_4089363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071531291.1|4089451_4089631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477612.1|4091651_4091873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001367252.1|4093205_4093388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149509028.1|4093326_4095414_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	3.4e-08
WP_000593011.1|4095759_4097604_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.3	8.1e-14
WP_071531293.1|4098056_4098317_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001032733.1|4098504_4098762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|4099293_4100566_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_149509029.1|4101472_4105564_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.0	3.8e-298
WP_149509030.1|4105791_4107405_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.0	8.0e-167
WP_000624684.1|4107435_4107786_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	2.8e-40
WP_000422722.1|4107782_4108208_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	96.9	9.8e-48
WP_000789658.1|4108408_4108600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997728.1|4108610_4108976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000264910.1|4108985_4109177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323309.1|4109210_4109420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001378814.1|4109917_4110562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226517.1|4110582_4110852_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000502848.1|4110930_4111569_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.5e-55
WP_149509070.1|4113285_4115454_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_149509071.1|4117454_4119200_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_149509072.1|4119377_4119926_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	2.6e-16
WP_000931685.1|4120496_4120811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149509031.1|4120914_4121151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101911705.1|4121137_4122145_-	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_071531845.1|4122526_4122712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062896426.1|4123185_4123641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077173362.1|4123645_4124155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064769067.1|4124413_4124803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137568204.1|4124805_4125372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000877779.1|4129099_4129357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149509032.1|4129353_4138326_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	40.2	1.9e-55
WP_052892273.1|4138341_4138869_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_001376511.1|4138878_4140531_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.4	2.2e-39
WP_001287885.1|4141206_4141398_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124190.1|4141450_4141684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366001.1|4141779_4142403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021552435.1|4142491_4142989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074435780.1|4143338_4143785_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_085947917.1|4144269_4145543_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000624677.1|4145627_4145978_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_149509033.1|4146008_4147601_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	3.9e-174
>prophage 12
NZ_CP043478	Escherichia coli strain ST130 chromosome, complete genome	5074423	4744326	4847873	5074423	head,terminase,plate,transposase,tail,capsid,portal,integrase,holin,protease,lysis	Escherichia_phage(41.67%)	102	4811027:4811073	4841308:4841354
WP_000101907.1|4744326_4745568_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000191257.1|4746586_4747600_+	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_001149002.1|4748010_4749333_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001315896.1|4749566_4751627_-	AsmA family protein	NA	NA	NA	NA	NA
WP_001295219.1|4751696_4752464_-	cyclic-guanylate-specific phosphodiesterase	NA	NA	NA	NA	NA
WP_001296796.1|4752695_4753625_+	sugar kinase	NA	NA	NA	NA	NA
WP_001163135.1|4753720_4755217_-	insulinase family protein	NA	NA	NA	NA	NA
WP_000858214.1|4755437_4756724_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_001266306.1|4756906_4758895_-	biofilm formation regulator HmsP	NA	NA	NA	NA	NA
WP_001225102.1|4758976_4762450_-	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_001307453.1|4762431_4763538_-	cellulase	NA	NA	NA	NA	NA
WP_149509059.1|4763544_4765884_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_000279528.1|4768509_4769262_-	cellulose biosynthesis protein BcsQ	NA	NA	NA	NA	NA
WP_001063318.1|4769273_4769462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204931.1|4769734_4771306_+	cellulose biosynthesis protein BcsE	NA	NA	NA	NA	NA
WP_000988308.1|4771302_4771494_+	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_000191596.1|4771490_4773170_+	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_001295224.1|4773256_4773364_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001295224.1|4773739_4773847_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001295224.1|4774222_4774330_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001296805.1|4774805_4776077_+	transporter	NA	NA	NA	NA	NA
WP_000107018.1|4776106_4777111_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
WP_001196486.1|4777107_4778091_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000084677.1|4778101_4779004_-	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_000938855.1|4779013_4780033_-	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_000198578.1|4780050_4780278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001222883.1|4780340_4781948_-	dipeptide ABC transporter substrate-binding protein DppA	NA	NA	NA	NA	NA
WP_000399648.1|4782791_4783772_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_071531605.1|4783786_4784116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797341.1|4784006_4784615_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000644414.1|4785607_4785844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149509060.1|4785845_4790030_-	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
WP_000710769.1|4790189_4790402_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001315935.1|4790604_4792803_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4792958_4793984_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068834.1|4794075_4795035_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4795127_4795658_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293343.1|4795667_4796999_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001307494.1|4797065_4797992_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4798084_4798570_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4798654_4798900_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4799325_4800171_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4800193_4801702_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4801837_4802848_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|4802944_4803691_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|4803695_4804124_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4804150_4804450_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155272.1|4804661_4805102_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|4805202_4805802_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4805909_4806677_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|4806731_4807487_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|4807593_4808583_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4808902_4809865_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4810045_4810948_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4811027:4811073	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4811184_4811403_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882975.1|4811484_4812648_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	3.7e-206
WP_001471798.1|4812647_4813127_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.1e-84
WP_149509061.1|4813141_4815589_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.9	0.0e+00
WP_000785970.1|4815581_4815701_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4815733_4816009_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4816066_4816585_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001696396.1|4816597_4817788_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	4.0e-224
WP_101981607.1|4817911_4818382_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	42.8	1.2e-22
WP_050867471.1|4818348_4820079_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	64.3	3.1e-84
WP_096942735.1|4820075_4820687_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_001121473.1|4820679_4821588_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_000127163.1|4821592_4821940_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_050867469.1|4821936_4822572_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	8.5e-112
WP_001001795.1|4822638_4823091_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.1e-76
WP_000917193.1|4823083_4823551_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	5.7e-81
WP_001440152.1|4823513_4823687_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_033549336.1|4823658_4824084_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	8.0e-66
WP_050867466.1|4824071_4824497_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	7.2e-59
WP_001144101.1|4824511_4825009_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|4825008_4825290_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|4825293_4825497_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|4825496_4826006_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_149508984.1|4826105_4826849_-|terminase	terminase endonuclease subunit	terminase	Q94MF8	Enterobacteria_phage	99.6	2.8e-122
WP_088563374.1|4826852_4827926_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	4.8e-200
WP_001085953.1|4827984_4828839_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156847.1|4829012_4830785_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_021526258.1|4830784_4831819_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	7.1e-201
WP_001284793.1|4832597_4833374_+	cytolethal distending toxin type V subunit CdtA	NA	G1BEM3	Escherichia_phage	100.0	7.9e-136
WP_000759934.1|4833370_4834180_+	cytolethal distending toxin type III/V nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	100.0	4.0e-151
WP_050868087.1|4834194_4834740_+	cytolethal distending toxin type V subunit CdtC	NA	M1SNM4	Escherichia_phage	98.9	1.6e-98
WP_089647395.1|4834815_4837113_-	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	97.6	0.0e+00
WP_000027667.1|4837102_4837378_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113264.1|4837374_4837599_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277966.1|4837598_4837901_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	99.0	1.7e-46
WP_000557703.1|4837900_4838125_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217682.1|4838188_4838689_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_000453534.1|4838858_4839131_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192858.1|4839283_4839577_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	99.0	5.2e-48
WP_000023382.1|4839646_4840630_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4C5	Escherichia_virus	97.5	3.2e-182
WP_000418739.1|4840630_4840867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185307.1|4840850_4841186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223800.1|4841377_4841878_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4841308:4841354	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|4842027_4842726_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4842722_4844096_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|4844201_4844876_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|4845024_4846008_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000399648.1|4846892_4847873_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
