The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031068	Bacillus sp. JAS24-2 chromosome, complete genome	5225480	256668	264615	5225480		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|256668_256953_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|256991_258626_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_149215952.1|259032_260571_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833096.1|260955_262281_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929880.1|262424_263126_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.5e-40
WP_000719210.1|263109_264615_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	7.8e-31
>prophage 2
NZ_CP031068	Bacillus sp. JAS24-2 chromosome, complete genome	5225480	302981	311357	5225480		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|302981_304289_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|304377_305097_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|305089_305344_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666787.1|305340_306024_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055564.1|306007_308227_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000879032.1|308211_309627_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	4.3e-55
WP_001262439.1|309732_310773_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|310769_311357_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NZ_CP031068	Bacillus sp. JAS24-2 chromosome, complete genome	5225480	1777235	1785350	5225480		Bacillus_phage(66.67%)	7	NA	NA
WP_000755498.1|1777235_1778528_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.5e-11
WP_001194306.1|1778627_1779392_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453861.1|1779632_1781393_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_000612414.1|1781430_1782108_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_001231624.1|1782104_1783178_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.8	1.8e-186
WP_000818979.1|1783467_1784187_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258541.1|1784477_1785350_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.8	1.6e-65
>prophage 4
NZ_CP031068	Bacillus sp. JAS24-2 chromosome, complete genome	5225480	2392434	2442725	5225480	head,portal,holin,integrase,coat,bacteriocin,terminase,tail	Bacillus_phage(76.92%)	59	2385419:2385433	2406746:2406760
2385419:2385433	attL	TATTTTTAAAAATAT	NA	NA	NA	NA
WP_001071364.1|2392434_2392755_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002063155.1|2393244_2393730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736195.1|2394039_2394741_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_149216294.1|2394779_2395889_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U3U8Y8	Bacillus_phage	77.5	3.0e-144
WP_001987382.1|2396204_2396651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216295.1|2396694_2396904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216296.1|2397743_2398895_+	hypothetical protein	NA	A0A1B0T6A5	Bacillus_phage	33.6	1.0e-51
WP_149216297.1|2398932_2399079_+	complement C1q protein	NA	NA	NA	NA	NA
WP_149216298.1|2399401_2399755_-	helix-turn-helix domain-containing protein	NA	A0A0U3SD25	Bacillus_phage	86.2	7.4e-49
WP_000854267.1|2399980_2400172_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	85.2	1.9e-22
WP_149216299.1|2400228_2400504_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	88.8	2.9e-37
WP_149216300.1|2400648_2400969_+	hypothetical protein	NA	I3WU08	Bacillus_phage	56.3	6.1e-26
WP_098209496.1|2400969_2401164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071730504.1|2401240_2401741_+	hypothetical protein	NA	A0A2H4J6F5	uncultured_Caudovirales_phage	37.7	1.3e-19
WP_149216301.1|2401741_2402686_+	hypothetical protein	NA	S6C475	Thermus_phage	49.7	1.8e-81
WP_149216302.1|2402701_2403493_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	66.1	1.8e-95
WP_149216303.1|2403663_2404521_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	56.1	1.6e-73
WP_149216751.1|2404591_2405284_+	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	50.8	1.5e-61
WP_149216304.1|2405289_2405478_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	52.5	1.5e-13
WP_149216305.1|2405458_2405941_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_149216752.1|2406088_2406403_+	hypothetical protein	NA	A0A0A7AQW3	Bacillus_phage	46.6	4.7e-23
WP_000049835.1|2406958_2407375_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	54.1	1.1e-32
2406746:2406760	attR	ATATTTTTAAAAATA	NA	NA	NA	NA
WP_149216306.1|2407389_2408106_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_149216307.1|2408175_2409069_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_081366294.1|2409078_2409468_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_088345966.1|2410027_2410222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216308.1|2411104_2411485_+	hypothetical protein	NA	S5MUC4	Brevibacillus_phage	49.1	1.4e-08
WP_149216309.1|2411559_2412027_-	epimerase	NA	NA	NA	NA	NA
WP_149216310.1|2412294_2412492_+	hypothetical protein	NA	A0A1B1P864	Bacillus_phage	61.5	2.1e-13
WP_149216753.1|2413319_2413520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216311.1|2413671_2413962_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_001110933.1|2415065_2415281_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	88.7	7.4e-28
WP_149216312.1|2415641_2416019_+	ArpU family transcriptional regulator	NA	A0A2H4J748	uncultured_Caudovirales_phage	50.4	4.3e-23
WP_098394576.1|2417189_2417396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216313.1|2417762_2417945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216314.1|2418373_2418580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216315.1|2419268_2420207_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	83.9	2.4e-115
WP_149216316.1|2420193_2421465_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1L2JY46	Aeribacillus_phage	84.6	1.7e-220
WP_149216317.1|2421477_2422911_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	97.5	2.4e-271
WP_149216754.1|2422984_2423752_+|head	phage head protein	head	A0A0S2MVF0	Bacillus_phage	96.5	3.2e-137
WP_149216318.1|2423824_2424538_+	DUF4355 domain-containing protein	NA	A0A0A7AQU8	Bacillus_phage	69.5	2.4e-70
WP_149216319.1|2424647_2425493_+	hypothetical protein	NA	A0A0A7AQF5	Bacillus_phage	94.3	1.6e-145
WP_149216320.1|2425689_2425998_+	hypothetical protein	NA	A0A0A7AQX9	Bacillus_phage	87.1	1.4e-43
WP_149216321.1|2425994_2426339_+|head,tail	head-tail adaptor protein	head,tail	A0A0A7AR32	Bacillus_phage	91.2	4.2e-57
WP_000061895.1|2426313_2426721_+	HK97 gp10 family phage protein	NA	A0A0A7AQU9	Bacillus_phage	94.1	6.5e-65
WP_149216322.1|2426726_2427089_+	hypothetical protein	NA	A0A0S2MV90	Bacillus_phage	95.8	3.9e-61
WP_000729988.1|2427103_2427697_+	hypothetical protein	NA	A0A0S2MV81	Bacillus_phage	99.5	6.3e-109
WP_149216323.1|2427743_2428172_+	hypothetical protein	NA	A0A0S2MV94	Bacillus_phage	94.4	5.0e-68
WP_000375621.1|2428276_2428483_+	hypothetical protein	NA	A0A0S2MV68	Bacillus_phage	98.5	2.1e-32
WP_149216324.1|2431174_2431939_+	hypothetical protein	NA	A0A2R3ZXV6	Staphylococcus_phage	34.3	3.1e-20
WP_149216325.1|2432247_2433729_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	88.0	5.5e-263
WP_149216326.1|2433725_2438039_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	61.4	0.0e+00
WP_000354139.1|2438055_2438433_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	62.9	3.9e-40
WP_149216327.1|2438560_2438785_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	86.5	9.5e-26
WP_098281123.1|2438860_2439286_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	94.3	2.7e-69
WP_149216328.1|2439285_2440104_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	86.8	5.7e-145
WP_149216329.1|2440522_2441902_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_149216330.1|2442096_2442288_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_149216331.1|2442512_2442725_+	small, acid-soluble spore protein, alpha/beta type	NA	A0A1P8CX76	Bacillus_phage	70.3	6.4e-16
>prophage 5
NZ_CP031068	Bacillus sp. JAS24-2 chromosome, complete genome	5225480	2483118	2488343	5225480		Bacillus_phage(50.0%)	9	NA	NA
WP_001139345.1|2483118_2483334_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	83.8	3.4e-25
WP_000369348.1|2483570_2483702_+	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	79.1	2.9e-11
WP_033685795.1|2484066_2484855_+	C1 family peptidase	NA	A0A2K9L1Z4	Tupanvirus	36.5	1.8e-34
WP_002005147.1|2484874_2485087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002061469.1|2485151_2485352_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.9	1.0e-15
WP_097796955.1|2485489_2486371_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_149216344.1|2486498_2487008_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	35.4	4.1e-16
WP_000411453.1|2487125_2487656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216345.1|2487668_2488343_+	response regulator	NA	W8CYM9	Bacillus_phage	30.7	2.8e-28
>prophage 6
NZ_CP031068	Bacillus sp. JAS24-2 chromosome, complete genome	5225480	3563143	3673040	5225480	protease,head,tRNA,portal,integrase,coat,capsid,bacteriocin,terminase,tail	Bacillus_phage(50.0%)	109	3551422:3551439	3675100:3675117
3551422:3551439	attL	TTCCCTAAATATTTCTCA	NA	NA	NA	NA
WP_001288799.1|3563143_3563686_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870461.1|3563811_3564243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216558.1|3564246_3565776_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000190155.1|3566206_3567073_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625417.1|3567059_3568817_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_065703380.1|3569041_3569965_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3570023_3570284_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221095.1|3570433_3571228_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000204911.1|3571390_3572953_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001283860.1|3573389_3574421_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	74.0	1.1e-137
WP_149216559.1|3574564_3575803_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_001052967.1|3575823_3576402_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_149216560.1|3576466_3577378_-	DUF4115 domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3577399_3578185_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114450.1|3578323_3578572_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_149216561.1|3578647_3579361_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_149216562.1|3579461_3580748_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	1.7e-10
WP_000772405.1|3580748_3582023_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.1	1.2e-56
WP_000008857.1|3582232_3583192_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001085254.1|3583192_3584251_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456908.1|3584243_3585776_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.6	2.8e-12
WP_000725771.1|3585893_3586979_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000114182.1|3587071_3587797_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001118776.1|3588334_3590716_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000605020.1|3590928_3591132_-	ribonuclease	NA	NA	NA	NA	NA
WP_000139806.1|3591128_3591878_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823096.1|3591980_3593651_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564764.1|3594387_3595266_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692453.1|3595277_3596510_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000414846.1|3596533_3597580_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_149216766.1|3597730_3597973_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_149216563.1|3598158_3599814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272778.1|3599834_3600245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004406814.1|3600476_3600602_-	hypothetical protein	NA	A0A1B1P878	Bacillus_phage	75.0	4.0e-10
WP_098869208.1|3600666_3601128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000245563.1|3601155_3601383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216564.1|3601407_3601833_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_149216565.1|3602399_3603209_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	83.3	2.6e-134
WP_001261076.1|3603208_3603445_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4JGN9	uncultured_Caudovirales_phage	100.0	1.7e-25
WP_097999696.1|3603475_3603850_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	97.6	4.6e-65
WP_149216566.1|3603865_3608185_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	61.7	0.0e+00
WP_149216567.1|3608181_3609657_-|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	80.7	1.0e-237
WP_149216568.1|3609698_3613325_-	DUF2207 domain-containing protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.5	1.5e-184
WP_000415905.1|3613557_3613920_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.0	1.2e-41
WP_001004907.1|3613924_3614512_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.1	5.1e-87
WP_000176452.1|3614512_3614848_-	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	7.5e-51
WP_149216569.1|3614844_3615189_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	79.6	3.7e-45
WP_149216570.1|3615190_3615544_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	92.2	5.6e-57
WP_149216571.1|3615545_3615839_-	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	86.6	1.1e-42
WP_149216572.1|3615844_3616996_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	95.8	1.1e-207
WP_048558800.1|3616999_3617743_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	81.4	1.4e-105
WP_149216573.1|3617742_3618888_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	81.6	1.5e-180
WP_149216574.1|3618896_3620564_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	90.5	8.5e-305
WP_149216575.1|3620560_3620872_-|terminase	P27 family phage terminase small subunit	terminase	D2XR14	Bacillus_phage	97.1	2.3e-46
WP_149216576.1|3620994_3621330_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	90.1	4.0e-52
WP_149216577.1|3622021_3622903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216578.1|3622924_3624016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060750964.1|3624705_3624906_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	72.7	1.1e-20
WP_080483135.1|3625208_3625388_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_001012165.1|3625796_3626339_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	2.5e-88
WP_149216579.1|3626338_3626803_-	ArpU family transcriptional regulator	NA	D2XR57	Bacillus_phage	92.9	5.1e-74
WP_149216580.1|3628184_3629423_+	NTTRR-F1 domain	NA	NA	NA	NA	NA
WP_086389448.1|3629939_3630131_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	88.5	8.3e-23
WP_149216581.1|3630205_3630568_-	cell division protein SepF	NA	D2XR47	Bacillus_phage	89.2	2.7e-54
WP_089148379.1|3630542_3630731_-	hypothetical protein	NA	D2XR45	Bacillus_phage	83.6	3.7e-15
WP_149216582.1|3630733_3632056_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	95.0	1.9e-235
WP_149216583.1|3632052_3633000_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	61.4	2.4e-86
WP_149216584.1|3633001_3633187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216585.1|3633279_3633564_-	hypothetical protein	NA	D2XR42	Bacillus_phage	52.1	1.1e-21
WP_086407747.1|3633752_3634067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086389452.1|3634397_3634619_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_000537277.1|3634632_3635220_-	hypothetical protein	NA	D2XR41	Bacillus_phage	69.7	2.2e-74
WP_002082295.1|3635310_3635559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065845234.1|3635611_3635800_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	55.9	4.2e-11
WP_063548461.1|3635955_3636390_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	53.9	7.2e-30
WP_086389454.1|3636402_3636837_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	77.8	3.9e-60
WP_149216586.1|3636877_3637432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216587.1|3637465_3638197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216588.1|3638399_3639947_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.8	1.6e-143
WP_000954735.1|3640401_3641304_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_001239756.1|3641474_3641726_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000592989.1|3641860_3643102_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_000868232.1|3643188_3644088_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076737.1|3644241_3646380_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3646540_3646810_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000766704.1|3646910_3647882_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	32.7	2.5e-06
WP_087967423.1|3647925_3648849_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776437.1|3648935_3649292_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000582367.1|3649307_3649589_-	DUF503 family protein	NA	NA	NA	NA	NA
WP_000036343.1|3649585_3651646_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	3.8e-20
WP_001286524.1|3651650_3651962_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071127.1|3651962_3652235_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102604.1|3652246_3653353_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359096.1|3653370_3653841_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_149216589.1|3654177_3658479_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_149216590.1|3658603_3660304_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001090243.1|3660413_3661670_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_000790372.1|3661687_3662830_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000813592.1|3662853_3663645_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_149216591.1|3663662_3664439_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	9.0e-23
WP_000531501.1|3664524_3665082_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000042668.1|3665084_3665807_-	UMP kinase	NA	NA	NA	NA	NA
WP_149216592.1|3665873_3666761_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000111485.1|3666864_3667566_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000421290.1|3667914_3668694_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_000550087.1|3668771_3670163_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.0	3.2e-47
WP_048567505.1|3670185_3670728_-|protease	ATP-dependent protease proteolytic subunit HslV	protease	NA	NA	NA	NA
WP_001101241.1|3670770_3671670_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.8	3.1e-35
WP_000213002.1|3671735_3673040_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
3675100:3675117	attR	TTCCCTAAATATTTCTCA	NA	NA	NA	NA
>prophage 1
NZ_CP031070	Bacillus sp. JAS24-2 plasmid pl278, complete sequence	277779	4542	91141	277779	transposase,integrase,protease,tRNA	Bacillus_phage(33.33%)	42	NA	NA
WP_149217112.1|4542_5484_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.4	1.4e-38
WP_149217113.1|7205_8324_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	4.0e-173
WP_149217236.1|9670_9991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149217114.1|11128_11767_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_149217115.1|16859_17171_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149217116.1|17188_18637_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_149217117.1|19464_20079_-	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_149217118.1|21346_21604_+	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_149217119.1|24545_24752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149217120.1|25203_25935_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.9	1.9e-35
WP_149217121.1|28996_30067_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_149217237.1|30213_30987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149217238.1|31839_32031_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q332I1	Clostridium_botulinum_C_phage	66.1	5.4e-14
WP_149217122.1|32067_32238_+|transposase	transposase	transposase	Q332I1	Clostridium_botulinum_C_phage	71.4	2.7e-17
WP_149217123.1|32540_33695_-	permease	NA	NA	NA	NA	NA
WP_149217124.1|33858_34893_-	YdcF family protein	NA	NA	NA	NA	NA
WP_149217239.1|37978_38212_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	82.7	3.1e-27
WP_149217125.1|38770_38968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149217126.1|42630_43002_+	DUF1093 domain-containing protein	NA	NA	NA	NA	NA
WP_149217127.1|43294_44056_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.8	4.5e-35
WP_149217128.1|44072_45935_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_149217129.1|47181_47556_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_149217130.1|47953_48670_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_149217131.1|48757_49588_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_149217132.1|49584_50283_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	1.5e-13
WP_149217133.1|57578_58841_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	40.4	2.5e-83
WP_149217134.1|58871_59486_+	protein rep	NA	NA	NA	NA	NA
WP_149217135.1|60070_61510_+	amino acid permease	NA	NA	NA	NA	NA
WP_149217136.1|61566_63429_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_149217137.1|63646_64462_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_149217138.1|64697_66083_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_149217139.1|66564_66858_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_086411375.1|69331_71158_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.1	1.4e-82
WP_149217240.1|72640_73012_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_149217140.1|73044_73857_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_149217141.1|79438_80437_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149217142.1|80840_82001_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	24.0	6.7e-06
WP_149217143.1|82576_83884_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	1.0e-26
WP_001100111.1|84057_84237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000956453.1|85648_85843_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_149217241.1|89090_89975_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_149217144.1|90766_91141_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP031070	Bacillus sp. JAS24-2 plasmid pl278, complete sequence	277779	158057	230387	277779	transposase,holin,protease	Bacillus_phage(16.67%)	52	NA	NA
WP_149217168.1|158057_158978_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_149217169.1|160257_160713_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149217170.1|161255_161453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149217171.1|162329_162470_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_149217172.1|163047_163329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149217173.1|163682_164306_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_149217174.1|164305_164599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149217175.1|164825_165356_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	33.3	4.4e-05
WP_149217176.1|165726_166446_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_149217177.1|166932_168144_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.6	1.8e-70
WP_149217178.1|169025_170375_-	amino acid permease	NA	NA	NA	NA	NA
WP_149217179.1|171004_172117_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_149217180.1|172113_173115_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_149217181.1|173204_174596_+	amino acid permease	NA	NA	NA	NA	NA
WP_149217182.1|178195_179713_-	lethal factor domain protein	NA	NA	NA	NA	NA
WP_149217183.1|180256_183610_-	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	31.6	1.5e-66
WP_149217184.1|184171_184294_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_149217185.1|184805_185417_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_149217242.1|185564_185696_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_149217186.1|185692_186499_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J966	uncultured_Caudovirales_phage	58.8	1.2e-94
WP_149217187.1|186983_187400_-|holin	phage holin family protein	holin	D2XPZ9	Bacillus_virus	71.4	1.3e-47
WP_149217188.1|188785_190114_-	magnesium transporter	NA	NA	NA	NA	NA
WP_149217189.1|190998_192459_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_149217190.1|192455_193565_+	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	45.5	2.6e-76
WP_149217191.1|194233_195046_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_149217192.1|195382_195787_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_149217193.1|196837_198181_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_149217194.1|199265_199979_-	response regulator	NA	NA	NA	NA	NA
WP_149217195.1|200086_201208_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	79.4	1.7e-168
WP_149217196.1|203092_203233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149217197.1|203560_204589_-	FUSC family protein	NA	NA	NA	NA	NA
WP_149217198.1|204848_205001_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_149217199.1|206083_206482_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_149217243.1|207524_207770_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_149217200.1|208330_209014_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_098287136.1|210349_211657_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	2.9e-26
WP_001100112.1|211830_212010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149217201.1|212161_212374_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_149217202.1|212837_213137_-	hypothetical protein	NA	U5P429	Shigella_phage	31.2	1.9e-05
WP_149217203.1|216028_216421_-	DUF1093 domain-containing protein	NA	NA	NA	NA	NA
WP_149217204.1|219919_220123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149217205.1|220383_220566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149217206.1|221257_222052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149217244.1|223000_223207_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_149217245.1|223194_223533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149217246.1|223696_223939_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_149217207.1|224083_225034_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_149217208.1|225531_226227_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.2	1.1e-16
WP_149217247.1|226190_227009_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_149217209.1|229689_229860_+|transposase	transposase	transposase	A0A0N9S8A3	Staphylococcus_phage	42.3	2.2e-06
WP_149217248.1|229926_230136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149217210.1|230171_230387_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	55.1	1.1e-10
>prophage 1
NZ_CP031069	Bacillus sp. JAS24-2 plasmid pl626, complete sequence	626394	213152	294301	626394	integrase,transposase,protease	Bacillus_phage(50.0%)	59	227485:227508	289504:289527
WP_149216882.1|213152_214274_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	1.1e-173
WP_149216883.1|218271_219936_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_149216884.1|220024_220861_+	class C sortase	NA	NA	NA	NA	NA
WP_149216885.1|221091_222321_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149216886.1|222815_224045_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149216887.1|225633_226014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216888.1|226259_227489_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
227485:227508	attL	TTCATTGTATTCTCCTTTTAAATG	NA	NA	NA	NA
WP_149216889.1|227939_232691_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_149216890.1|232720_234382_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_149216891.1|234481_235306_+	class C sortase	NA	NA	NA	NA	NA
WP_149216892.1|235413_236610_+	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_149216893.1|237147_237966_+	class C sortase	NA	NA	NA	NA	NA
WP_149216894.1|238227_239454_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149216895.1|240100_240667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216896.1|240748_241039_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_149216897.1|242172_243168_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149216898.1|243345_243549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216899.1|243570_244743_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	3.0e-06
WP_001000186.1|245413_245920_-	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_149216900.1|246677_247103_+	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
WP_149216901.1|247333_248125_+	ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	37.7	1.6e-27
WP_149216902.1|249650_249863_+	small, acid-soluble spore protein, alpha/beta type	NA	Q77YX0	Bacillus_phage	56.7	1.9e-12
WP_149217099.1|250252_250456_-	spore germination protein	NA	NA	NA	NA	NA
WP_149216903.1|250563_250791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216904.1|251386_252796_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_149216905.1|252944_254522_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_149216906.1|254877_255324_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_149216907.1|255986_257705_+	alpha-keto acid decarboxylase family protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	8.4e-21
WP_149216908.1|257945_259367_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_149217100.1|259693_260230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149214957.1|260296_261148_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_149216909.1|261161_261959_+	hydrolase TatD	NA	NA	NA	NA	NA
WP_149214956.1|261973_262804_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_149216910.1|262800_263679_+	UbiA-like protein EboC	NA	NA	NA	NA	NA
WP_149217101.1|263711_265034_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_149216911.1|265038_266223_+	myo-inositol-1-phosphate synthase	NA	NA	NA	NA	NA
WP_149216912.1|266678_267599_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_149216913.1|267653_267869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216914.1|268163_269750_+	amino acid permease	NA	NA	NA	NA	NA
WP_086388367.1|269851_270079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216915.1|270815_271667_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_149216916.1|271790_273026_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_149216917.1|273795_274779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216918.1|274871_275774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216919.1|276516_277278_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_149216920.1|277445_277955_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_149216921.1|278658_279135_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_149216922.1|279458_281042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216923.1|281978_283391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216924.1|283831_284905_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.0	1.5e-73
WP_149216925.1|285112_285430_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_149216926.1|285637_286414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216927.1|286613_287360_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_149216928.1|287765_288164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149216929.1|288524_289508_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_149216930.1|289782_290694_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.0	1.1e-35
289504:289527	attR	TTCATTGTATTCTCCTTTTAAATG	NA	NA	NA	NA
WP_113304807.1|290686_291631_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_149216931.1|291826_292834_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_149216932.1|293182_294301_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.5	8.9e-173
>prophage 2
NZ_CP031069	Bacillus sp. JAS24-2 plasmid pl626, complete sequence	626394	585858	593680	626394	holin	Bacillus_phage(90.91%)	11	NA	NA
WP_149217077.1|585858_586914_-	SH3 domain-containing protein	NA	A0A1B0T6C8	Bacillus_phage	71.8	3.1e-151
WP_149217078.1|586910_587150_-|holin	holin	holin	A0A0A7AR38	Bacillus_phage	74.7	5.9e-26
WP_000377825.1|587149_587386_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	84.6	3.0e-14
WP_149217079.1|587455_588352_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.1	6.0e-79
WP_149217080.1|588627_589470_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A218KCJ1	Bacillus_phage	47.7	1.0e-32
WP_149217081.1|589592_590579_-	lysozyme family protein	NA	A0A218KCJ1	Bacillus_phage	47.5	1.4e-33
WP_098685367.1|590817_591204_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	71.4	2.0e-47
WP_149217082.1|591307_592204_-	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	51.2	3.1e-75
WP_086388376.1|592427_592664_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	58.2	2.4e-11
WP_086388377.1|592800_593229_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	51.4	1.6e-29
WP_065705253.1|593251_593680_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	1.6e-34
