The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043399	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. GXS275 chromosome, complete genome	4870694	976940	987102	4870694	transposase,protease	Dickeya_phage(12.5%)	10	NA	NA
WP_001201751.1|976940_978059_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|978055_980002_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|980131_980353_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000572405.1|981133_981928_+	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
WP_149100777.1|981948_982197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044815406.1|982184_982427_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	6.4e-12
WP_000934063.1|982457_984734_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|984925_985384_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_119920232.1|985556_985832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983316.1|985846_987102_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP043399	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. GXS275 chromosome, complete genome	4870694	1037195	1136004	4870694	integrase,holin,protease,tail,lysis,tRNA,terminase,portal	Salmonella_phage(44.64%)	102	1040104:1040123	1111892:1111911
WP_001154025.1|1037195_1037999_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1037991_1039314_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1039294_1039999_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1039998_1044465_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1040104:1040123	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1044809_1046651_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1046910_1047459_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1047486_1048134_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1048195_1049386_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1049570_1050662_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1051268_1052669_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1052869_1053331_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1053327_1053561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1053647_1054862_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1055106_1056543_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1056620_1057823_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262308.1|1058017_1059310_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.5	2.9e-252
WP_000065276.1|1059354_1059603_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1059643_1059883_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1059925_1061083_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1061045_1063931_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1064057_1064357_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1064378_1064537_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1064529_1064790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1064839_1065250_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1065369_1065609_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1065574_1065949_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1066033_1067017_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800013.1|1067019_1067769_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
WP_000113629.1|1067779_1068127_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1068123_1068435_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1068512_1068803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1069094_1069328_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1069439_1069661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1069743_1070346_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001241019.1|1070345_1070552_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096552.1|1070554_1071166_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1071162_1071309_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1071298_1072096_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1072162_1072480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1072653_1072779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1072914_1073364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1073724_1074411_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1074686_1075016_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1074999_1075452_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1075469_1075949_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1076156_1076690_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1076646_1078785_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1078781_1078988_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1079014_1080532_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1080455_1082537_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1082627_1082951_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1082943_1083243_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1083223_1083790_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1083786_1084188_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1084199_1084949_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1084994_1085393_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1085389_1085719_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1085798_1088786_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1088782_1089115_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1089213_1089711_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1089827_1090361_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1090450_1091146_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1091155_1091893_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1091790_1092495_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000178849.1|1095955_1096198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1096251_1098690_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1098689_1099271_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|1099746_1100715_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|1101362_1101989_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1102057_1102357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1102341_1103028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1103298_1103490_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1103916_1106529_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1106736_1107747_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1107912_1108455_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1108451_1109561_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1109659_1111768_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1111780_1113688_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1111892:1111911	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1113702_1114956_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1114960_1116601_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1116597_1117161_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1117416_1117584_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1117683_1118202_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1118270_1120031_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1120216_1120669_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1120740_1121793_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1122149_1122659_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1122875_1123481_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1123467_1125621_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1125639_1126086_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1126209_1128264_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1128299_1128758_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1128852_1129515_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1129685_1130102_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1130146_1130464_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1130521_1131733_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1131947_1132496_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1132521_1133301_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1133349_1133631_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1133627_1133957_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1134043_1134703_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1135323_1136004_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP043399	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. GXS275 chromosome, complete genome	4870694	1274451	1331565	4870694	integrase,capsid,head,transposase,tail,terminase,lysis,tRNA,portal	Enterobacteria_phage(32.69%)	73	1285179:1285193	1299577:1299591
WP_000502119.1|1274451_1274910_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001113672.1|1275000_1276290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000456516.1|1276329_1277451_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001031687.1|1277531_1278995_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000986522.1|1278994_1279669_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423763.1|1279792_1281163_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
WP_001519653.1|1281166_1281808_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004541.1|1281894_1283001_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476067.1|1283054_1283516_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825957.1|1283527_1283857_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001249412.1|1283853_1284519_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444507.1|1284690_1285941_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
1285179:1285193	attL	TGAATGGAAAGCTGA	NA	NA	NA	NA
WP_000741325.1|1286053_1287196_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000089141.1|1287185_1287422_-	excisionase	NA	NA	NA	NA	NA
WP_000069465.1|1287471_1288023_-	hypothetical protein	NA	A0A192Y7X3	Salmonella_phage	34.5	2.8e-10
WP_000066251.1|1288019_1288352_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
WP_001033922.1|1288344_1288665_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
WP_001126029.1|1288700_1289531_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
WP_022664343.1|1289523_1292235_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	39.6	1.2e-125
WP_000373340.1|1292945_1293152_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000368620.1|1293259_1294345_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_000169863.1|1294496_1294964_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
WP_000145711.1|1294977_1295205_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_072143007.1|1295170_1295545_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000024048.1|1295636_1296542_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_000788827.1|1296538_1297231_+	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000065092.1|1297245_1297911_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000852188.1|1297912_1298383_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000208067.1|1298385_1299039_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000002116.1|1299031_1299313_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_014344025.1|1299424_1299616_+	hypothetical protein	NA	G8C7S2	Escherichia_phage	68.9	1.1e-17
1299577:1299591	attR	TGAATGGAAAGCTGA	NA	NA	NA	NA
WP_001217669.1|1299874_1300108_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1300224_1300473_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929785.1|1300507_1301107_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	81.0	1.7e-93
WP_000784702.1|1301103_1301298_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
WP_000926953.1|1301279_1301576_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
WP_000639984.1|1301572_1302127_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
WP_014344026.1|1302123_1302312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211401.1|1302393_1302954_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	71.1	1.1e-41
WP_024132423.1|1302873_1303062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658040.1|1303196_1303385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000690097.1|1303538_1303757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533418.1|1303768_1304236_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_001533331.1|1304485_1304788_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001208107.1|1304765_1305305_+	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	5.7e-77
WP_086015771.1|1305622_1306078_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.8	8.0e-56
WP_000669689.1|1306304_1306706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1306991_1307537_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623088.1|1307508_1309440_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_000201415.1|1309423_1309627_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_149100639.1|1309623_1311204_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	7.3e-189
WP_149100640.1|1311193_1312690_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.8e-96
WP_000011260.1|1312702_1313050_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1313104_1314133_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_149100641.1|1314190_1314556_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1314566_1314950_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_149100642.1|1314977_1315556_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	6.3e-82
WP_149100643.1|1315604_1316735_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.7	4.5e-217
WP_000033885.1|1316843_1317245_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1317252_1317999_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1318049_1318445_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1318441_1318780_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1318751_1321847_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1321849_1322179_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1322188_1322887_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1322893_1323631_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1323528_1324176_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514918.1|1324237_1327600_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000178849.1|1327638_1327881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038407301.1|1327934_1330376_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.0	2.5e-87
WP_000143179.1|1330375_1330960_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
WP_014344029.1|1331057_1331258_-	PagJ	NA	NA	NA	NA	NA
WP_071531834.1|1331448_1331565_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP043399	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. GXS275 chromosome, complete genome	4870694	1976311	1983120	4870694	tail,integrase	Salmonella_phage(33.33%)	11	1971174:1971196	1980889:1980911
1971174:1971196	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1976311_1977193_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1977665_1977854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1977918_1978086_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1978342_1978876_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1978929_1979160_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1979349_1979844_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1979903_1980758_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1981131_1981485_-	YebY family protein	NA	NA	NA	NA	NA
1980889:1980911	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1981501_1982377_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1982377_1982752_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1982889_1983120_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP043399	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. GXS275 chromosome, complete genome	4870694	2058570	2137914	4870694	integrase,plate,holin,capsid,head,transposase,terminase,protease,tail,lysis,portal	Salmonella_phage(85.07%)	105	2065108:2065123	2139537:2139552
WP_000502119.1|2058570_2059029_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2059209_2060415_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2060493_2061981_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2062237_2063641_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2063655_2064063_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2064062_2064431_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2064502_2065987_+	alpha-amylase	NA	NA	NA	NA	NA
2065108:2065123	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2066026_2066452_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2066637_2067843_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2067839_2068073_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2068337_2068724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2068843_2069158_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2069374_2071057_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2071049_2072045_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2072037_2072745_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2072744_2074115_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2074136_2074580_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2074576_2075794_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2075898_2076366_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2076370_2077375_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2077371_2077785_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2077784_2078162_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2078161_2078899_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2078908_2079178_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2079186_2079981_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2080262_2080886_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2080924_2081173_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2081247_2081475_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2081784_2082600_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2082578_2084291_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2084455_2084701_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2084717_2085629_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2085804_2086725_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2086713_2087184_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2087164_2088595_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2088668_2089364_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2089455_2089755_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2090404_2091601_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2091861_2092050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2092060_2092273_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2092727_2093996_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2093998_2094418_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2094544_2094706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099112411.1|2095007_2095223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2095336_2095558_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2095770_2096778_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_000760554.1|2097062_2097632_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000554737.1|2097631_2099194_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2099180_2099768_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2099770_2100292_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|2100326_2100872_-	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2100843_2101257_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2101261_2101795_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2101794_2102853_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2102849_2104190_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2104223_2106152_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2106236_2106563_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2106559_2106916_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2106915_2108412_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2108401_2108566_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2108569_2109130_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2109126_2109639_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2109610_2110015_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2110011_2110335_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2110337_2110538_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2110588_2111794_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2111808_2112459_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2112436_2113678_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2113677_2113860_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2113871_2115605_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2115601_2116096_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2116221_2116572_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2116632_2116935_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2117154_2117574_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2117786_2118272_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2118268_2118883_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2118885_2119230_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2119391_2119826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2119755_2120013_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2120145_2120769_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202278.1|2120779_2121769_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	9.2e-190
WP_001061457.1|2121776_2122637_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2122653_2123043_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2123039_2123933_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2123932_2124415_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2124416_2125235_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2125231_2125456_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2125452_2126610_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2126606_2127161_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2127189_2127414_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2127352_2127538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2127511_2128207_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2129021_2129393_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2129450_2130278_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2130414_2130954_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2131024_2131255_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2131251_2131767_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2131763_2132381_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2132377_2133211_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2133214_2133784_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2133808_2134051_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2134052_2135042_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2135333_2136131_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2136502_2136793_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2137440_2137914_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2139537:2139552	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP043399	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. GXS275 chromosome, complete genome	4870694	2223908	2234414	4870694		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2223908_2225222_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2225248_2226328_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2226332_2227106_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2227102_2228095_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2228100_2228652_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2228652_2229531_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2229578_2230478_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2230477_2231563_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2231939_2232833_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2233010_2234414_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP043399	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. GXS275 chromosome, complete genome	4870694	2302722	2311893	4870694	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2302722_2304756_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2304996_2305455_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2305626_2306157_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2306213_2306681_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2306727_2307447_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2307443_2309129_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2309351_2310083_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2310142_2310250_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2310230_2310962_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2310945_2311893_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP043399	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. GXS275 chromosome, complete genome	4870694	2331300	2397695	4870694	tail,lysis,holin	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2331300_2331996_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2332149_2333034_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2333210_2333930_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2333926_2334172_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2334376_2335618_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2335611_2336847_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2336921_2337932_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2337947_2339468_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2339601_2340600_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2341098_2342121_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2342270_2343413_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2343427_2344096_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2344425_2345283_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2345271_2345661_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2345665_2347033_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2347249_2348137_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2348169_2349492_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2349535_2351527_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2351871_2353341_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2353530_2354394_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2354514_2355564_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2355642_2356500_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2356564_2358253_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2358269_2359208_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2359207_2360338_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2360706_2361888_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2361952_2362618_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2362619_2362742_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2363129_2363384_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2363707_2364280_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2364492_2365479_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2365508_2366228_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2366641_2367214_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2367539_2369096_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2369202_2371008_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2371017_2372112_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2372111_2373137_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2373138_2374728_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2374731_2375076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2375466_2376657_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2376684_2377380_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2377531_2379292_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2379416_2379701_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2379809_2380430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2380457_2381465_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2381644_2381872_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2381903_2383664_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2383944_2384448_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2384475_2384766_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2385113_2386943_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2386996_2387440_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2387817_2388345_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2388347_2389589_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2390181_2390511_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2390807_2392139_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2392167_2392536_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_014344510.1|2392550_2393540_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.4e-190
WP_001115840.1|2393868_2396235_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2396403_2396607_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2396903_2397695_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP043399	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. GXS275 chromosome, complete genome	4870694	2736568	2838038	4870694	integrase,holin,protease,capsid,head,transposase,tRNA,terminase,tail,lysis,portal	Salmonella_phage(36.07%)	110	2762712:2762727	2833127:2833142
WP_000940032.1|2736568_2737300_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2737418_2738222_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2738366_2739245_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2739426_2740470_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2740473_2741292_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2741302_2742316_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2742316_2743303_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2743293_2743932_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2744057_2745335_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2745329_2746469_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2746664_2747918_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2748242_2749433_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2749614_2751159_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2751519_2752851_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2752933_2755078_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2755133_2756594_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2756642_2756981_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2757057_2758395_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2758391_2759156_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2759157_2760588_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970045.1|2761237_2765125_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2762712:2762727	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2765146_2765380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734258.1|2765380_2766925_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2766975_2767527_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2767551_2768187_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2768190_2769552_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2769562_2770456_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2770571_2771420_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2771458_2772376_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2772397_2773594_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2773709_2774636_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2774673_2774934_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2775045_2775426_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2775425_2776157_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2776168_2776897_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2776908_2777814_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2777810_2778491_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2778764_2779739_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2779755_2781555_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2781959_2783453_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2783931_2784069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2784781_2784946_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2785525_2785591_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2785653_2785866_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2785972_2786200_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2786296_2786875_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2786864_2787689_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2787685_2790058_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2790111_2790354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2790392_2793755_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2793816_2794464_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2794361_2795099_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2795105_2795804_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2795813_2796143_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2796145_2799241_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2799212_2799551_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2799547_2799943_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2799993_2800740_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2800747_2801149_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_149100644.1|2801257_2802388_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.5	5.0e-216
WP_149100642.1|2802436_2803015_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	6.3e-82
WP_000083294.1|2803042_2803426_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_149100641.1|2803436_2803802_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2803859_2804888_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2804942_2805290_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_149100645.1|2805302_2806799_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.4	4.8e-97
WP_149100639.1|2806788_2808369_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	7.3e-189
WP_000201415.1|2808365_2808569_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2808552_2810484_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2810455_2811001_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2811287_2811689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2811924_2812377_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2812394_2812847_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2812830_2813160_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2813435_2814122_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2814336_2814525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2815031_2815595_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_072095218.1|2815685_2815871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097241.1|2815867_2816545_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2816541_2816682_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2816678_2817290_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001241017.1|2817292_2817499_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_000929791.1|2817498_2818101_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2818135_2818384_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2818500_2818734_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2818976_2819609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2819716_2820415_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801764.1|2820428_2821124_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000024044.1|2821120_2822005_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_010835408.1|2822096_2822471_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2822430_2822673_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2822772_2823168_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2823226_2824066_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2824058_2824445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2824444_2825107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2825563_2825722_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2825743_2826094_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2826220_2829148_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2829110_2830268_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2830310_2830550_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2830590_2830875_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2830852_2832082_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2832579_2833059_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2833055_2834012_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2833127:2833142	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2834011_2834662_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2834693_2835269_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2835265_2835430_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|2835429_2835609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000989177.1|2835693_2837316_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2837300_2838038_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP043399	Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S substr. GXS275 chromosome, complete genome	4870694	4431885	4452305	4870694	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4431885_4432614_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4432810_4433101_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4433349_4433805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4433801_4434407_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4434411_4436157_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4436159_4436792_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4436784_4437900_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4437890_4438250_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4438413_4439961_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4439960_4440890_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4440886_4441249_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4441576_4442299_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4442308_4443352_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4443339_4443549_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4443548_4444502_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4444501_4446856_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4446952_4447081_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4447040_4447358_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4447409_4447934_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4447933_4449361_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4449350_4449548_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4449544_4450000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4450159_4450474_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270440.1|4450486_4451092_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_001226442.1|4451094_4451382_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4451957_4452305_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
