The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043400	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. JY996 chromosome, complete genome	4870263	976940	985672	4870263	transposase,protease	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|976940_978059_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|978055_980002_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|980131_980353_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|980676_980997_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|981027_983304_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|983495_983954_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_119920232.1|984126_984402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983316.1|984416_985672_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP043400	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. JY996 chromosome, complete genome	4870263	1035765	1134574	4870263	portal,protease,integrase,tail,tRNA,terminase,holin,lysis	Salmonella_phage(44.64%)	102	1038674:1038693	1110462:1110481
WP_001154025.1|1035765_1036569_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1036561_1037884_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1037864_1038569_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1038568_1043035_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1038674:1038693	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1043379_1045221_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1045480_1046029_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1046056_1046704_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1046765_1047956_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1048140_1049232_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1049838_1051239_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1051439_1051901_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1051897_1052131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1052217_1053432_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1053676_1055113_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1055190_1056393_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262308.1|1056587_1057880_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.5	2.9e-252
WP_000065276.1|1057924_1058173_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1058213_1058453_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1058495_1059653_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1059615_1062501_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1062627_1062927_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1062948_1063107_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1063099_1063360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1063409_1063820_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1063939_1064179_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1064144_1064519_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1064603_1065587_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800013.1|1065589_1066339_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
WP_000113629.1|1066349_1066697_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1066693_1067005_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1067082_1067373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1067664_1067898_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1068009_1068231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1068313_1068916_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001241019.1|1068915_1069122_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096552.1|1069124_1069736_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1069732_1069879_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1069868_1070666_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1070732_1071050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1071223_1071349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1071484_1071934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1072294_1072981_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1073256_1073586_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1073569_1074022_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1074039_1074519_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1074726_1075260_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1075216_1077355_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1077351_1077558_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1077584_1079102_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1079025_1081107_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1081197_1081521_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1081513_1081813_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1081793_1082360_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1082356_1082758_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1082769_1083519_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1083564_1083963_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1083959_1084289_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1084368_1087356_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1087352_1087685_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1087783_1088281_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1088397_1088931_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1089020_1089716_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1089725_1090463_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1090360_1091065_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000178849.1|1094525_1094768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1094821_1097260_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1097259_1097841_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|1098316_1099285_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|1099932_1100559_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1100627_1100927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1100911_1101598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1101868_1102060_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1102486_1105099_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1105306_1106317_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1106482_1107025_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1107021_1108131_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1108229_1110338_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1110350_1112258_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1110462:1110481	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1112272_1113526_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1113530_1115171_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1115167_1115731_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1115986_1116154_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1116253_1116772_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1116840_1118601_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1118786_1119239_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1119310_1120363_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1120719_1121229_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1121445_1122051_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1122037_1124191_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1124209_1124656_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1124779_1126834_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1126869_1127328_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1127422_1128085_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1128255_1128672_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1128716_1129034_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1129091_1130303_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1130517_1131066_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1131091_1131871_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1131919_1132201_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1132197_1132527_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1132613_1133273_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1133893_1134574_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP043400	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. JY996 chromosome, complete genome	4870263	1273021	1330135	4870263	portal,capsid,transposase,integrase,tail,head,tRNA,terminase,lysis	Enterobacteria_phage(32.69%)	73	1283749:1283763	1298147:1298161
WP_000502119.1|1273021_1273480_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001113672.1|1273570_1274860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000456516.1|1274899_1276021_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001031687.1|1276101_1277565_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000986522.1|1277564_1278239_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423763.1|1278362_1279733_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
WP_001519653.1|1279736_1280378_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004541.1|1280464_1281571_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476067.1|1281624_1282086_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825957.1|1282097_1282427_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001249412.1|1282423_1283089_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444507.1|1283260_1284511_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
1283749:1283763	attL	TGAATGGAAAGCTGA	NA	NA	NA	NA
WP_000741325.1|1284623_1285766_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000089141.1|1285755_1285992_-	excisionase	NA	NA	NA	NA	NA
WP_000069465.1|1286041_1286593_-	hypothetical protein	NA	A0A192Y7X3	Salmonella_phage	34.5	2.8e-10
WP_000066251.1|1286589_1286922_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
WP_001033922.1|1286914_1287235_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
WP_001126029.1|1287270_1288101_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
WP_022664343.1|1288093_1290805_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	39.6	1.2e-125
WP_000373340.1|1291515_1291722_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000368620.1|1291829_1292915_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_000169863.1|1293066_1293534_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
WP_000145711.1|1293547_1293775_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_072143007.1|1293740_1294115_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000024048.1|1294206_1295112_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_000788827.1|1295108_1295801_+	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000065092.1|1295815_1296481_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000852188.1|1296482_1296953_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000208067.1|1296955_1297609_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000002116.1|1297601_1297883_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_014344025.1|1297994_1298186_+	hypothetical protein	NA	G8C7S2	Escherichia_phage	68.9	1.1e-17
1298147:1298161	attR	TGAATGGAAAGCTGA	NA	NA	NA	NA
WP_001217669.1|1298444_1298678_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1298794_1299043_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929785.1|1299077_1299677_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	81.0	1.7e-93
WP_000784702.1|1299673_1299868_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
WP_000926953.1|1299849_1300146_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
WP_000639984.1|1300142_1300697_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
WP_014344026.1|1300693_1300882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211401.1|1300963_1301524_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	71.1	1.1e-41
WP_024132423.1|1301443_1301632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658040.1|1301766_1301955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000690097.1|1302108_1302327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533418.1|1302338_1302806_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_001533331.1|1303055_1303358_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001208107.1|1303335_1303875_+	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	5.7e-77
WP_086015771.1|1304192_1304648_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.8	8.0e-56
WP_000669689.1|1304874_1305276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1305561_1306107_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623088.1|1306078_1308010_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_000201415.1|1307993_1308197_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_149100639.1|1308193_1309774_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	7.3e-189
WP_149100640.1|1309763_1311260_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.8e-96
WP_000011260.1|1311272_1311620_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1311674_1312703_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_149100641.1|1312760_1313126_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1313136_1313520_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_149100642.1|1313547_1314126_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	6.3e-82
WP_149100643.1|1314174_1315305_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.7	4.5e-217
WP_000033885.1|1315413_1315815_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1315822_1316569_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1316619_1317015_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1317011_1317350_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1317321_1320417_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1320419_1320749_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1320758_1321457_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1321463_1322201_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1322098_1322746_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514918.1|1322807_1326170_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000178849.1|1326208_1326451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038407301.1|1326504_1328946_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.0	2.5e-87
WP_000143179.1|1328945_1329530_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
WP_014344029.1|1329627_1329828_-	PagJ	NA	NA	NA	NA	NA
WP_071531834.1|1330018_1330135_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP043400	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. JY996 chromosome, complete genome	4870263	2057140	2136484	4870263	portal,capsid,lysis,transposase,integrase,tail,head,terminase,plate,holin,protease	Salmonella_phage(85.07%)	105	2063678:2063693	2138107:2138122
WP_000502119.1|2057140_2057599_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2057779_2058985_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2059063_2060551_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2060807_2062211_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2062225_2062633_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2062632_2063001_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2063072_2064557_+	alpha-amylase	NA	NA	NA	NA	NA
2063678:2063693	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2064596_2065022_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2065207_2066413_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2066409_2066643_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2066907_2067294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2067413_2067728_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2067944_2069627_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2069619_2070615_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2070607_2071315_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2071314_2072685_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2072706_2073150_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2073146_2074364_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2074468_2074936_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2074940_2075945_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2075941_2076355_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2076354_2076732_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2076731_2077469_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2077478_2077748_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2077756_2078551_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2078832_2079456_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2079494_2079743_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2079817_2080045_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2080354_2081170_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2081148_2082861_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2083025_2083271_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2083287_2084199_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2084374_2085295_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2085283_2085754_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2085734_2087165_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2087238_2087934_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2088025_2088325_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2088974_2090171_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2090431_2090620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2090630_2090843_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2091297_2092566_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2092568_2092988_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2093114_2093276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099112411.1|2093577_2093793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2093906_2094128_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2094340_2095348_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_000760554.1|2095632_2096202_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000554737.1|2096201_2097764_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2097750_2098338_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2098340_2098862_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|2098896_2099442_-	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2099413_2099827_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2099831_2100365_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2100364_2101423_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2101419_2102760_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2102793_2104722_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2104806_2105133_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2105129_2105486_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2105485_2106982_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2106971_2107136_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2107139_2107700_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2107696_2108209_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2108180_2108585_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2108581_2108905_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2108907_2109108_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2109158_2110364_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2110378_2111029_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2111006_2112248_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2112247_2112430_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2112441_2114175_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2114171_2114666_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2114791_2115142_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2115202_2115505_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2115724_2116144_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2116356_2116842_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2116838_2117453_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2117455_2117800_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2117961_2118396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2118325_2118583_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2118715_2119339_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202278.1|2119349_2120339_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	9.2e-190
WP_001061457.1|2120346_2121207_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2121223_2121613_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2121609_2122503_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2122502_2122985_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2122986_2123805_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2123801_2124026_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2124022_2125180_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2125176_2125731_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2125759_2125984_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2125922_2126108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2126081_2126777_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2127591_2127963_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2128020_2128848_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2128984_2129524_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2129594_2129825_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2129821_2130337_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2130333_2130951_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2130947_2131781_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2131784_2132354_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2132378_2132621_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2132622_2133612_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2133903_2134701_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2135072_2135363_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2136010_2136484_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2138107:2138122	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP043400	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. JY996 chromosome, complete genome	4870263	2222478	2232984	4870263		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2222478_2223792_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2223818_2224898_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2224902_2225676_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2225672_2226665_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2226670_2227222_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2227222_2228101_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2228148_2229048_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2229047_2230133_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2230509_2231403_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2231580_2232984_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP043400	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. JY996 chromosome, complete genome	4870263	2301292	2310463	4870263	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2301292_2303326_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2303566_2304025_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2304196_2304727_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2304783_2305251_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2305297_2306017_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2306013_2307699_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2307921_2308653_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2308712_2308820_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2308800_2309532_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2309515_2310463_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
NZ_CP043400	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. JY996 chromosome, complete genome	4870263	2329870	2396265	4870263	holin,tail,lysis	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2329870_2330566_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2330719_2331604_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2331780_2332500_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2332496_2332742_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2332946_2334188_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2334181_2335417_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2335491_2336502_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2336517_2338038_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2338171_2339170_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2339668_2340691_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2340840_2341983_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2341997_2342666_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2342995_2343853_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2343841_2344231_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2344235_2345603_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2345819_2346707_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2346739_2348062_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2348105_2350097_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2350441_2351911_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2352100_2352964_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2353084_2354134_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2354212_2355070_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2355134_2356823_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2356839_2357778_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2357777_2358908_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2359276_2360458_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2360522_2361188_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2361189_2361312_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2361699_2361954_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2362277_2362850_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2363062_2364049_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2364078_2364798_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2365211_2365784_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2366109_2367666_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2367772_2369578_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2369587_2370682_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2370681_2371707_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2371708_2373298_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2373301_2373646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2374036_2375227_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2375254_2375950_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2376101_2377862_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2377986_2378271_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2378379_2379000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2379027_2380035_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2380214_2380442_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2380473_2382234_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2382514_2383018_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2383045_2383336_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2383683_2385513_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2385566_2386010_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2386387_2386915_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2386917_2388159_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2388751_2389081_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2389377_2390709_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2390737_2391106_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_014344510.1|2391120_2392110_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.4e-190
WP_001115840.1|2392438_2394805_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2394973_2395177_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2395473_2396265_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP043400	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. JY996 chromosome, complete genome	4870263	2735138	2836608	4870263	portal,capsid,transposase,protease,integrase,tail,head,tRNA,terminase,holin,lysis	Salmonella_phage(36.07%)	110	2761282:2761297	2831697:2831712
WP_000940032.1|2735138_2735870_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2735988_2736792_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2736936_2737815_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2737996_2739040_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2739043_2739862_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2739872_2740886_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2740886_2741873_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2741863_2742502_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2742627_2743905_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2743899_2745039_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2745234_2746488_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2746812_2748003_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2748184_2749729_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2750089_2751421_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2751503_2753648_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2753703_2755164_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2755212_2755551_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2755627_2756965_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2756961_2757726_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2757727_2759158_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970045.1|2759807_2763695_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2761282:2761297	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2763716_2763950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734258.1|2763950_2765495_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2765545_2766097_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2766121_2766757_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2766760_2768122_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2768132_2769026_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2769141_2769990_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2770028_2770946_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2770967_2772164_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2772279_2773206_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2773243_2773504_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2773615_2773996_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2773995_2774727_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2774738_2775467_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2775478_2776384_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2776380_2777061_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2777334_2778309_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2778325_2780125_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2780529_2782023_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2782501_2782639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2783351_2783516_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2784095_2784161_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2784223_2784436_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2784542_2784770_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2784866_2785445_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2785434_2786259_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2786255_2788628_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2788681_2788924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2788962_2792325_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2792386_2793034_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2792931_2793669_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2793675_2794374_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2794383_2794713_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2794715_2797811_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2797782_2798121_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2798117_2798513_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2798563_2799310_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2799317_2799719_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_149100644.1|2799827_2800958_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.5	5.0e-216
WP_149100642.1|2801006_2801585_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	6.3e-82
WP_000083294.1|2801612_2801996_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_149100641.1|2802006_2802372_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2802429_2803458_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2803512_2803860_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_149100645.1|2803872_2805369_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.4	4.8e-97
WP_149100639.1|2805358_2806939_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	7.3e-189
WP_000201415.1|2806935_2807139_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2807122_2809054_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2809025_2809571_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2809857_2810259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2810494_2810947_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2810964_2811417_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2811400_2811730_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2812005_2812692_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2812906_2813095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2813601_2814165_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_072095218.1|2814255_2814441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097241.1|2814437_2815115_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2815111_2815252_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2815248_2815860_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001241017.1|2815862_2816069_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_000929791.1|2816068_2816671_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2816705_2816954_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2817070_2817304_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2817546_2818179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2818286_2818985_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2818998_2819694_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|2819690_2820575_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|2820666_2821041_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2821000_2821243_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2821342_2821738_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2821796_2822636_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2822628_2823015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2823014_2823677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2824133_2824292_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2824313_2824664_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2824790_2827718_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2827680_2828838_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2828880_2829120_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2829160_2829445_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2829422_2830652_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2831149_2831629_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2831625_2832582_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2831697:2831712	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2832581_2833232_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2833263_2833839_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2833835_2834000_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|2833999_2834179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000989177.1|2834263_2835886_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2835870_2836608_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP043400	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. JY996 chromosome, complete genome	4870263	4431454	4451874	4870263	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4431454_4432183_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4432379_4432670_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4432918_4433374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4433370_4433976_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4433980_4435726_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4435728_4436361_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4436353_4437469_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4437459_4437819_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4437982_4439530_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4439529_4440459_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4440455_4440818_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4441145_4441868_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4441877_4442921_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4442908_4443118_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4443117_4444071_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4444070_4446425_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4446521_4446650_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4446609_4446927_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4446978_4447503_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4447502_4448930_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4448919_4449117_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4449113_4449569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4449728_4450043_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270440.1|4450055_4450661_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_001226442.1|4450663_4450951_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4451526_4451874_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
