The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031071	Bacillus mycoides strain BPN401 chromosome, complete genome	5369163	263337	271286	5369163		uncultured_virus(33.33%)	6	NA	NA
WP_002009985.1|263337_263622_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	4.4e-20
WP_002029451.1|263659_265294_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	2.2e-156
WP_122974556.1|265700_267239_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	3.4e-21
WP_061689877.1|267624_268950_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.2	3.8e-45
WP_002029454.1|269095_269797_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_002124847.1|269780_271286_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.6e-31
>prophage 2
NZ_CP031071	Bacillus mycoides strain BPN401 chromosome, complete genome	5369163	1909341	1918150	5369163		Bacillus_phage(71.43%)	8	NA	NA
WP_149190400.1|1909341_1910628_+	SH3 domain-containing protein	NA	A0A1V0DZX6	Clostridioides_phage	29.2	3.8e-10
WP_002135756.1|1910794_1911559_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002031356.1|1911834_1913595_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	94.5	1.8e-265
WP_002031358.1|1913681_1914359_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	91.1	1.6e-116
WP_016103187.1|1914355_1915429_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	87.7	1.2e-171
WP_002012353.1|1915597_1916317_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_016103188.1|1916466_1917138_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.0	6.3e-65
WP_149190401.1|1917271_1918150_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.0	3.1e-64
>prophage 3
NZ_CP031071	Bacillus mycoides strain BPN401 chromosome, complete genome	5369163	2378574	2386916	5369163	integrase	Moumouvirus(16.67%)	9	2376493:2376508	2390737:2390752
2376493:2376508	attL	ATTTAATATTGTAATT	NA	NA	NA	NA
WP_149190484.1|2378574_2379861_+	collagen-like repeat preface domain-containing protein	NA	M1PNR1	Moumouvirus	34.5	8.8e-07
WP_149190485.1|2380156_2381377_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1Q1PVS7	Staphylococcus_phage	30.9	4.4e-40
WP_071735167.1|2381420_2381891_-	helix-turn-helix transcriptional regulator	NA	A6XML9	Bacillus_virus	59.3	7.6e-17
WP_149190486.1|2381972_2382164_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149190487.1|2382237_2382507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149190488.1|2382756_2385009_+	hypothetical protein	NA	A0A1S7FZ15	Listeria_phage	31.6	1.3e-69
WP_048375994.1|2385418_2385646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149190489.1|2385657_2386047_+	sigma-70 family RNA polymerase sigma factor	NA	A0A288WG73	Bacillus_phage	46.3	1.6e-20
WP_107886993.1|2386466_2386916_+	hypothetical protein	NA	E2ELI1	Clostridium_phage	35.1	2.0e-11
2390737:2390752	attR	AATTACAATATTAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP031071	Bacillus mycoides strain BPN401 chromosome, complete genome	5369163	3235622	3242286	5369163		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_098069387.1|3235622_3236717_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.2	1.6e-102
WP_149190738.1|3236716_3236980_+	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	43.9	6.1e-08
WP_149190739.1|3237827_3238295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520472.1|3238390_3238678_-	hypothetical protein	NA	A6M999	Geobacillus_virus	71.3	1.9e-34
WP_149190740.1|3238820_3239036_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	79.4	1.9e-23
WP_149190741.1|3240631_3241756_+	collagen-like protein	NA	A0A285PWR0	Cedratvirus	64.1	1.7e-38
WP_149190742.1|3242031_3242286_-	hypothetical protein	NA	A0A1B1P779	Bacillus_phage	88.0	9.4e-38
>prophage 5
NZ_CP031071	Bacillus mycoides strain BPN401 chromosome, complete genome	5369163	4389029	4439698	5369163	tRNA,integrase,coat,protease	Klosneuvirus(25.0%)	53	4424709:4424750	4439797:4439838
WP_002138477.1|4389029_4389374_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4389385_4389694_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002034148.1|4389864_4391274_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_002088816.1|4391468_4392329_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_002034147.1|4392321_4393068_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_000503308.1|4393201_4393999_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002015372.1|4394001_4394688_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002015371.1|4394723_4395269_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_149190936.1|4395283_4396135_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002015369.1|4396176_4397196_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_002015368.1|4397354_4398032_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012261761.1|4398082_4398658_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_078172760.1|4398679_4398778_+	formamidopyrimidine-DNA glycosylase	NA	NA	NA	NA	NA
WP_149190937.1|4398877_4399840_-	stage II sporulation protein B	NA	NA	NA	NA	NA
WP_149190938.1|4400004_4401306_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002129263.1|4401400_4404046_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.0	2.8e-164
WP_012261764.1|4404450_4405476_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_002190787.1|4405548_4406526_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_002034163.1|4406635_4407925_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	35.2	1.3e-05
WP_002015358.1|4407924_4408914_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_002088828.1|4409088_4409841_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_002143273.1|4409843_4410773_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_002015354.1|4410790_4411624_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_002143275.1|4411641_4412973_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_149190939.1|4413390_4413843_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002015349.1|4413845_4414262_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_002088829.1|4414297_4414894_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002034201.1|4414890_4417221_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.4	1.9e-177
WP_002034202.1|4417405_4419076_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	6.7e-15
WP_000472285.1|4419182_4420442_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	7.7e-149
WP_002015345.1|4420706_4421984_-	trigger factor	NA	NA	NA	NA	NA
WP_002034206.1|4422294_4423293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001983650.1|4423491_4423740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000473869.1|4424055_4424670_+	hypothetical protein	NA	NA	NA	NA	NA
4424709:4424750	attL	AAGGTTTTGTTAGCGTCCCAGGAGAGATTCGAACTCCCGACC	NA	NA	NA	NA
WP_149190940.1|4424992_4425193_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_149190941.1|4425225_4425528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149190942.1|4425578_4425821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149190943.1|4425992_4426772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149190944.1|4426841_4427381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002184901.1|4427377_4427653_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016106257.1|4427864_4428140_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149190945.1|4428136_4428376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149190946.1|4428661_4429669_-	hypothetical protein	NA	Q854V0	Mycobacterium_virus	31.7	1.7e-18
WP_149190947.1|4429704_4429998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149190948.1|4430003_4430609_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149190949.1|4430839_4431079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149190950.1|4432003_4432429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098989628.1|4432905_4433454_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SCL7	Streptococcus_phage	44.7	1.6e-29
WP_149190951.1|4434010_4434880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098361923.1|4435013_4435859_-	hypothetical protein	NA	A0A1P8CWW3	Bacillus_phage	33.8	4.9e-22
WP_149190952.1|4436019_4436232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149190953.1|4437492_4438053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149190954.1|4438699_4439698_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4439797:4439838	attR	AAGGTTTTGTTAGCGTCCCAGGAGAGATTCGAACTCCCGACC	NA	NA	NA	NA
>prophage 1
NZ_CP031076	Bacillus mycoides strain BPN401 plasmid pl36, complete sequence	36372	0	4066	36372		Bacillus_phage(66.67%)	7	NA	NA
WP_149191461.1|327_600_-	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	48.1	2.4e-07
WP_149191462.1|599_1007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191463.1|1051_1489_-	molecular chaperone DnaJ	NA	A0A218KC61	Bacillus_phage	56.1	3.6e-05
WP_098661292.1|1657_1843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098661293.1|1988_2288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098661294.1|2352_2946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191494.1|2959_4066_-	bifunctional lytic transglycosylase/NlpC/P60 family protein	NA	A0A1S5SEZ8	Streptococcus_phage	37.8	5.9e-52
>prophage 2
NZ_CP031076	Bacillus mycoides strain BPN401 plasmid pl36, complete sequence	36372	8933	11510	36372		Streptococcus_phage(100.0%)	1	NA	NA
WP_149191466.1|8933_11510_-	recombinase RmuC	NA	A0A1S5SF64	Streptococcus_phage	28.4	7.5e-82
>prophage 3
NZ_CP031076	Bacillus mycoides strain BPN401 plasmid pl36, complete sequence	36372	22840	31351	36372	integrase	Bacillus_phage(37.5%)	17	23460:23473	32742:32755
WP_149191474.1|22840_24061_+	DNA translocase FtsK	NA	Q0H250	Geobacillus_phage	40.4	2.2e-68
23460:23473	attL	TTGAAAAAATCGAA	NA	NA	NA	NA
WP_149191475.1|24065_24731_+	hypothetical protein	NA	A0A1B1P7T2	Bacillus_phage	46.9	1.8e-48
WP_149191476.1|24775_25000_-	helix-turn-helix domain-containing protein	NA	S5MBY6	Brevibacillus_phage	39.2	4.7e-09
WP_149191477.1|25273_26029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191496.1|26068_26431_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	61.5	2.4e-34
WP_149191478.1|26616_26982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191479.1|27018_27201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191480.1|27228_27726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191481.1|27819_27999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191482.1|28024_28258_-	DUF3961 domain-containing protein	NA	A0A1B1P789	Bacillus_phage	39.7	1.0e-06
WP_149191483.1|28347_28515_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_149191484.1|28613_29048_-	sporulation protein	NA	F8WPS9	Bacillus_phage	62.9	8.2e-34
WP_149191485.1|29126_29495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098859010.1|29544_29973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191486.1|30033_30327_-	hypothetical protein	NA	A0A0H3UZM8	Geobacillus_virus	55.9	2.4e-21
WP_149191487.1|30367_30619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191488.1|30778_31351_-|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	47.5	8.3e-34
32742:32755	attR	TTCGATTTTTTCAA	NA	NA	NA	NA
>prophage 1
NZ_CP031072	Bacillus mycoides strain BPN401 plasmid pl395, complete sequence	394614	49905	62006	394614	holin	Bacillus_phage(75.0%)	14	NA	NA
WP_149191182.1|49905_51729_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.6	1.7e-35
WP_149191183.1|52249_53362_+	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	45.5	6.7e-80
WP_149191184.1|54096_54525_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	53.7	2.4e-33
WP_149191185.1|54547_54976_-	helix-turn-helix domain-containing protein	NA	Q786F1	Bacillus_phage	50.7	1.8e-28
WP_149191186.1|55113_55350_+	helix-turn-helix domain-containing protein	NA	W8CYU0	Bacillus_phage	53.1	2.8e-12
WP_149191187.1|55436_56333_+	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	62.0	1.6e-76
WP_002150869.1|56685_57072_+	hypothetical protein	NA	A0A288WG73	Bacillus_phage	69.0	6.4e-46
WP_149191188.1|57310_58285_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.3	7.0e-33
WP_149191189.1|58424_59255_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A218KCJ1	Bacillus_phage	43.1	2.9e-27
WP_149191190.1|59691_59949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191191.1|60028_60400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348874.1|60478_60715_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	85.9	1.3e-14
WP_149191192.1|60714_60954_+|holin	holin	holin	A0A0A7AR38	Bacillus_phage	75.9	7.7e-26
WP_149191193.1|60950_62006_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	68.4	2.5e-140
>prophage 2
NZ_CP031072	Bacillus mycoides strain BPN401 plasmid pl395, complete sequence	394614	83636	231779	394614	integrase,transposase,coat	Bacillus_phage(28.21%)	102	102018:102035	226662:226681
WP_149191204.1|83636_85040_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_016127794.1|85073_86099_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P1ELS8	Moumouvirus	33.9	6.5e-37
WP_033729000.1|86095_87058_+	NAD-dependent epimerase/dehydratase family protein	NA	M1IGU2	Acanthocystis_turfacea_Chlorella_virus	30.9	1.1e-30
WP_050001331.1|87057_88263_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	32.9	6.2e-47
WP_098168519.1|88263_89259_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_149191205.1|89298_90399_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_149191206.1|90400_90961_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002169371.1|90953_92003_+	pseudaminic acid synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	31.6	4.9e-24
WP_149191207.1|92127_93105_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002169373.1|93136_93382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002016601.1|93606_93840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191331.1|94990_97420_+	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_033729511.1|98264_99119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080116949.1|99378_99606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191208.1|100453_100906_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002139695.1|101000_101519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002139696.1|101542_101932_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
102018:102035	attL	TGTAGAATCATAGGAAAG	NA	NA	NA	NA
WP_033729090.1|104154_104862_+	response regulator transcription factor	NA	NA	NA	NA	NA
102018:102035	attL	TGTAGAATCATAGGAAAG	NA	NA	NA	NA
WP_149191209.1|104858_105845_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_078214121.1|105986_106988_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_149191210.1|107228_107999_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	2.1e-32
WP_033729081.1|107973_109944_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_078204043.1|109967_110711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078179253.1|111946_112225_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	63.9	1.3e-13
WP_002203963.1|112836_113025_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_078179092.1|113763_116010_+	hypothetical protein	NA	G1FGA4	Mycobacterium_phage	44.0	1.7e-10
WP_149191211.1|116150_118142_+	DUF3472 domain-containing protein	NA	G1FGA4	Mycobacterium_phage	42.2	3.5e-10
WP_078179272.1|121927_123097_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.0	1.5e-21
WP_095210734.1|123614_123779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078178494.1|123801_125064_+	MFS transporter	NA	NA	NA	NA	NA
WP_149191212.1|125078_129635_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.4	2.0e-93
WP_149191213.1|129637_136108_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.0	1.7e-191
WP_149191214.1|136104_151011_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.5	3.6e-184
WP_016127770.1|151503_152100_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_098632893.1|152116_152839_+	thioesterase	NA	NA	NA	NA	NA
WP_002187279.1|153851_154130_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	74.5	6.0e-14
WP_002187278.1|154094_154373_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	76.9	1.9e-15
WP_078178487.1|155700_156066_+	hypothetical protein	NA	I7J6W4	Bacillus_phage	84.2	1.5e-49
WP_149191215.1|156999_157215_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	83.1	4.1e-26
WP_033729035.1|157725_158025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002066657.1|158226_158388_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_033729031.1|158699_159182_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	5.0e-72
WP_149191216.1|159181_159724_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	90.6	1.6e-87
WP_016128160.1|160030_160279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078178485.1|160561_161515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191217.1|161890_162166_+	hypothetical protein	NA	A0A1B1P857	Bacillus_phage	76.9	8.0e-35
WP_149191218.1|162386_162575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191219.1|162978_163461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002191492.1|163841_164294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078178482.1|164758_165925_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	NA	NA	NA	NA
WP_016093780.1|166017_166614_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113937316.1|167005_168229_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_078178481.1|168344_168914_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_113937317.1|168999_169599_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149191332.1|170593_171301_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.8	5.6e-40
WP_149191220.1|171731_172010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016093776.1|172369_172561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191221.1|172739_173447_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.7	3.0e-41
WP_149191222.1|174105_175149_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.4	2.2e-08
WP_149191223.1|175381_175717_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078179251.1|175753_176266_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002016873.1|177293_177593_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_149191224.1|178355_178880_+	NlpC/P60 family protein	NA	A0A1S5SEZ8	Streptococcus_phage	53.4	5.3e-27
WP_149191225.1|179363_180419_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
179159:179176	attR	TGTAGAATCATAGGAAAG	NA	NA	NA	NA
WP_078179299.1|181533_182376_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
179159:179176	attR	TGTAGAATCATAGGAAAG	NA	NA	NA	NA
WP_149191226.1|182751_183459_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.7	6.0e-42
WP_149191227.1|183968_184172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098633255.1|184166_185027_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149191228.1|185485_187591_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_149191229.1|188057_189503_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033707376.1|190075_190894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191230.1|190920_191601_+	response regulator	NA	W8CYM9	Bacillus_phage	33.0	3.2e-32
WP_149191231.1|191597_193445_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.5	6.7e-16
WP_144513839.1|193655_195806_-	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_149191232.1|196327_198532_+	cell wall-binding protein	NA	NA	NA	NA	NA
WP_033728919.1|199062_199776_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.1	5.5e-43
WP_033728918.1|199772_200852_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.5	5.2e-29
WP_149191233.1|200928_201426_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_149191234.1|201661_201916_-	DUF1093 domain-containing protein	NA	NA	NA	NA	NA
WP_149191235.1|202215_203337_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	79.6	4.6e-169
WP_149191236.1|204003_205500_+	amino acid permease	NA	NA	NA	NA	NA
WP_033728915.1|205525_206017_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	48.0	1.2e-17
WP_078178659.1|206791_207571_+	alpha/beta hydrolase	NA	A0A1D8EZZ0	Mycobacterium_phage	28.4	1.0e-13
WP_149191237.1|208085_208838_+	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_002166965.1|209452_209725_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	70.0	3.3e-25
WP_149191238.1|210288_212007_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.5	3.2e-12
WP_149191239.1|213351_213465_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_080020971.1|213645_213858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191240.1|214479_215709_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149191333.1|215951_216122_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_149191241.1|216905_218075_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_149191242.1|218125_219280_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_149191243.1|219552_220710_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_149191244.1|222574_222919_+	protein phosphatase	NA	NA	NA	NA	NA
WP_149191245.1|223375_224449_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_033713870.1|225881_226589_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.7	3.5e-42
WP_002203963.1|226877_227066_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_088031163.1|227591_227870_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	68.9	3.2e-15
WP_149191334.1|228581_229322_+	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	59.5	9.6e-75
WP_149191246.1|229324_229537_+	DUF3006 family protein	NA	Q0H256	Geobacillus_phage	50.0	6.9e-10
WP_149191247.1|230668_231070_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	70.5	1.6e-47
WP_149191248.1|231554_231779_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	84.7	4.0e-24
>prophage 1
NZ_CP031074	Bacillus mycoides strain BPN401 plasmid pl41, complete sequence	41246	0	40942	41246	protease,plate,terminase,head,portal,capsid,tail	Bacillus_phage(60.53%)	53	NA	NA
WP_149191403.1|0_2343_+	DNA primase	NA	A0A2H4J990	uncultured_Caudovirales_phage	89.7	0.0e+00
WP_149191404.1|2662_3091_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	71.1	5.2e-57
WP_149191405.1|3093_3504_+	hypothetical protein	NA	A0A1B1P7V7	Bacillus_phage	36.4	1.4e-14
WP_149191406.1|3500_4040_+	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	53.7	1.7e-49
WP_149191407.1|4053_4200_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_149191408.1|4183_4408_+	hypothetical protein	NA	D2XR53	Bacillus_phage	56.8	1.3e-14
WP_149191409.1|4477_4720_+	glutaredoxin family protein	NA	A0A0U3TI10	Bacillus_phage	59.8	5.1e-17
WP_149191410.1|4911_5427_+	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	36.0	3.4e-18
WP_149191411.1|5443_6193_+	FAD-dependent thymidylate synthase	NA	A0A2P1JUN2	Bacillus_phage	68.5	1.2e-88
WP_149191412.1|6230_6491_+	hypothetical protein	NA	A0A0E3D9F5	Bacillus_phage	50.6	6.3e-13
WP_149191413.1|6535_6730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191414.1|6766_6994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191415.1|7340_7463_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_149191416.1|7477_7867_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	58.9	1.1e-37
WP_149191417.1|8440_8767_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	52.0	7.1e-22
WP_149191454.1|8805_9081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191418.1|9266_9719_+	hypothetical protein	NA	E2ELI1	Clostridium_phage	44.2	3.6e-24
WP_149191419.1|9702_11370_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	56.8	1.5e-179
WP_149191420.1|11386_12619_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	39.3	2.6e-77
WP_149191455.1|12560_13262_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	50.3	1.4e-43
WP_149191421.1|13275_14394_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	55.0	3.9e-96
WP_149191422.1|14407_14719_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	45.2	4.4e-13
WP_149191423.1|14718_15084_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_149191424.1|15061_15442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191425.1|15431_15842_+	hypothetical protein	NA	R4IBU7	Listeria_phage	37.3	1.5e-13
WP_149191426.1|15842_16409_+|tail	phage tail protein	tail	Q8W5Z9	Listeria_phage	42.4	1.4e-36
WP_149191427.1|16482_16851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191428.1|17032_20818_+|tail	phage tail tape measure protein	tail	A0A2H4J957	uncultured_Caudovirales_phage	46.8	1.4e-65
WP_149191429.1|20810_21497_+|tail	phage tail protein	tail	A0A2H4J851	uncultured_Caudovirales_phage	64.0	1.2e-84
WP_149191430.1|21493_24094_+	endopeptidase	NA	A0A2H4JFY7	uncultured_Caudovirales_phage	50.2	1.9e-263
WP_149191431.1|24097_26044_+|plate	BppU family phage baseplate upper protein	plate	A0A2H4J855	uncultured_Caudovirales_phage	56.2	3.5e-39
WP_149191432.1|26075_27359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191433.1|27521_27755_+	hypothetical protein	NA	A0A1B1P887	Bacillus_phage	87.0	4.4e-26
WP_149191434.1|27758_27983_+	hypothetical protein	NA	A0A1B2APX7	Phage_Wrath	79.4	6.8e-24
WP_149191435.1|27982_28810_+	N-acetylmuramoyl-L-alanine amidase	NA	A7KV11	Bacillus_phage	76.4	1.1e-87
WP_149191436.1|28846_29080_-	helix-turn-helix domain-containing protein	NA	A0A0S2GLH4	Bacillus_phage	73.2	4.6e-23
WP_013450099.1|29381_29576_+	hypothetical protein	NA	W8CYN5	Bacillus_phage	54.7	7.9e-13
WP_149191437.1|29586_30753_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	87.4	2.9e-198
WP_149191438.1|30742_31351_+	hypothetical protein	NA	W8CZ47	Bacillus_phage	75.7	1.5e-89
WP_149191439.1|31375_31765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191440.1|31761_32745_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	38.0	1.6e-53
WP_149191441.1|33588_34707_-	hypothetical protein	NA	H0UST6	Bacillus_phage	38.0	5.7e-71
WP_149191442.1|35191_35536_+	helix-turn-helix domain-containing protein	NA	S5MUA5	Brevibacillus_phage	31.3	1.2e-06
WP_149191443.1|35622_36504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191444.1|36825_37155_-	helix-turn-helix domain-containing protein	NA	H0UST7	Bacillus_phage	61.1	2.1e-29
WP_149191445.1|37723_38356_+	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	48.2	1.6e-46
WP_149191446.1|38417_38720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191447.1|38697_38883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191448.1|39045_39237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191449.1|39242_39443_+	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	55.0	6.5e-10
WP_149191450.1|39449_39752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191451.1|39779_40451_+	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	86.1	4.1e-109
WP_149191452.1|40471_40942_+	DUF669 domain-containing protein	NA	A0A2H4J986	uncultured_Caudovirales_phage	83.4	1.3e-69
>prophage 1
NZ_CP031073	Bacillus mycoides strain BPN401 plasmid pl50, complete sequence	50441	0	49208	50441	portal,plate,capsid,terminase,tail	Bacillus_phage(56.36%)	63	NA	NA
WP_149191340.1|860_1289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191341.1|1325_1709_+	hypothetical protein	NA	A0A0A7AR60	Bacillus_phage	36.8	3.2e-13
WP_149191342.1|1730_1994_+	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	74.1	1.6e-19
WP_098168455.1|1908_2196_+	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	81.1	5.8e-36
WP_149191343.1|2192_2462_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	60.7	9.0e-23
WP_149191344.1|2473_2893_+	hypothetical protein	NA	A0A1B1P8A6	Bacillus_phage	79.2	1.2e-37
WP_149191345.1|2902_3046_+	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	79.5	2.4e-11
WP_149191346.1|3029_3224_+	hypothetical protein	NA	A0A1B1P7U9	Bacillus_phage	71.9	4.8e-18
WP_149191347.1|3290_3527_+	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	65.4	1.8e-22
WP_149191348.1|3720_4218_+	hypothetical protein	NA	M4W9N7	Bacillus_phage	31.0	2.9e-14
WP_149191349.1|4221_4950_+	hypothetical protein	NA	A0A0K1LMK0	Bacillus_phage	52.5	8.7e-44
WP_149191350.1|4998_5409_+	hypothetical protein	NA	Q2LI92	Bacillus_phage	94.9	4.7e-71
WP_149191351.1|5445_5691_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	56.5	1.6e-05
WP_149191352.1|5906_6305_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	72.7	8.0e-52
WP_149191353.1|6500_7511_+	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	58.8	7.9e-120
WP_149191354.1|7536_7752_+	hypothetical protein	NA	A0A1B1P8C8	Bacillus_phage	68.1	1.6e-17
WP_149191355.1|8236_8659_+	DUF1064 domain-containing protein	NA	A0A1B1P859	Bacillus_phage	91.4	2.6e-69
WP_149191356.1|8673_8862_+	hypothetical protein	NA	B5LPP9	Bacillus_virus	60.7	1.7e-15
WP_149191357.1|8999_9455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191358.1|10351_10594_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.5	3.3e-16
WP_149191359.1|11534_11750_+	hypothetical protein	NA	A0A0A7AQJ4	Bacillus_phage	59.7	2.7e-14
WP_149191360.1|11821_12610_+	hypothetical protein	NA	D2XPX8	Bacillus_virus	68.9	1.3e-82
WP_149191361.1|12590_13868_+|terminase	PBSX family phage terminase large subunit	terminase	D2XPX9	Bacillus_virus	86.1	7.9e-226
WP_149191362.1|13880_15392_+|portal	phage portal protein	portal	D2XPY0	Bacillus_virus	89.2	3.3e-247
WP_149191363.1|15395_16523_+|capsid	minor capsid protein	capsid	B5LPR2	Bacillus_virus	68.0	3.6e-137
WP_149191364.1|16534_17206_+	hypothetical protein	NA	D2XPY4	Bacillus_virus	84.4	1.1e-85
WP_149191365.1|17279_18176_+|capsid	capsid protein	capsid	B5LPR4	Bacillus_virus	86.9	7.4e-146
WP_149191366.1|18227_18467_+	hypothetical protein	NA	B5LPR5	Bacillus_virus	75.9	7.0e-27
WP_149191367.1|18475_18877_+	hypothetical protein	NA	D2XPY6	Bacillus_virus	86.5	5.2e-59
WP_149191368.1|18873_19230_+|capsid	minor capsid protein	capsid	D2XPY7	Bacillus_virus	85.6	3.3e-57
WP_149191369.1|19226_19577_+|capsid	minor capsid protein	capsid	B5LPR8	Bacillus_virus	82.8	3.2e-52
WP_149191370.1|19586_20009_+|capsid	minor capsid protein	capsid	A0A1B1P879	Bacillus_phage	69.3	1.9e-51
WP_149191402.1|20034_20466_+|capsid	capsid protein	capsid	A0A1B1P877	Bacillus_phage	79.6	6.5e-47
WP_149191371.1|20541_20946_+	hypothetical protein	NA	A0A1B1P876	Bacillus_phage	67.2	1.8e-43
WP_149191372.1|20957_21620_+	hypothetical protein	NA	B5LPS2	Bacillus_virus	74.3	3.0e-88
WP_149191373.1|21612_25320_+	carbamoyl-phosphate synthase large subunit	NA	D2XPZ4	Bacillus_virus	79.2	1.2e-290
WP_149191374.1|25364_26843_+|tail	phage tail family protein	tail	D2XPZ5	Bacillus_virus	81.3	2.0e-241
WP_149191375.1|26842_30415_+	peptidase S74	NA	D2XPZ6	Bacillus_virus	73.4	0.0e+00
WP_149191376.1|30470_31943_+|plate	BppU family phage baseplate upper protein	plate	A0A1B1P836	Bacillus_phage	51.4	1.2e-97
WP_149191377.1|31958_32462_+	hypothetical protein	NA	D2XPZ8	Bacillus_virus	77.2	2.4e-61
WP_149191378.1|32712_32994_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	82.4	1.0e-32
WP_149191379.1|32996_33203_+	hypothetical protein	NA	D2XR32	Bacillus_phage	90.9	2.2e-29
WP_149191380.1|33202_33985_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D6X870	Bacillus_phage	44.9	1.7e-45
WP_149191381.1|34023_34377_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	32.7	1.8e-10
WP_149191382.1|34465_34702_-	helix-turn-helix domain-containing protein	NA	B5LPT1	Bacillus_virus	93.6	7.6e-34
WP_149191383.1|34787_35318_-	hypothetical protein	NA	A0A1B1P8A3	Bacillus_phage	96.6	4.8e-92
WP_149191384.1|35329_35710_-	hypothetical protein	NA	A0A1B1P8B2	Bacillus_phage	91.3	1.3e-56
WP_128856808.1|35839_36172_-	peptidylprolyl isomerase	NA	D2XQ05	Bacillus_virus	91.8	4.1e-49
WP_149191385.1|36131_37163_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	97.1	5.1e-191
WP_149191386.1|37329_38109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191387.1|38189_38720_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	39.3	7.5e-13
WP_149191388.1|38865_39927_-	replication protein	NA	A0A1B1P784	Bacillus_phage	47.7	1.1e-26
WP_149191389.1|40375_40948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149191390.1|40971_41454_-	hypothetical protein	NA	O64019	Bacillus_phage	49.7	5.2e-37
WP_149191391.1|41646_41991_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149191392.1|42504_43668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191393.1|44094_44445_-	helix-turn-helix domain-containing protein	NA	A0A288WFW4	Bacillus_phage	38.8	1.3e-16
WP_149191394.1|44627_44861_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	43.7	1.9e-08
WP_149191395.1|44888_45650_+	phage antirepressor Ant	NA	A0A2H4JCR9	uncultured_Caudovirales_phage	43.3	4.3e-46
WP_149191396.1|45914_46145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191397.1|46537_48067_+	AAA family ATPase	NA	A0A2I7SC81	Paenibacillus_phage	39.1	4.0e-83
WP_149191398.1|48056_48251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149191399.1|48266_49208_+	recombinase RecT	NA	A0A0C5AEC1	Paenibacillus_phage	38.4	3.4e-48
