The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	945929	992500	4158695	protease,transposase	Organic_Lake_phycodnavirus(100.0%)	29	NA	NA
WP_004247335.1|945929_947405_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_104836276.1|947981_950045_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_149127364.1|950261_952226_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_149127806.1|952563_954543_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_149127365.1|954849_956787_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_004244894.1|957251_958136_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064506156.1|958129_959386_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_149127366.1|959754_961140_-	porin	NA	NA	NA	NA	NA
WP_149127367.1|961194_961839_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_149127368.1|961831_964549_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_063109177.1|964574_965996_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_004247347.1|966114_967083_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_004244872.1|968339_969197_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244871.1|969170_969962_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244870.1|970603_970909_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_149127369.1|970991_977915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001985440.1|978019_979273_+	TolC family protein	NA	NA	NA	NA	NA
WP_041701033.1|979297_981463_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.5	4.7e-29
WP_001985443.1|981478_982738_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_112843129.1|983006_983684_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112843193.1|983813_985142_-	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_020945294.1|985205_987368_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_107034653.1|987741_987849_-	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_064505954.1|988207_988948_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_104836282.1|988984_989563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063108912.1|989566_989836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149127370.1|990359_991241_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_064505950.1|991296_991554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836283.1|992212_992500_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	1196387	1207742	4158695		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004246075.1|1196387_1197587_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_149127390.1|1198195_1199164_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_075206322.1|1199189_1201316_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.2e-205
WP_149127391.1|1201344_1201749_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	1.8e-11
WP_004246071.1|1201760_1201985_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_017827772.1|1202266_1202740_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1202937_1203147_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246058.1|1203605_1203980_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1203995_1204961_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1205062_1205707_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1206068_1206332_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1206530_1207742_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 3
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	1407652	1486565	4158695	plate,tRNA,protease	Bacillus_phage(17.65%)	58	NA	NA
WP_004244558.1|1407652_1407967_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1407997_1410292_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1410411_1410630_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_036908220.1|1410949_1411642_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_112843271.1|1411643_1413395_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	3.0e-18
WP_020945408.1|1413397_1415167_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004252032.1|1415308_1416268_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	3.4e-64
WP_004244566.1|1416810_1417305_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_149127413.1|1417432_1421221_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1421333_1421939_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1421949_1423299_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|1423432_1424722_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004252020.1|1424901_1425234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945410.1|1425632_1426682_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_049197238.1|1426754_1427660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1428019_1428760_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1428867_1431150_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_049197240.1|1431204_1432059_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_036894537.1|1432729_1434487_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_046335158.1|1434714_1435752_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_149127414.1|1435826_1437086_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_020945415.1|1437222_1438653_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.6	3.4e-07
WP_149127415.1|1438789_1439878_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	3.4e-84
WP_004252010.1|1440074_1441361_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_020945417.1|1441649_1442327_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_149127416.1|1442508_1444182_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1444246_1444534_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_149127417.1|1444934_1447304_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.7	4.7e-22
WP_004244589.1|1447340_1449086_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_012367713.1|1449082_1450084_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1450579_1450795_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1451209_1451389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1451393_1452155_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_149127418.1|1452278_1453109_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|1453488_1454262_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1454271_1455594_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1455574_1456306_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_149127419.1|1456302_1460760_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_049197252.1|1461041_1461695_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.9	3.1e-101
WP_041701075.1|1462101_1462815_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_149127420.1|1463157_1464873_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1465204_1465753_+	YcbK family protein	NA	NA	NA	NA	NA
WP_049213546.1|1465802_1466453_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1466545_1467019_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|1467109_1468846_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_049221421.1|1468838_1470194_-	membrane protein	NA	NA	NA	NA	NA
WP_004244610.1|1470231_1473780_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_149127421.1|1473782_1475246_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_149127422.1|1475251_1475902_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1475903_1476692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149127423.1|1476695_1479407_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	3.8e-84
WP_004244617.1|1479415_1480171_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_017628433.1|1480163_1481531_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1481523_1482075_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1482076_1483345_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|1483349_1484387_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_046334530.1|1484350_1486126_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|1486133_1486565_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	1562672	1601874	4158695	lysis,portal,terminase,tail,protease,capsid,head	Morganella_phage(27.91%)	52	NA	NA
WP_004247034.1|1562672_1563086_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	40.3	1.4e-19
WP_004247035.1|1563132_1563318_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	52.5	1.4e-11
WP_049208654.1|1564756_1565308_-	phage protein	NA	NA	NA	NA	NA
WP_149127438.1|1565411_1565687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074924370.1|1566079_1567261_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.0	1.2e-29
WP_049219192.1|1567262_1567469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149127439.1|1567545_1568022_-	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.7	1.6e-70
WP_149127440.1|1568005_1568506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497316.1|1568498_1568768_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	55.1	1.8e-15
WP_064497315.1|1568767_1569082_-	hypothetical protein	NA	A0A1W5PTP2	Pseudoalteromonas_phage	34.3	5.6e-08
WP_149127808.1|1569084_1569264_-	hypothetical protein	NA	A0A1P8DTH9	Proteus_phage	98.2	5.2e-27
WP_149127441.1|1569297_1569795_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	66.1	7.0e-45
WP_149127442.1|1569853_1570681_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	57.3	4.5e-81
WP_149127443.1|1570746_1571121_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	70.6	7.1e-42
WP_149127444.1|1571144_1571327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149127445.1|1571458_1571662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049211705.1|1571809_1572499_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	58.5	6.6e-70
WP_049210565.1|1572596_1572812_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	45.1	2.9e-08
WP_071425561.1|1572868_1573327_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	46.1	2.1e-27
WP_036904897.1|1573584_1573764_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.9	8.1e-12
WP_149127446.1|1573773_1574892_+	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	58.2	3.6e-49
WP_064506368.1|1574891_1575530_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	66.0	7.5e-84
WP_149127447.1|1575526_1575922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049255030.1|1576096_1576900_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	63.1	1.5e-89
WP_149127448.1|1576896_1577922_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.7	2.2e-85
WP_036901017.1|1577949_1578630_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	50.5	3.3e-53
WP_126656782.1|1578806_1578986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149127449.1|1579053_1580076_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	69.5	8.2e-133
WP_004250558.1|1580337_1580607_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_149127450.1|1580606_1581077_+	glycoside hydrolase family protein	NA	A0A1W6JNW4	Morganella_phage	59.9	2.3e-50
WP_141192328.1|1581219_1581681_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	36.1	5.0e-13
WP_149127451.1|1582199_1582703_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	71.7	1.5e-39
WP_087741133.1|1582763_1583114_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	95.6	2.4e-60
WP_149127452.1|1583110_1583308_+	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	87.7	8.3e-26
WP_149127453.1|1583456_1583927_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	80.8	6.5e-69
WP_064506379.1|1583930_1585664_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	98.4	0.0e+00
WP_036905261.1|1585811_1587041_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	87.8	4.8e-212
WP_036905264.1|1587030_1587636_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	5.3e-87
WP_064506418.1|1587651_1588881_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	82.0	2.9e-185
WP_026164628.1|1588966_1589269_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	70.0	6.8e-35
WP_080749322.1|1589275_1589602_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	44.5	2.6e-16
WP_017827270.1|1589588_1589978_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	1.0e-30
WP_149127454.1|1589974_1590379_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	56.5	9.4e-32
WP_060961287.1|1590401_1590878_+|tail	phage tail protein	tail	Q7Y403	Yersinia_phage	75.5	1.2e-57
WP_149127455.1|1590877_1591234_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	40.0	4.1e-15
WP_149127456.1|1591483_1594786_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	44.2	7.8e-193
WP_149127457.1|1594786_1595386_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	55.4	3.1e-55
WP_149127458.1|1595382_1595964_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	1.6e-48
WP_149127459.1|1595991_1596609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036901068.1|1596671_1597070_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.0	2.7e-31
WP_149127460.1|1597070_1600502_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.7	5.1e-187
WP_149127461.1|1600518_1601874_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	59.6	1.5e-118
>prophage 5
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	1680712	1715282	4158695	tRNA,integrase,lysis,portal,terminase,tail,protease,capsid,head	Morganella_phage(19.35%)	48	1674816:1674832	1721835:1721851
1674816:1674832	attL	TATTTATCAAATGATAA	NA	NA	NA	NA
WP_004247117.1|1680712_1681816_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1681921_1682374_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|1682366_1682996_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|1683134_1684388_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_004251675.1|1684508_1685636_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.6	3.7e-126
WP_004251672.1|1685616_1685859_-	excisionase	NA	NA	NA	NA	NA
WP_004247124.1|1685920_1686451_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004247125.1|1686507_1687335_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247126.1|1687400_1687775_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247127.1|1687798_1687981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247128.1|1688423_1688906_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247129.1|1689009_1689249_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004247130.1|1689333_1689792_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
WP_004247131.1|1689881_1690091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247132.1|1690080_1690260_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
WP_132587572.1|1690272_1691364_+	replication protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_071425535.1|1691535_1692243_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.3	2.1e-55
WP_004247135.1|1692242_1693268_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247136.1|1693295_1693694_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247137.1|1694036_1694249_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247148.1|1694650_1695172_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|1695495_1695831_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_071425729.1|1695934_1696861_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_036908073.1|1697277_1697706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894738.1|1697858_1698110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905789.1|1698553_1698823_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_036900946.1|1698822_1699293_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_036905787.1|1699435_1699897_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_001967215.1|1700793_1701132_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905782.1|1701134_1701347_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
WP_017628364.1|1701470_1701938_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	1.6e-43
WP_017628363.1|1701891_1703625_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_017628362.1|1703624_1704893_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|1704910_1705579_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|1705582_1706749_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|1706787_1707087_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|1707086_1707416_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_017628358.1|1707405_1707879_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	8.2e-11
WP_017628357.1|1707884_1708226_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|1708235_1708901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|1708965_1709382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|1709378_1709657_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1709681_1709873_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628353.1|1709999_1713275_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|1713275_1713872_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|1713871_1714453_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|1714469_1714805_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|1714883_1715282_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
1721835:1721851	attR	TATTTATCAAATGATAA	NA	NA	NA	NA
>prophage 6
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	2000667	2010659	4158695		Escherichia_phage(66.67%)	8	NA	NA
WP_017628120.1|2000667_2002725_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
WP_004248043.1|2002736_2004437_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|2004772_2005459_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|2005458_2005920_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|2005972_2006584_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_004242891.1|2006723_2007584_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_004242892.1|2007585_2008203_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_020945635.1|2008214_2010659_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	3.3e-220
>prophage 7
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	2540845	2559735	4158695	lysis,holin	Escherichia_phage(21.43%)	21	NA	NA
WP_126656697.1|2540845_2543284_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	3.8e-261
WP_004243609.1|2543295_2543913_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2543916_2544693_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_149127569.1|2544808_2545351_-	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	4.2e-19
WP_017628013.1|2545919_2546099_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_149127570.1|2547499_2548156_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_036907817.1|2548152_2549340_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	8.5e-73
WP_004243617.1|2549332_2549677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250721.1|2549673_2550366_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2550368_2551181_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2551149_2551470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243624.1|2551482_2551971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149127571.1|2551973_2554277_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
WP_004243627.1|2554359_2554818_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|2554877_2555330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945912.1|2555340_2556828_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_012368090.1|2556836_2557349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907811.1|2557385_2557835_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004243635.1|2557831_2558236_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.8	3.8e-25
WP_004248367.1|2558238_2558538_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_020945914.1|2558919_2559735_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
>prophage 8
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	3062082	3130781	4158695	integrase,tRNA,lysis,holin,terminase,tail,head	Morganella_phage(26.47%)	97	3077897:3077943	3126390:3126436
WP_052715531.1|3062082_3065313_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	42.0	1.8e-101
WP_036918873.1|3065329_3065671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|3065670_3065844_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036918875.1|3066015_3066528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043103.1|3067512_3070233_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.1	0.0e+00
WP_046334700.1|3070229_3070574_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.1	1.4e-44
WP_052715532.1|3070588_3071185_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.2	6.4e-29
WP_036900272.1|3071184_3071379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334701.1|3071548_3072160_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_036907509.1|3072156_3072366_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_036918882.1|3072362_3072542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334702.1|3072538_3072796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072052191.1|3072798_3072972_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_080942627.1|3072964_3073906_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	50.0	3.3e-64
WP_046334703.1|3073902_3074736_-	antA/AntB antirepressor family protein	NA	A0A088CBR4	Shigella_phage	46.1	1.4e-21
WP_036918890.1|3074748_3075144_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	2.1e-28
WP_036918892.1|3075143_3075341_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	46.3	2.3e-07
WP_046334704.1|3076521_3077733_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
3077897:3077943	attL	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_063691743.1|3078117_3078348_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	93.4	5.3e-32
WP_149127641.1|3078400_3079708_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.1	2.1e-112
WP_149127642.1|3079724_3083507_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	63.1	0.0e+00
WP_049199070.1|3083506_3084073_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	1.4e-49
WP_149127643.1|3084009_3084729_-|tail	phage tail protein	tail	A0A1W6JNU8	Morganella_phage	74.5	4.8e-111
WP_149127644.1|3084732_3085431_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.6	3.1e-115
WP_149127645.1|3085427_3085757_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	74.3	1.1e-43
WP_103004656.1|3085902_3086160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149127646.1|3086156_3086363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149127647.1|3086378_3089732_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	46.8	9.7e-215
WP_149127648.1|3089798_3090182_-	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	47.8	1.1e-05
WP_149127816.1|3090245_3090518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099659173.1|3090600_3090945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556276.1|3090941_3091199_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_149127649.1|3091312_3091474_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_149127650.1|3092373_3093066_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.5	9.0e-91
WP_149127651.1|3093115_3093871_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	80.5	8.8e-108
WP_149127652.1|3093935_3094304_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	3.7e-11
WP_066747477.1|3094300_3094672_-	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	65.9	5.0e-40
WP_004247766.1|3094673_3095015_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	52.4	9.4e-25
WP_094960238.1|3095014_3095413_-	hypothetical protein	NA	I6S619	Salmonella_phage	78.8	2.7e-55
WP_094960239.1|3095469_3095643_-	glycoprotein	NA	I6R9A3	Salmonella_phage	50.0	1.2e-07
WP_004247762.1|3095652_3096747_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.9	2.0e-145
WP_149127653.1|3096763_3097201_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	68.5	1.5e-46
WP_149127654.1|3097200_3098475_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	64.4	8.1e-154
WP_149127655.1|3098478_3099408_-|head	phage head morphogenesis protein	head	A0A1V0E5Q2	Salmonella_phage	55.7	2.7e-90
WP_149127656.1|3099358_3100714_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	63.8	1.1e-161
WP_149127657.1|3100713_3101958_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	73.8	1.2e-186
WP_149127658.1|3101938_3102361_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	61.7	2.6e-32
WP_004247755.1|3102377_3102560_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	74.1	6.3e-20
WP_049257606.1|3102756_3103020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149127659.1|3103053_3103293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149127660.1|3103357_3103888_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	57.0	5.3e-51
WP_001966798.1|3104323_3104515_-	hypothetical protein	NA	A0A0U4ISD3	Pseudomonas_phage	54.1	7.3e-11
WP_149127661.1|3104743_3105196_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	66.9	2.9e-34
WP_149127662.1|3105192_3105585_-	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	97.9	9.7e-50
WP_109391054.1|3105577_3105895_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	97.1	2.3e-54
WP_149127663.1|3106375_3106990_-	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	48.1	3.6e-43
WP_149127664.1|3106986_3107178_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	92.1	3.3e-27
WP_149127665.1|3107177_3107798_-	hypothetical protein	NA	A0A2I7RAC0	Vibrio_phage	54.1	9.3e-47
WP_149127666.1|3108071_3108365_-	hypothetical protein	NA	O64345	Escherichia_phage	36.5	3.4e-07
WP_149127667.1|3108361_3108802_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	65.5	4.0e-44
WP_149127668.1|3108923_3109148_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	1.4e-24
WP_149127669.1|3109144_3109588_-	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	93.2	6.4e-34
WP_049199114.1|3109597_3109807_-	hypothetical protein	NA	A0A1X9Y878	Proteus_phage	70.3	1.2e-22
WP_063073731.1|3109923_3110217_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	1.5e-18
WP_124743660.1|3110280_3110667_-	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	52.8	3.8e-30
WP_107336918.1|3110686_3110917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149127817.1|3110934_3111609_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	86.2	8.4e-110
WP_063073728.1|3112290_3112695_-	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	36.6	8.2e-12
WP_063073727.1|3112649_3113333_-	antirepressor	NA	A0A1P8DTE1	Proteus_phage	93.4	1.8e-112
WP_063073726.1|3113354_3113687_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	99.1	3.5e-53
WP_070486794.1|3113830_3114058_-	DNA-binding protein	NA	G9L677	Escherichia_phage	62.2	6.0e-20
WP_149127670.1|3114137_3114815_+	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	54.9	5.4e-56
WP_149127671.1|3115052_3115397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049200766.1|3116072_3116384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220845.1|3116398_3116635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071233777.1|3116606_3116888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049199141.1|3117054_3117330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149127672.1|3117446_3118388_+	cell envelope biogenesis protein TolA	NA	A0A2I7R804	Vibrio_phage	47.2	2.3e-20
WP_063073719.1|3118606_3118861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049199148.1|3118857_3119079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073718.1|3119075_3120002_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.6	1.2e-109
WP_049206325.1|3120041_3120662_+	hypothetical protein	NA	A0A068CBG2	Acinetobacter_phage	45.9	1.2e-25
WP_149127673.1|3120654_3121356_+	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	57.7	8.0e-71
WP_149127674.1|3121345_3121885_+	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	63.1	3.9e-57
WP_149127675.1|3121900_3122188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121909455.1|3122242_3122407_+	hook protein	NA	NA	NA	NA	NA
WP_063108484.1|3122435_3122615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149127818.1|3122624_3123158_+	DUF2384 domain-containing protein	NA	A0A1W5PTP2	Pseudoalteromonas_phage	30.9	1.3e-12
WP_058336149.1|3123157_3123511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149127676.1|3123823_3124165_+	DUF2591 family protein	NA	A0A1P8DTH6	Proteus_phage	67.9	1.8e-31
WP_149127677.1|3124154_3124700_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	62.6	7.1e-59
WP_135091701.1|3124784_3124979_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	92.2	3.5e-29
WP_149127678.1|3125212_3126370_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4R586	Salmonella_phage	74.9	6.8e-176
WP_004244243.1|3126658_3127531_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
3126390:3126436	attR	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004244244.1|3127534_3127747_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004244246.1|3128382_3129324_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004244247.1|3129389_3130781_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
>prophage 9
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	3389742	3398610	4158695		Caulobacter_phage(50.0%)	9	NA	NA
WP_041701270.1|3389742_3391311_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3391711_3392392_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3392488_3393064_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3393140_3393719_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3393786_3394812_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3394846_3395302_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_149127712.1|3395326_3396487_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004250201.1|3396487_3397072_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017827550.1|3397464_3398610_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
>prophage 10
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	4040264	4097356	4158695	tRNA,protease,transposase	Escherichia_phage(44.44%)	49	NA	NA
WP_060554972.1|4040264_4040849_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004246555.1|4040943_4041855_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_110706844.1|4043297_4043693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149127795.1|4043840_4045955_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_149127796.1|4045957_4048306_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_004249969.1|4048316_4052003_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_004246549.1|4052018_4052489_+	cellulose biosynthesis protein	NA	NA	NA	NA	NA
WP_149127797.1|4052527_4053433_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_020946490.1|4053606_4054569_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.1	8.7e-60
WP_041701443.1|4054642_4055680_+	endoglucanase	NA	NA	NA	NA	NA
WP_143475488.1|4055818_4057468_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_020946492.1|4057576_4059439_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	1.1e-13
WP_041701446.1|4059435_4060827_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_149127798.1|4060842_4061763_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_004246538.1|4061961_4062618_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004246537.1|4062614_4063553_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_080749536.1|4063564_4066612_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_004246534.1|4066791_4067622_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_004246527.1|4067781_4068657_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_004246526.1|4068948_4069491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246525.1|4069705_4070677_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_004249779.1|4070801_4071689_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012368631.1|4072103_4072904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126656857.1|4073078_4074431_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_149127799.1|4074475_4077553_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_110706833.1|4077580_4078384_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_149127825.1|4078437_4080303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246518.1|4080430_4081360_-	phosphoesterase	NA	NA	NA	NA	NA
WP_004249773.1|4081544_4082009_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001145449.1|4082544_4083174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150667.1|4083306_4083480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|4083521_4084286_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001297012.1|4084373_4084487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|4084792_4085293_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|4085311_4085491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|4085420_4086260_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4086253_4086601_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067855.1|4086741_4087446_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012512979.1|4087436_4087616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001235713.1|4087761_4088319_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|4088501_4089362_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_149127800.1|4089620_4090097_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_011091028.1|4090143_4091019_-	class A extended-spectrum beta-lactamase CTX-M-3	NA	A0A1B0VBP7	Salmonella_phage	82.1	5.4e-125
WP_001067855.1|4091454_4092159_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|4092544_4092961_+	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
WP_014839979.1|4092965_4093484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|4093483_4094272_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|4094771_4095476_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|4097113_4097356_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP043332	Proteus mirabilis strain CRPM10 chromosome, complete genome	4158695	4109012	4117186	4158695	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_000052512.1|4109012_4110488_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_001067855.1|4110937_4111642_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|4112192_4112897_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4113086_4113902_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4114052_4114757_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|4114900_4115455_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|4115585_4116416_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|4116553_4117186_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
