The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035899	Bacillus amyloliquefaciens strain ARP23 chromosome, complete genome	4018867	402751	412641	4018867		Synechococcus_phage(42.86%)	8	NA	NA
WP_032871757.1|402751_404290_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	6.7e-78
WP_007408902.1|404286_404874_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_151295677.1|404870_405911_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	2.2e-64
WP_007609856.1|406002_407433_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_151295678.1|407408_409637_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	1.2e-157
WP_151295679.1|409620_410304_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_151295680.1|410300_410555_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_007408896.1|411348_412641_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
>prophage 2
NZ_CP035899	Bacillus amyloliquefaciens strain ARP23 chromosome, complete genome	4018867	1326168	1372770	4018867	lysis,holin,coat	Escherichia_phage(33.33%)	45	NA	NA
WP_012118753.1|1326168_1326849_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_007407725.1|1326830_1327217_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003150908.1|1327323_1328232_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151295944.1|1328234_1329053_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_151295945.1|1329923_1330118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295946.1|1330136_1331393_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_151295947.1|1331478_1332081_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_151295948.1|1332774_1333455_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003150917.1|1333670_1333832_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_151295949.1|1334166_1334790_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151296710.1|1334869_1335256_+	GtrA family protein	NA	NA	NA	NA	NA
WP_151295950.1|1336480_1338022_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003150926.1|1338037_1338283_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_012118744.1|1338784_1339750_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012118743.1|1339777_1341727_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003150930.1|1341741_1342356_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_007407711.1|1342357_1342726_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_007614574.1|1342769_1343030_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_151295951.1|1343322_1343736_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151295952.1|1344188_1344404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151295953.1|1345936_1346686_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_151295954.1|1346849_1347851_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003150952.1|1350828_1351143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407705.1|1351166_1351997_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_151295955.1|1352216_1353599_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_151295956.1|1353595_1355035_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	24.8	1.6e-20
WP_007407702.1|1355134_1355374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150959.1|1355404_1356217_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003150960.1|1356366_1356705_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151295957.1|1356697_1357333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295958.1|1357378_1357906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295959.1|1357989_1358808_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012118732.1|1358804_1359488_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
WP_022553956.1|1359548_1359971_+	YwdI family protein	NA	NA	NA	NA	NA
WP_007407694.1|1361371_1361743_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015240806.1|1362620_1363391_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	25.4	5.8e-06
WP_012118727.1|1364840_1366010_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_032868197.1|1366010_1366874_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151295960.1|1366873_1367995_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_151295961.1|1367984_1368728_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_151295962.1|1368729_1369734_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_012118722.1|1369761_1370499_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.3	6.5e-47
WP_151295963.1|1370501_1371449_+	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	42.1	2.0e-69
WP_114354770.1|1371469_1372318_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	2.4e-37
WP_003150986.1|1372314_1372770_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP035899	Bacillus amyloliquefaciens strain ARP23 chromosome, complete genome	4018867	2042353	2075384	4018867	head,capsid,tail,terminase,integrase	uncultured_Caudovirales_phage(44.44%)	47	2042200:2042259	2086109:2086174
2042200:2042259	attL	CTGGCAGCGTAGAGGTCAGGGGTTCGAGCCCCCTTGGCTCCATACCTTTAAACCCTTATT	NA	NA	NA	NA
WP_007408627.1|2042353_2043580_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	49.5	1.4e-107
WP_007408626.1|2043584_2044106_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	64.6	1.6e-55
WP_151296156.1|2044178_2045156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015239592.1|2045372_2045747_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	65.9	1.2e-33
WP_063095672.1|2045905_2046130_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	78.4	4.7e-25
WP_007408621.1|2046140_2046335_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151296157.1|2046331_2047060_+	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	63.3	8.3e-87
WP_003155916.1|2047117_2047690_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	1.3e-58
WP_151296158.1|2047686_2047944_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	40.5	6.0e-08
WP_151296159.1|2047940_2048138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007408617.1|2048240_2048429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239598.1|2048425_2049343_+	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	61.4	9.4e-88
WP_082186550.1|2049362_2050100_+	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	44.9	6.7e-52
WP_007408614.1|2050099_2050288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296160.1|2050297_2050999_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	33.3	9.0e-06
WP_139890484.1|2050883_2051831_+	AAA family ATPase	NA	A0A0K2CPA5	Brevibacillus_phage	51.1	4.0e-57
WP_016938684.1|2052065_2052494_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	62.0	4.8e-42
WP_151296161.1|2052784_2052988_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	2.6e-22
WP_151296162.1|2053019_2053400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296163.1|2053396_2053798_+	hypothetical protein	NA	X2JNJ3	Bacillus_phage	46.4	4.3e-29
WP_151296164.1|2053810_2054071_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.7	2.8e-05
WP_151296165.1|2054074_2054899_+	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	57.6	3.8e-88
WP_151296166.1|2055014_2055533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151296167.1|2055671_2056106_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	72.9	8.2e-50
WP_151296168.1|2056375_2056993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296169.1|2057125_2057254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296170.1|2057268_2057784_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	45.5	1.8e-27
WP_031378529.1|2058125_2058317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155868.1|2058324_2058537_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
WP_151296171.1|2058543_2058726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296172.1|2058718_2058931_+	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	48.3	1.4e-07
WP_151296173.1|2059454_2059736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296174.1|2060644_2061853_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	86.8	2.9e-209
WP_151296175.1|2064269_2064851_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	53.7	2.4e-52
WP_151296176.1|2064865_2065783_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	68.9	2.0e-114
WP_151296177.1|2065787_2066123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296178.1|2066124_2066376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296179.1|2066384_2066684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296180.1|2066680_2067019_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_015239630.1|2067445_2067844_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
WP_007408587.1|2067857_2068373_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_080292743.1|2068296_2068629_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	75.3	3.1e-25
WP_151296721.1|2068642_2068885_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_007408585.1|2068941_2069448_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	32.7	1.5e-10
WP_003155844.1|2069495_2069804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296722.1|2069808_2074623_+	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	24.1	2.3e-36
WP_151296181.1|2074619_2075384_+|tail	phage tail family protein	tail	NA	NA	NA	NA
2086109:2086174	attR	CTGGCAGCGTAGAGGTCAGGGGTTCGAGCCCCCTTGGCTCCATACCTTTAAACCCTTATTCTATAA	NA	NA	NA	NA
>prophage 4
NZ_CP035899	Bacillus amyloliquefaciens strain ARP23 chromosome, complete genome	4018867	2337124	2366894	4018867	terminase,portal	uncultured_Caudovirales_phage(54.84%)	43	NA	NA
WP_016938667.1|2337124_2337601_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	37.6	5.0e-24
WP_151296250.1|2339225_2339630_-	helix-turn-helix transcriptional regulator	NA	O64078	Bacillus_phage	46.5	2.3e-14
WP_129003950.1|2339821_2340052_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_127010347.1|2340298_2340997_+	phage antirepressor	NA	Q4ZCB0	Staphylococcus_virus	47.8	1.1e-32
WP_151296251.1|2341065_2341638_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.6	4.7e-61
WP_151296252.1|2341634_2341913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073981971.1|2341899_2342100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296253.1|2342211_2342829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296254.1|2342821_2343007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296255.1|2343006_2343957_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	73.0	3.7e-135
WP_151296256.1|2343959_2344799_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	80.5	1.0e-120
WP_151296257.1|2345803_2346712_+	AAA domain-containing protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	72.8	1.9e-104
WP_003155894.1|2347974_2348178_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_151296258.1|2348208_2348574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296259.1|2348570_2348786_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	65.5	1.7e-16
WP_151296260.1|2348782_2349037_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.5	3.8e-07
WP_151296261.1|2349132_2349873_+	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	67.6	3.1e-89
WP_069007377.1|2349960_2350299_+	hypothetical protein	NA	Q9ZXC0	Bacillus_phage	86.6	3.2e-49
WP_151296262.1|2350446_2350926_+	hypothetical protein	NA	A0A059VFZ8	Pseudomonas_phage	35.8	5.0e-16
WP_151296263.1|2350965_2351271_+	hypothetical protein	NA	Q38076	Bacillus_phage	39.4	8.1e-12
WP_151296725.1|2351568_2351841_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	46.7	3.7e-16
WP_151296264.1|2351837_2352200_+	hypothetical protein	NA	R4JKA5	Bacillus_phage	42.9	1.9e-20
WP_151296265.1|2352196_2352385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129003918.1|2352459_2352822_+	hypothetical protein	NA	A0A2I6UHS3	Bacillus_phage	28.6	8.7e-05
WP_151296266.1|2353189_2353408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296267.1|2353413_2353848_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	71.4	1.1e-49
WP_151296268.1|2353881_2354172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129003956.1|2354227_2354431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296269.1|2354954_2355416_+	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	52.0	1.1e-25
WP_151296270.1|2355809_2356007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127010307.1|2357162_2358368_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	84.0	1.2e-202
WP_151296271.1|2358371_2359784_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	58.7	6.0e-150
WP_127010303.1|2360283_2360556_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	80.0	4.1e-39
WP_103042004.1|2360678_2361398_+	DUF4355 domain-containing protein	NA	A0A1L2K2N1	Aeribacillus_phage	56.1	5.0e-52
WP_014470561.1|2361412_2362273_+	hypothetical protein	NA	A0A1L2JY55	Aeribacillus_phage	77.1	4.5e-124
WP_014470560.1|2362286_2362490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296272.1|2362501_2363371_+	hypothetical protein	NA	A0A2H4JD21	uncultured_Caudovirales_phage	43.0	3.9e-51
WP_014470558.1|2363385_2363721_+	hypothetical protein	NA	A0A2H4J6J9	uncultured_Caudovirales_phage	56.8	1.2e-29
WP_151296273.1|2363725_2364229_+	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	58.9	1.4e-48
WP_151296274.1|2364228_2364618_+	hypothetical protein	NA	A0A2H4JDP3	uncultured_Caudovirales_phage	57.0	3.5e-28
WP_151296275.1|2364574_2365045_+	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	57.0	1.3e-48
WP_014470553.1|2366099_2366495_+	hypothetical protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	64.3	2.3e-38
WP_151296276.1|2366594_2366894_+	hypothetical protein	NA	A0A2D1GQ87	Lysinibacillus_phage	41.7	1.3e-06
>prophage 5
NZ_CP035899	Bacillus amyloliquefaciens strain ARP23 chromosome, complete genome	4018867	2372234	2380633	4018867	holin,plate	uncultured_Caudovirales_phage(81.82%)	13	NA	NA
WP_129003885.1|2372234_2372594_+	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	71.2	2.8e-43
WP_151296277.1|2372577_2373546_+	hypothetical protein	NA	A0A2H4J4T4	uncultured_Caudovirales_phage	59.2	4.4e-104
WP_016938720.1|2373545_2373893_+	hypothetical protein	NA	A0A2H4JDQ2	uncultured_Caudovirales_phage	60.0	3.4e-30
WP_151296278.1|2373889_2374246_+	DUF2634 domain-containing protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	60.2	6.7e-34
WP_151296279.1|2374238_2375414_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	71.4	4.1e-152
WP_151296280.1|2376053_2377295_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	54.0	1.8e-33
WP_151296281.1|2377307_2377730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296282.1|2377719_2377911_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	62.9	1.4e-17
WP_042635098.1|2377978_2378257_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	67.4	4.8e-27
WP_151296283.1|2378272_2378536_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	70.1	2.9e-26
WP_151296284.1|2378591_2379749_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	66.2	1.7e-70
WP_151296285.1|2380216_2380417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296286.1|2380420_2380633_+	helix-turn-helix domain-containing protein	NA	A0A290FZJ4	Caldibacillus_phage	50.7	2.6e-09
>prophage 6
NZ_CP035899	Bacillus amyloliquefaciens strain ARP23 chromosome, complete genome	4018867	2406018	2452153	4018867	portal,head,protease,capsid,tRNA,tail,terminase	Bacillus_phage(81.48%)	48	NA	NA
WP_151296295.1|2406018_2407281_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.5	8.5e-148
WP_007612896.1|2409286_2411611_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.4e-183
WP_003152626.1|2411607_2412195_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_052827767.1|2412911_2414279_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_151296296.1|2414286_2415117_+	cytochrome C assembly protein	NA	NA	NA	NA	NA
WP_151296297.1|2415151_2416093_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_151296298.1|2416082_2416862_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_029326045.1|2416867_2417842_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_151296299.1|2419291_2421202_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_003152639.1|2422271_2422463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151296300.1|2422914_2425557_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	3.7e-161
WP_059368033.1|2425615_2426908_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_069006955.1|2427923_2428925_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_151296301.1|2429065_2429635_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_151296302.1|2430086_2431511_-	recombinase family protein	NA	Q9T200	Bacillus_phage	98.7	3.0e-266
WP_015968241.1|2431556_2432003_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	100.0	2.4e-81
WP_045510139.1|2432016_2432451_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	97.2	4.3e-67
WP_045510142.1|2432711_2432984_+	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	90.0	1.7e-37
WP_151296303.1|2433209_2433491_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	77.9	1.7e-32
WP_104679009.1|2433477_2433786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296304.1|2433776_2434424_+	DNA-binding protein	NA	A0A288WFT2	Bacillus_phage	40.6	1.6e-33
WP_052364770.1|2435438_2435807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032867711.1|2435818_2436610_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	48.2	3.2e-28
WP_144663912.1|2436602_2436959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296305.1|2436960_2438289_+	replicative DNA helicase	NA	W8EEZ1	Geobacillus_phage	56.7	8.4e-138
WP_151296306.1|2438278_2438491_+	hypothetical protein	NA	A0A0U4B0C8	Bacillus_phage	42.2	9.9e-09
WP_151296307.1|2438516_2438726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296308.1|2438722_2438950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144663914.1|2438936_2439137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296309.1|2439356_2439872_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	42.0	4.0e-27
WP_032867696.1|2440329_2440515_-	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	69.5	1.2e-18
WP_151296310.1|2440698_2441337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296311.1|2441436_2441727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296312.1|2441895_2442144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296313.1|2442280_2442499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151296314.1|2442512_2442887_+	HNH endonuclease	NA	Q38456	Bacillus_phage	95.2	2.3e-69
WP_151296315.1|2442855_2443182_+	transglycosylase	NA	Q9T203	Bacillus_phage	98.1	1.7e-55
WP_015968210.1|2443268_2443775_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	100.0	8.8e-88
WP_151296316.1|2445494_2445725_+	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.3	1.6e-20
WP_151296317.1|2445730_2446981_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	99.5	4.8e-244
WP_053574214.1|2446970_2447597_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	97.1	2.1e-110
WP_064115596.1|2447636_2448839_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	72.0	2.3e-158
WP_139783886.1|2448851_2449163_+	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	96.0	9.7e-45
WP_039251289.1|2450037_2450397_+|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	96.6	8.0e-59
WP_061521161.1|2450389_2450773_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	98.4	2.5e-66
WP_151296726.1|2450769_2451150_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	93.7	5.0e-59
WP_095352906.1|2451150_2451759_+|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	91.0	4.4e-102
WP_151296318.1|2451814_2452153_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	92.0	3.6e-53
>prophage 7
NZ_CP035899	Bacillus amyloliquefaciens strain ARP23 chromosome, complete genome	4018867	3846380	3878031	4018867	portal,plate,holin,tail,terminase	Bacillus_phage(29.63%)	38	NA	NA
WP_151296630.1|3846380_3847259_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
WP_003154813.1|3847272_3847536_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_151296631.1|3847549_3847813_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_061581965.1|3847864_3848626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151296632.1|3848682_3848880_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	9.5e-14
WP_151296633.1|3848884_3849256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154822.1|3850901_3851174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007407262.1|3851170_3851749_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	3.1e-12
WP_151296740.1|3851732_3852779_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	6.6e-69
WP_151296634.1|3852771_3853197_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	3.3e-11
WP_007610818.1|3853300_3853567_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_151296635.1|3853566_3854544_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.0	2.3e-39
WP_151296636.1|3854557_3855217_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_015239684.1|3860078_3860231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151296637.1|3860272_3860677_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	9.1e-11
WP_151296638.1|3861238_3862636_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	1.5e-81
WP_151296639.1|3862840_3863287_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_151296640.1|3863283_3863787_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.7	9.2e-37
WP_127070283.1|3863783_3864140_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_063095517.1|3864136_3864520_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407274.1|3864536_3865472_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_151296641.1|3865498_3866344_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
WP_094031916.1|3866363_3867755_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	3.0e-138
WP_151296642.1|3867803_3869102_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	58.9	3.6e-149
WP_151296643.1|3869098_3869896_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.4	1.6e-59
WP_007407279.1|3870008_3870521_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
WP_007407280.1|3870627_3870831_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.9e-12
WP_015239676.1|3870820_3871162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151296644.1|3871426_3872227_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.5	8.0e-59
WP_151296645.1|3872126_3872954_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	50.0	4.4e-20
WP_033574556.1|3872943_3873123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151296646.1|3873312_3873693_+	helix-turn-helix domain-containing protein	NA	O03970	Lactobacillus_phage	62.1	5.4e-13
WP_007610775.1|3873798_3874389_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_151296647.1|3874296_3874557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047935636.1|3874546_3875152_-	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	1.0e-42
WP_151296648.1|3875261_3875675_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	48.6	1.8e-14
WP_144499842.1|3876770_3876905_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_087920760.1|3876894_3878031_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
