The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043307	Acinetobacter johnsonii strain Acsw19 chromosome, complete genome	3433749	905568	911785	3433749		Acinetobacter_phage(83.33%)	7	NA	NA
WP_010327245.1|905568_906945_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.4	5.3e-18
WP_010327244.1|907001_907361_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_171054237.1|907447_907996_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	94.0	4.9e-92
WP_148825677.1|908089_908776_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	74.2	3.0e-86
WP_062034010.1|909323_910130_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	83.2	3.9e-122
WP_004695696.1|910146_911193_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	84.5	1.7e-162
WP_171056750.1|911209_911785_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	93.2	3.8e-103
>prophage 2
NZ_CP043307	Acinetobacter johnsonii strain Acsw19 chromosome, complete genome	3433749	1157914	1168979	3433749		Tetraselmis_virus(14.29%)	12	NA	NA
WP_058869901.1|1157914_1158892_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.1	9.5e-38
WP_004982122.1|1158895_1159435_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_148825793.1|1159469_1160012_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_148825794.1|1160001_1160568_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_004696348.1|1160567_1161314_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.2	1.1e-20
WP_148825795.1|1161560_1162157_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.8	3.7e-24
WP_148825796.1|1162149_1162761_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	50.8	2.0e-09
WP_004696353.1|1162889_1163732_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	3.8e-35
WP_062033552.1|1163873_1164539_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	37.3	7.9e-28
WP_148825797.1|1164672_1165392_-	peptidase M15	NA	NA	NA	NA	NA
WP_004696359.1|1165524_1165848_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_148825798.1|1166345_1168979_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.8	6.6e-33
>prophage 3
NZ_CP043307	Acinetobacter johnsonii strain Acsw19 chromosome, complete genome	3433749	1295460	1355440	3433749	protease,transposase,holin	Staphylococcus_phage(10.0%)	57	NA	NA
WP_148825229.1|1295460_1296765_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004696602.1|1297022_1297289_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_148825863.1|1297502_1298168_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_062033117.1|1298176_1298689_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_148825864.1|1298738_1299518_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_148825865.1|1299675_1300587_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_058869883.1|1300609_1301149_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094148191.1|1301319_1303344_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_004981883.1|1303535_1303949_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_148825866.1|1304030_1305107_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_148825867.1|1305184_1306354_-	MFS transporter	NA	NA	NA	NA	NA
WP_148825868.1|1306362_1307169_-	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	36.2	5.4e-39
WP_094148194.1|1307279_1308170_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148825869.1|1308230_1308632_-	internalin	NA	NA	NA	NA	NA
WP_148825870.1|1308858_1310499_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.6	3.1e-150
WP_005401052.1|1310530_1311388_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.2	5.6e-50
WP_094148196.1|1311448_1312738_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.9	1.2e-136
WP_005401054.1|1312751_1313147_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_094148197.1|1313106_1313826_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004696637.1|1313940_1315077_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_094148198.1|1315158_1315644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148825871.1|1315700_1316975_-	MFS transporter	NA	NA	NA	NA	NA
WP_148825872.1|1317048_1318683_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_148825873.1|1319174_1320839_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	29.5	2.2e-50
WP_148825874.1|1320959_1322432_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_148825875.1|1322424_1323051_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_148825876.1|1323598_1325659_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.9	3.8e-20
WP_004981851.1|1325671_1326286_+	MarC family protein	NA	NA	NA	NA	NA
WP_004696655.1|1326340_1326643_-	cyd operon YbgE family protein	NA	NA	NA	NA	NA
WP_002120988.1|1326646_1326748_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_004981849.1|1326772_1327918_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004696658.1|1327914_1329495_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_148825877.1|1329494_1329686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148825878.1|1330392_1331010_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_010326961.1|1331028_1331340_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_148827078.1|1331354_1332359_-	adenosine kinase	NA	NA	NA	NA	NA
WP_004696669.1|1332498_1332948_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171522825.1|1333092_1336047_+	insulinase family protein	NA	NA	NA	NA	NA
WP_005401069.1|1336064_1337204_+	phospholipase A	NA	NA	NA	NA	NA
WP_010326956.1|1337266_1338616_-	potassium transporter TrkH	NA	NA	NA	NA	NA
WP_004981828.1|1338612_1339266_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_148825880.1|1339416_1339911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004696682.1|1339951_1341490_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_148825881.1|1341597_1342269_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_148825882.1|1342396_1343080_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_171522869.1|1343261_1344374_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	7.8e-20
WP_171522870.1|1344481_1345537_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_004696694.1|1345616_1346363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004981811.1|1346380_1346797_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.2	3.4e-13
WP_148825885.1|1346807_1349084_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.7	2.1e-165
WP_005401079.1|1349171_1349525_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.6	1.4e-26
WP_004696701.1|1349552_1350026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148825886.1|1350116_1351037_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_148825887.1|1351158_1351809_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004696708.1|1352055_1352940_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_148825888.1|1352942_1354079_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_148825229.1|1354135_1355440_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP043307	Acinetobacter johnsonii strain Acsw19 chromosome, complete genome	3433749	1735193	1772547	3433749	protease,portal,tail,head,terminase,integrase	uncultured_Caudovirales_phage(40.74%)	53	1745136:1745151	1774930:1774945
WP_125274655.1|1735193_1735490_-	anaerobic dehydrogenase	NA	A0A1B2IBL3	Erwinia_phage	41.4	6.2e-17
WP_148826114.1|1735490_1736000_-	glycoside hydrolase family protein	NA	A0A0B5L5F7	Acinetobacter_phage	57.4	7.6e-47
WP_148826115.1|1735989_1736271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826116.1|1736498_1738214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826117.1|1738272_1741143_-	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	33.5	1.1e-126
WP_148826118.1|1741139_1741457_-	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	31.1	5.1e-09
WP_148826119.1|1741456_1741933_-	DUF1833 family protein	NA	A0A1B1P9F1	Acinetobacter_phage	36.0	2.9e-24
WP_148826120.1|1741925_1742414_-	hypothetical protein	NA	A0A1B1P9F0	Acinetobacter_phage	31.5	3.4e-12
WP_148826121.1|1742470_1742707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826122.1|1742709_1746381_-	transglycosylase SLT domain-containing protein	NA	A0A2H4JDA4	uncultured_Caudovirales_phage	35.1	6.8e-153
1745136:1745151	attL	GCTGAAGAGTATTTAA	NA	NA	NA	NA
WP_148826123.1|1747416_1747950_-|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_004694098.1|1747959_1748430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826124.1|1748496_1748853_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_148826125.1|1749642_1749948_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	99.0	1.2e-50
WP_148826126.1|1751371_1752031_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	84.1	2.8e-102
WP_148826127.1|1752023_1753259_-|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	97.8	1.1e-235
WP_148826128.1|1753255_1754950_-|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	94.3	1.8e-310
WP_148826129.1|1755292_1755955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826130.1|1756030_1756483_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	98.0	2.4e-76
WP_171522827.1|1756588_1756744_-	hypothetical protein	NA	A0A2I7QLK0	Vibrio_phage	60.0	9.8e-06
WP_148826131.1|1756740_1757031_-	HNH endonuclease	NA	A0A0R6PHK1	Moraxella_phage	58.1	6.1e-25
WP_171522828.1|1757033_1757210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171522829.1|1757261_1757435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826133.1|1757514_1757754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148827083.1|1758041_1758188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826134.1|1758206_1758824_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_148826135.1|1758960_1759374_-	antitermination protein	NA	NA	NA	NA	NA
WP_148826136.1|1759384_1759819_-	hypothetical protein	NA	G3EN88	Psychrobacter_phage	41.8	1.6e-21
WP_148826137.1|1759811_1760090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826138.1|1760086_1760485_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	A0A2H4J558	uncultured_Caudovirales_phage	82.4	4.9e-09
WP_148826139.1|1760640_1761129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826140.1|1761125_1761734_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_148826141.1|1761730_1762573_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	55.1	5.5e-58
WP_148826142.1|1762569_1763301_-	phage antirepressor KilAC domain-containing protein	NA	G3EN85	Psychrobacter_phage	37.6	1.8e-28
WP_010326039.1|1763347_1763848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326038.1|1763915_1764146_-	helix-turn-helix domain-containing protein	NA	A0A0R6PJ81	Moraxella_phage	53.7	1.0e-14
WP_148827084.1|1764147_1764930_+	peptidase S24	NA	A0A0R6PJ00	Moraxella_phage	41.0	7.6e-30
WP_148826143.1|1765672_1766044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826144.1|1766085_1766967_+	DUF2303 family protein	NA	A0A142KC52	Gordonia_phage	24.6	1.4e-08
WP_005400136.1|1767049_1767322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004694173.1|1767330_1767591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062034570.1|1767590_1767836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826145.1|1767837_1768428_+	HNH endonuclease	NA	A0A2H4JIA5	uncultured_Caudovirales_phage	31.6	4.1e-20
WP_148827085.1|1768496_1768772_+	hypothetical protein	NA	I2GUB3	Acinetobacter_phage	45.9	5.8e-09
WP_148826146.1|1768764_1768989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826147.1|1768981_1769299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826148.1|1769295_1769583_+	hypothetical protein	NA	A0A2H4J8T6	uncultured_Caudovirales_phage	41.4	2.5e-10
WP_058952524.1|1769582_1769867_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_058952057.1|1769863_1770883_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	41.9	9.8e-70
WP_010326624.1|1771165_1771534_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	35.4	2.6e-12
WP_148826149.1|1771578_1771929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826150.1|1771939_1772221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004979945.1|1772235_1772547_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.1	2.9e-17
1774930:1774945	attR	TTAAATACTCTTCAGC	NA	NA	NA	NA
>prophage 5
NZ_CP043307	Acinetobacter johnsonii strain Acsw19 chromosome, complete genome	3433749	2019844	2025829	3433749	terminase,capsid	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_148826312.1|2019844_2021047_-|capsid	minor capsid protein	capsid	B7SDN5	Haemophilus_phage	37.2	1.3e-23
WP_148826313.1|2021047_2022514_-	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	68.8	9.2e-194
WP_148826314.1|2022526_2024203_-|terminase	terminase	terminase	A0A2H4JGD8	uncultured_Caudovirales_phage	91.4	0.0e+00
WP_148826315.1|2024199_2024706_-	DUF2280 domain-containing protein	NA	A0A2H4JI35	uncultured_Caudovirales_phage	75.0	2.2e-62
WP_148826316.1|2024751_2025393_-	hypothetical protein	NA	A0A2H4JE07	uncultured_Caudovirales_phage	83.6	1.8e-106
WP_148826317.1|2025352_2025829_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	64.5	5.6e-52
>prophage 6
NZ_CP043307	Acinetobacter johnsonii strain Acsw19 chromosome, complete genome	3433749	2028855	2045743	3433749	integrase	Acinetobacter_phage(47.06%)	27	2027532:2027548	2043477:2043493
2027532:2027548	attL	CATAAAAAAAGCCTAAT	NA	NA	NA	NA
WP_148826319.1|2028855_2029413_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	61.6	3.7e-63
WP_058869377.1|2029424_2030096_-	metallophosphoesterase	NA	A0A1J0MGN8	Acinetobacter_phage	43.8	8.8e-43
WP_148827090.1|2030100_2030469_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	65.3	1.4e-37
WP_148826320.1|2030501_2030759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826321.1|2030755_2031364_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_148826322.1|2031360_2032203_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	54.2	2.4e-61
WP_148827091.1|2032199_2032868_-	phage antirepressor KilAC domain-containing protein	NA	A0A059VF66	Pseudomonas_phage	35.0	3.5e-23
WP_058869369.1|2033148_2033649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086207688.1|2033707_2033887_-	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	57.6	5.8e-10
WP_148826323.1|2033986_2034715_+	helix-turn-helix domain-containing protein	NA	A0A0P0I8E0	Acinetobacter_phage	54.1	1.7e-63
WP_148826324.1|2034760_2035087_+	hypothetical protein	NA	A0A0D4DCB9	Acinetobacter_phage	56.2	6.2e-26
WP_148826325.1|2035191_2035665_+	hypothetical protein	NA	A0A2H4J8G2	uncultured_Caudovirales_phage	40.4	1.6e-22
WP_148826326.1|2035657_2036428_+	DUF1828 domain-containing protein	NA	A0A2H4JC42	uncultured_Caudovirales_phage	49.8	4.4e-62
WP_115736954.1|2036481_2037183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826327.1|2037471_2037900_+	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	45.7	1.8e-25
WP_125280162.1|2037899_2038208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058869364.1|2038252_2038927_+	hypothetical protein	NA	A0A2D1GLT5	Escherichia_phage	56.2	1.6e-63
WP_148826328.1|2038957_2039695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826329.1|2039707_2040385_+	3'-5' exonuclease	NA	A0A059VJT9	Pseudomonas_phage	40.7	2.0e-34
WP_148826330.1|2040496_2040841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826331.1|2040840_2041083_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	46.8	4.8e-07
WP_148826332.1|2041086_2041686_+	HNH endonuclease	NA	A0A1V0E8E4	Vibrio_phage	34.6	2.3e-18
WP_148826333.1|2041682_2041892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004693796.1|2041888_2042140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826334.1|2042128_2043352_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AWU1	Escherichia_phage	45.1	7.6e-101
WP_010326440.1|2043775_2044252_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
2043477:2043493	attR	CATAAAAAAAGCCTAAT	NA	NA	NA	NA
WP_148826335.1|2044363_2045743_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.9	3.8e-24
>prophage 7
NZ_CP043307	Acinetobacter johnsonii strain Acsw19 chromosome, complete genome	3433749	2504767	2562609	3433749	transposase	Enterobacteria_phage(30.77%)	52	NA	NA
WP_148826576.1|2504767_2505700_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	4.3e-56
WP_148826577.1|2505733_2506060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826578.1|2506371_2507304_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.4	6.7e-57
WP_148827107.1|2507491_2508940_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004981443.1|2508956_2510219_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_148826579.1|2510796_2512299_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	26.3	4.9e-17
WP_058952237.1|2512713_2514159_+	amino acid permease	NA	NA	NA	NA	NA
WP_148826580.1|2514273_2515497_-	heparin lyase I family protein	NA	NA	NA	NA	NA
WP_148826581.1|2517246_2518707_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_039889800.1|2518699_2519704_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004694789.1|2519718_2519841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826582.1|2519920_2521327_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_148826583.1|2521459_2522386_-	HPP family protein	NA	NA	NA	NA	NA
WP_148826584.1|2522404_2523115_-	LrgB family protein	NA	NA	NA	NA	NA
WP_148826585.1|2523524_2525177_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_148826586.1|2525246_2526068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148826587.1|2526363_2526825_-	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_148826588.1|2526933_2527827_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_148826446.1|2528581_2529514_+|transposase	IS5-like element ISAha1 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.8	2.8e-55
WP_171522839.1|2529536_2529824_-|transposase	transposase	transposase	U5P429	Shigella_phage	62.0	4.8e-22
WP_062034202.1|2529937_2530219_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	65.4	2.0e-20
WP_000920558.1|2530555_2530858_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_148826590.1|2531191_2532022_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000842149.1|2532250_2533363_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.1	1.2e-33
WP_005105873.1|2533384_2533660_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_148826591.1|2534127_2535123_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_148826592.1|2535112_2536129_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_148827108.1|2536143_2537043_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048881947.1|2537178_2537919_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_148826593.1|2537992_2538991_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000156169.1|2539011_2539296_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_062034209.1|2542217_2542820_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.9	2.3e-42
WP_148826594.1|2542946_2543735_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_148826595.1|2543731_2544943_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_148826596.1|2545043_2545937_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148826597.1|2546050_2546623_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_148826598.1|2546598_2547096_+	chalcone isomerase family protein	NA	NA	NA	NA	NA
WP_148826599.1|2547107_2547800_+	response regulator	NA	W8CYM9	Bacillus_phage	36.8	9.8e-29
WP_148827109.1|2547796_2549119_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_148826600.1|2549154_2550204_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_148826601.1|2550212_2550992_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_148826602.1|2551016_2552213_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	33.6	9.9e-45
WP_148826603.1|2552209_2553004_-	DUF1365 family protein	NA	NA	NA	NA	NA
WP_062034221.1|2553013_2554297_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_148826604.1|2554293_2555280_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_148826605.1|2555414_2555963_-	lipocalin family protein	NA	A0A2P1EMA7	Moumouvirus	39.0	1.4e-17
WP_148826606.1|2556132_2556906_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_148827110.1|2557289_2558813_+	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	28.9	1.0e-46
WP_081408287.1|2558816_2558951_+	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_058952279.1|2558965_2559220_-	TIGR03643 family protein	NA	NA	NA	NA	NA
WP_148826607.1|2560786_2561674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148826446.1|2561676_2562609_-|transposase	IS5-like element ISAha1 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.8	2.8e-55
>prophage 8
NZ_CP043307	Acinetobacter johnsonii strain Acsw19 chromosome, complete genome	3433749	2776117	2781318	3433749		uncultured_Caudovirales_phage(83.33%)	7	NA	NA
WP_148826713.1|2776117_2777191_-	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	61.3	1.4e-95
WP_148826714.1|2777292_2778246_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.8	1.7e-60
WP_148826715.1|2778263_2778968_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.9	1.3e-92
WP_148826716.1|2778973_2780017_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_148826717.1|2780024_2780498_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.9	8.7e-37
WP_004723201.1|2780504_2780825_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	64.8	9.4e-27
WP_087550548.1|2780883_2781318_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	56.2	8.5e-39
>prophage 9
NZ_CP043307	Acinetobacter johnsonii strain Acsw19 chromosome, complete genome	3433749	2792675	2838865	3433749	tRNA,integrase,transposase,protease	uncultured_virus(10.0%)	38	2782439:2782452	2830096:2830109
2782439:2782452	attL	TCAAAATAAAGAAG	NA	NA	NA	NA
WP_148826723.1|2792675_2793377_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	53.6	4.6e-34
WP_171522843.1|2793373_2793538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148827114.1|2793692_2793989_+	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_148826724.1|2793954_2795091_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	44.0	7.8e-92
WP_148826725.1|2795222_2796245_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_085940648.1|2796617_2797708_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|2797797_2798613_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|2798699_2799002_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|2798895_2799147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|2799177_2800671_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|2800782_2801088_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214119.1|2801115_2802330_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_000480968.1|2802765_2803602_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2803601_2804405_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_085940648.1|2804506_2805596_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_148826726.1|2805906_2807016_-	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_148826727.1|2807115_2807883_-	ThiF family adenylyltransferase	NA	S4VW33	Pandoravirus	30.2	1.2e-16
WP_148826728.1|2807997_2810751_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_171522883.1|2810878_2811694_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_148826730.1|2811706_2812657_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_148826731.1|2812704_2813523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004692398.1|2813614_2815204_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.2	3.6e-10
WP_148826732.1|2815372_2817451_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.9	1.2e-16
WP_010325906.1|2817714_2819910_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	46.1	1.9e-171
WP_148826733.1|2820151_2821168_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_148826734.1|2821326_2822202_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_148826735.1|2822262_2823594_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_148827115.1|2823900_2825166_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.4	1.6e-98
WP_004979078.1|2825775_2826993_+	acetate kinase	NA	NA	NA	NA	NA
WP_148826736.1|2827048_2829190_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_148826737.1|2829871_2830882_+	hypothetical protein	NA	NA	NA	NA	NA
2830096:2830109	attR	TCAAAATAAAGAAG	NA	NA	NA	NA
WP_148826738.1|2831556_2832462_-	EamA family transporter	NA	NA	NA	NA	NA
WP_148827116.1|2832641_2833511_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010325897.1|2833533_2833812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004692421.1|2834495_2836022_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_148826739.1|2836125_2836674_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_148826740.1|2836679_2837396_-	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_010325894.1|2837554_2838865_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.2	6.8e-132
>prophage 1
NZ_CP043309	Acinetobacter johnsonii strain Acsw19 plasmid pAcsw19-2, complete sequence	351885	13126	62451	351885	transposase	Escherichia_phage(28.57%)	44	NA	NA
WP_001067783.1|13126_13831_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	2.3e-118
WP_005093369.1|14142_14919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033917445.1|14918_15485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033917444.1|15486_18870_+	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	26.3	1.9e-37
WP_005093363.1|18968_19724_+	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_005093361.1|19698_20883_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_005093359.1|20876_21350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019838313.1|21778_22672_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019838314.1|22721_24074_-	MFS transporter	NA	NA	NA	NA	NA
WP_033917443.1|24342_25263_-	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_019838315.1|25362_26652_-	salicylate 1-monooxygenase	NA	NA	NA	NA	NA
WP_158660397.1|26852_27749_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020753574.1|28216_29482_+	CmlA/FloR family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	29.0	3.2e-25
WP_020753573.1|29474_30680_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	58.6	4.2e-112
WP_081316864.1|30612_32049_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_019838318.1|32121_33213_+	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.0	2.1e-30
WP_148827133.1|33526_34231_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	83.2	4.1e-115
WP_001067784.1|35042_35747_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_033917554.1|36180_37695_-	MFS transporter	NA	NA	NA	NA	NA
WP_033917515.1|37923_39321_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_033917518.1|39400_42511_-	AdeB/AdeJ family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.4	9.4e-63
WP_033917516.1|42510_43698_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_033917517.1|43836_44568_+	efflux system response regulator transcription factor AdeR	NA	NA	NA	NA	NA
WP_043041662.1|44557_45637_+	two-component sensor histidine kinase AdeS	NA	W8CYF6	Bacillus_phage	28.0	2.7e-25
WP_033917576.1|45649_46612_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.5	9.1e-33
WP_015060246.1|46867_47479_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000155092.1|47668_48553_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|48608_50084_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000369781.1|50576_50849_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000897307.1|50841_51162_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001180106.1|51301_51721_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000985609.1|51800_52082_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.3	5.7e-12
WP_000286964.1|52082_52385_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	9.5e-21
WP_000172759.1|52533_53064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004728120.1|53152_53467_-	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_000438825.1|53453_53741_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_000447788.1|53970_54576_-	LysE family translocator	NA	NA	NA	NA	NA
WP_085940648.1|54648_55739_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000073658.1|55814_56642_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002002480.1|57612_58455_-	carbapenem-hydrolyzing class D beta-lactamase OXA-58	NA	NA	NA	NA	NA
WP_065995571.1|59015_59495_-	cysteine hydrolase family protein	NA	NA	NA	NA	NA
WP_148827134.1|60201_60771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148827135.1|60978_61383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067790.1|61746_62451_-|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
>prophage 2
NZ_CP043309	Acinetobacter johnsonii strain Acsw19 plasmid pAcsw19-2, complete sequence	351885	222406	258809	351885	integrase,transposase	uncultured_Caudovirales_phage(18.18%)	34	220677:220706	264064:264093
220677:220706	attL	TTTTTAATCAATTAAAAAACATCGCTTGCG	NA	NA	NA	NA
WP_117008103.1|222406_223482_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_005005993.1|223579_223954_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_003464986.1|225250_225532_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_005005995.1|225599_225872_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	41.9	7.5e-09
WP_002118292.1|226325_227072_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003464980.1|227064_227667_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_080755359.1|230010_230604_-|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_039048263.1|230783_231254_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_010591688.1|231782_232076_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_005006001.1|232134_232566_-	heme-binding protein	NA	NA	NA	NA	NA
WP_002118279.1|232638_233652_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005006003.1|233697_234006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002118270.1|234097_235066_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_005006007.1|235062_235767_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003464967.1|235907_236447_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003464965.1|236448_236892_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_074964445.1|237412_238171_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	36.4	2.1e-32
WP_085944217.1|238261_239426_+|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.3	4.6e-164
WP_002122354.1|239505_240858_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.9e-37
WP_005028587.1|241988_242135_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005006017.1|243148_244474_+	DNA cytosine methyltransferase	NA	A0A1L5C2B8	Pseudoalteromonas_phage	42.7	7.4e-110
WP_005006018.1|244842_246222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005006020.1|246372_246933_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	44.4	5.3e-33
WP_038350012.1|246929_248219_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	45.4	5.9e-112
WP_033917550.1|248353_248602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201168.1|249215_249854_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|249858_250224_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201164.1|250227_251040_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_033917495.1|251764_252193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033917496.1|253507_253933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952573.1|254310_255459_-	hypothetical protein	NA	I6XKU1	Burkholderia_virus	28.3	1.8e-27
WP_087554627.1|255798_256824_+|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	9.3e-52
WP_000422636.1|256924_257704_+	aminoglycoside O-phosphotransferase APH(3')-VIa	NA	E4ZFP6	Streptococcus_phage	35.1	1.5e-30
WP_001988464.1|257783_258809_+|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
264064:264093	attR	TTTTTAATCAATTAAAAAACATCGCTTGCG	NA	NA	NA	NA
