The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042817	Treponema phagedenis strain B36.5 chromosome, complete genome	3708782	71977	127962	3708782	head,transposase,tRNA,integrase	Bacillus_phage(30.0%)	48	69181:69195	131791:131805
69181:69195	attL	CTGCGTAAAACAAAA	NA	NA	NA	NA
WP_024752844.1|71977_73708_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024752845.1|73935_74937_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002696060.1|74929_75271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752846.1|75840_78495_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_148884366.1|78909_80091_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_002701287.1|80477_80840_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_024752848.1|80839_81463_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044634762.1|81467_82832_+|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_002701293.1|82981_83269_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_044634779.1|83788_86191_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_024752851.1|86224_88906_-	transcription elongation factor GreA	NA	A0A248SJQ8	Salicola_phage	27.1	1.3e-07
WP_024752852.1|88923_89871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044634763.1|90475_92878_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002701312.1|93285_94299_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_148878525.1|94600_94720_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002701318.1|95109_95808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878526.1|95952_96165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002701322.1|96411_97038_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002701324.1|97030_98398_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_039915987.1|98471_98813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039915994.1|99003_100392_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002701330.1|100651_101548_-	acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_148879394.1|101616_103140_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.3	8.0e-07
WP_024752858.1|103629_104805_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_024752859.1|104805_107895_+	exonuclease subunit SbcC	NA	NA	NA	NA	NA
WP_148878529.1|108576_109452_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.4	2.4e-32
WP_148878530.1|110431_111307_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.4	4.8e-33
WP_024752891.1|111291_111609_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148878531.1|111724_113716_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	1.5e-05
WP_148878532.1|114106_114793_-	site-specific DNA-methyltransferase	NA	A0A1P8CMS8	Staphylococcus_phage	35.2	3.4e-34
WP_024751679.1|114991_115276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148884650.1|115618_116686_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	31.0	5.7e-12
WP_148884369.1|117083_118322_-	DUF935 family protein	NA	NA	NA	NA	NA
WP_148879018.1|118318_119845_-	hypothetical protein	NA	A0A0N7AEF1	Bacillus_phage	29.1	9.0e-51
WP_148879017.1|119841_120378_-	DUF3486 family protein	NA	NA	NA	NA	NA
WP_024751680.1|120393_120684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044634729.1|120710_121109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878534.1|121113_121410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878535.1|121372_121735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751776.1|121718_122054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751777.1|122077_122632_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0B5CTW5	Listeria_phage	35.3	1.4e-22
WP_081718572.1|122749_122974_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148879016.1|123152_123599_-	DUF1018 domain-containing protein	NA	A4JWM5	Burkholderia_virus	32.8	2.1e-08
WP_024751779.1|123678_124191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002696308.1|124232_124427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878663.1|124431_125133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751674.1|125134_126070_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_148879015.1|126081_127962_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
131791:131805	attR	CTGCGTAAAACAAAA	NA	NA	NA	NA
>prophage 2
NZ_CP042817	Treponema phagedenis strain B36.5 chromosome, complete genome	3708782	497786	505675	3708782	transposase	Staphylococcus_phage(14.29%)	10	NA	NA
WP_148878660.1|497786_498473_+	site-specific DNA-methyltransferase	NA	A0A1P8CMS8	Staphylococcus_phage	36.1	1.4e-35
WP_148878659.1|498694_499198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878658.1|499225_499567_+	hypothetical protein	NA	D2ECI8	Treponema_phage	64.9	2.8e-05
WP_148878657.1|499661_500483_+	oxidoreductase	NA	A0A139ZPI9	Marinitoga_camini_virus	42.1	3.0e-37
WP_148884429.1|500479_501361_+	DNA adenine methylase	NA	A0A0H3UZK1	Geobacillus_virus	33.2	2.1e-28
WP_024751713.1|501357_501687_+	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	41.5	5.5e-14
WP_024751714.1|501683_501965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081718583.1|502048_502312_+	DUF1064 domain-containing protein	NA	B8Q5A6	Abalone_shriveling_syndrome-associated_virus	46.3	2.3e-07
WP_148884430.1|502348_504595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024751992.1|504658_505675_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	30.3	9.0e-23
>prophage 3
NZ_CP042817	Treponema phagedenis strain B36.5 chromosome, complete genome	3708782	762550	860058	3708782	protease,transposase,tRNA,integrase	Bacillus_phage(10.53%)	76	808222:808262	833223:833263
WP_148878595.1|762550_763672_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_047170258.1|763691_764705_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_002700763.1|764769_764988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081718774.1|764978_765200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752929.1|765358_765976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752928.1|766309_767974_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024752927.1|768306_769380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044634994.1|769366_770407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002700756.1|770436_771165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081718773.1|771166_772384_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002700754.1|772380_773070_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	2.4e-19
WP_148879922.1|773096_773945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752923.1|773937_774690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752922.1|775549_778672_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_024752205.1|780142_781015_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002696684.1|781073_781349_+	septation regulator SpoVG	NA	I3PV82	Clostridium_phage	41.7	7.8e-06
WP_002696682.1|781661_782297_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002696680.1|782356_783715_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	22.8	4.7e-11
WP_024752206.1|783781_785818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752207.1|785804_787511_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.5	3.4e-14
WP_024752208.1|787524_789330_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	44.8	1.2e-22
WP_148879198.1|789707_790433_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148878587.1|790441_790954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002698061.1|792815_793820_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.1	1.8e-60
WP_024752211.1|793816_794860_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_044634438.1|794856_795609_+	ATP-binding cassette domain-containing protein	NA	A7K9T9	Acanthocystis_turfacea_chlorella_virus	28.3	2.1e-08
WP_024752213.1|796373_797612_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024751821.1|801356_803087_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.2e-27
WP_044634938.1|803086_804802_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	7.8e-35
WP_024751820.1|804840_805443_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024751819.1|806264_807770_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.1	8.8e-59
808222:808262	attL	TCAGAACGGGCACGGACGCCCGTGGTTCCAAACAGAAGCGA	NA	NA	NA	NA
WP_024752995.1|808862_810269_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024752996.1|810272_811040_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_024752998.1|812663_814532_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_148878583.1|814534_815050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878582.1|815125_816490_+	response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	4.0e-34
WP_024753000.1|816518_816881_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_024753001.1|817034_817253_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_148878581.1|817258_817789_-	DnaJ domain-containing protein	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	46.2	4.4e-13
WP_002695411.1|817785_818472_-	UMP kinase	NA	NA	NA	NA	NA
WP_148884452.1|818812_820498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753004.1|820508_821222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753005.1|821205_821748_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024753006.1|821903_823364_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0U2SJ70	Niemeyer_virus	27.9	8.9e-40
WP_002695397.1|823471_824434_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_024753007.1|824494_825742_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002695393.1|825750_826344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002695391.1|826318_826774_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_002695389.1|827021_827834_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_002695388.1|827976_829107_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q6XM27	Feldmannia_irregularis_virus	34.9	2.2e-06
WP_024753008.1|829539_830832_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_047170259.1|831423_831771_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	43.4	5.6e-09
WP_024753009.1|831882_832164_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_047170260.1|832346_832694_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	43.4	4.3e-09
WP_024752184.1|832805_833087_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148884453.1|833617_836389_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
833223:833263	attR	TCAGAACGGGCACGGACGCCCGTGGTTCCAAACAGAAGCGA	NA	NA	NA	NA
WP_148884454.1|836388_839805_+	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	25.0	4.2e-16
WP_024751992.1|841879_842896_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	30.3	9.0e-23
WP_148878579.1|843496_843619_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148878578.1|843566_844196_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_024753013.1|844348_844573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002696721.1|844690_844891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878577.1|845015_846269_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_148884455.1|846537_846873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148879397.1|846869_847046_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_002699530.1|847130_847412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753017.1|847452_848067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753018.1|848276_849326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753019.1|849376_850405_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002699538.1|850435_851401_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002699542.1|851871_852891_+	thiamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024753022.1|852905_854552_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_024753023.1|854551_855175_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	8.8e-29
WP_148878576.1|855230_857318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044634523.1|857340_858423_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_148878575.1|858981_860058_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP042817	Treponema phagedenis strain B36.5 chromosome, complete genome	3708782	1043580	1050066	3708782	portal	Abalone_shriveling_syndrome-associated_virus(16.67%)	8	NA	NA
WP_081718583.1|1043580_1043844_-	DUF1064 domain-containing protein	NA	B8Q5A6	Abalone_shriveling_syndrome-associated_virus	46.3	2.3e-07
WP_024751734.1|1043927_1044209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751735.1|1044205_1044535_-	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	41.5	9.4e-14
WP_148884480.1|1044531_1045410_-	DNA adenine methylase	NA	B0ZSH4	Halomonas_phage	32.9	6.8e-27
WP_024751624.1|1045406_1046228_-	hypothetical protein	NA	A0A139ZPI9	Marinitoga_camini_virus	42.5	1.8e-37
WP_039914875.1|1046325_1046634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148884481.1|1046665_1048438_-|portal	phage portal protein	portal	F8WPY2	Bacillus_phage	29.4	2.7e-38
WP_148878755.1|1048470_1050066_-	hypothetical protein	NA	S5MBV8	Brevibacillus_phage	35.6	5.3e-70
>prophage 5
NZ_CP042817	Treponema phagedenis strain B36.5 chromosome, complete genome	3708782	1231564	1308196	3708782	tRNA,transposase	uncultured_Mediterranean_phage(16.67%)	51	NA	NA
WP_024751992.1|1231564_1232581_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	30.3	9.0e-23
WP_052335653.1|1232781_1234035_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_024752306.1|1234737_1235964_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_044635033.1|1236668_1237868_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.6	1.3e-20
WP_148884500.1|1237979_1238168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148884501.1|1238343_1238856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148883908.1|1238864_1239590_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_148878782.1|1239839_1241741_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_148879412.1|1244138_1245686_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	41.6	1.3e-76
WP_148878529.1|1247730_1248606_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.4	2.4e-32
WP_148878783.1|1248577_1249342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753277.1|1250833_1251874_+	radical SAM protein	NA	NA	NA	NA	NA
WP_044634801.1|1251889_1252579_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_052812616.1|1252725_1253661_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_024753280.1|1253702_1254185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884502.1|1254677_1256804_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.5	2.9e-07
WP_002697760.1|1257930_1259157_+	aminopeptidase	NA	NA	NA	NA	NA
WP_002697758.1|1259178_1259814_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081718812.1|1259804_1260833_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_148884503.1|1260912_1261935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753284.1|1262294_1263662_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_039914711.1|1263755_1264409_-	PTS transporter subunit EIIA	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	35.7	2.2e-06
WP_148884504.1|1264712_1265540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878786.1|1266242_1267376_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024753289.1|1267429_1268965_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	1.4e-11
WP_148879653.1|1268954_1270073_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024753291.1|1270065_1270971_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002697730.1|1271182_1271635_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_024753292.1|1271640_1272525_+	DMT family transporter	NA	NA	NA	NA	NA
WP_148878787.1|1272629_1272839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044634501.1|1279634_1279916_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024753293.1|1280565_1282113_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	27.9	5.8e-13
WP_002698745.1|1282538_1283177_+	P13 family porin	NA	NA	NA	NA	NA
WP_044634368.1|1283447_1284167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002698755.1|1284243_1284714_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_148878788.1|1284725_1285100_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_039943845.1|1285638_1287480_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	33.3	8.5e-72
WP_148878789.1|1288016_1289291_-	aminoacetone oxidase family FAD-binding enzyme	NA	A0A2H4PQX1	Staphylococcus_phage	53.9	2.0e-19
WP_024753300.1|1290208_1292125_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	43.5	1.5e-135
WP_024753301.1|1292590_1293088_+	flavodoxin	NA	NA	NA	NA	NA
WP_081718814.1|1293336_1293519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753302.1|1293723_1294053_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024753303.1|1294068_1294824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044634367.1|1294985_1296386_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_002698788.1|1297749_1298247_-	OmpA family protein	NA	NA	NA	NA	NA
WP_024753307.1|1300621_1302769_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	9.2e-09
WP_148878791.1|1303180_1304122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752184.1|1304367_1304649_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148878792.1|1305506_1305857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753309.1|1305911_1306532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751818.1|1307014_1308196_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP042817	Treponema phagedenis strain B36.5 chromosome, complete genome	3708782	1700861	1751537	3708782	portal,tail,transposase,integrase	Bacillus_phage(12.5%)	56	1699699:1699713	1743172:1743186
1699699:1699713	attL	AGATTATATAAAATT	NA	NA	NA	NA
WP_148884520.1|1700861_1701641_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	25.7	4.6e-11
WP_024751666.1|1701710_1702109_+	single-stranded DNA-binding protein	NA	E5DV85	Deep-sea_thermophilic_phage	41.4	1.4e-16
WP_148878753.1|1702128_1702329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044634232.1|1702822_1703014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884482.1|1703010_1703808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878755.1|1703916_1705512_+	hypothetical protein	NA	S5MBV8	Brevibacillus_phage	35.6	5.3e-70
WP_148878756.1|1705544_1707317_+|portal	phage portal protein	portal	F8WPY2	Bacillus_phage	29.6	7.0e-39
WP_081718581.1|1707330_1707660_+	hypothetical protein	NA	D2ECI8	Treponema_phage	64.9	2.7e-05
WP_024751624.1|1707754_1708576_+	hypothetical protein	NA	A0A139ZPI9	Marinitoga_camini_virus	42.5	1.8e-37
WP_148884521.1|1708572_1709451_+	DNA adenine methylase	NA	A0A0H3UZK1	Geobacillus_virus	32.0	1.8e-27
WP_024751735.1|1709447_1709777_+	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	41.5	9.4e-14
WP_024751714.1|1709773_1710055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081718583.1|1710138_1710402_+	DUF1064 domain-containing protein	NA	B8Q5A6	Abalone_shriveling_syndrome-associated_virus	46.3	2.3e-07
WP_024751946.1|1710473_1711076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024751945.1|1711053_1712517_+	DNA-packaging protein	NA	A0A0K1LMR9	Caulobacter_phage	33.0	1.0e-51
WP_148884522.1|1712544_1714038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884523.1|1714040_1714424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884524.1|1714420_1716037_+	hypothetical protein	NA	A0A0A8WIZ2	Clostridium_phage	32.8	2.4e-30
WP_024751943.1|1716005_1716347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024751942.1|1716321_1716636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148884525.1|1716789_1718199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884066.1|1718214_1718553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884526.1|1718577_1719633_+	hypothetical protein	NA	A0A0A8WEW9	Clostridium_phage	27.0	4.8e-27
WP_024751938.1|1719684_1719930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024751937.1|1719947_1720316_+	hypothetical protein	NA	A0A0N7ACH0	Bacillus_phage	29.1	2.3e-05
WP_024751936.1|1720309_1720705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148879782.1|1720704_1721103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002695945.1|1721106_1721475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884527.1|1721506_1722484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024751932.1|1722545_1723100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884528.1|1723318_1728037_+|tail	phage tail tape measure protein	tail	Q9MBP2	Staphylococcus_prophage	31.1	2.3e-36
WP_148884529.1|1728041_1728782_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_148884530.1|1728782_1731596_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_148884531.1|1731597_1732773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081718636.1|1732745_1733312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884532.1|1733323_1734550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884533.1|1735266_1735959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148884058.1|1736043_1736316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884057.1|1736386_1736647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884056.1|1736768_1736981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884534.1|1736977_1737709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878653.1|1737871_1738663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024751645.1|1738649_1739069_+	CHAP domain-containing protein	NA	D3W0F3	Lactococcus_phage	38.9	2.3e-09
WP_148884535.1|1739153_1739495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148884434.1|1739545_1739863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751917.1|1739862_1740267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751914.1|1740455_1741742_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	24.8	8.5e-10
WP_148884536.1|1741870_1742191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002699887.1|1742187_1744443_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
1743172:1743186	attR	AGATTATATAAAATT	NA	NA	NA	NA
WP_002699885.1|1744498_1745185_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_148878868.1|1745379_1745703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878869.1|1746889_1747660_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_002699440.1|1748003_1748657_+	HEAT repeat protein	NA	NA	NA	NA	NA
WP_148878870.1|1748653_1749463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878871.1|1749454_1750651_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_148878872.1|1751255_1751537_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP042817	Treponema phagedenis strain B36.5 chromosome, complete genome	3708782	2244626	2303207	3708782	protease,tRNA,transposase	Staphylococcus_phage(18.18%)	55	NA	NA
WP_002699091.1|2244626_2245220_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.9	3.1e-31
WP_024752388.1|2247011_2248445_+	amino acid permease	NA	NA	NA	NA	NA
WP_148878989.1|2249183_2250122_+	AEC family transporter	NA	NA	NA	NA	NA
WP_081718624.1|2250195_2250384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002699078.1|2250604_2250982_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002699076.1|2250994_2251861_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	2.0e-18
WP_024751880.1|2251862_2252558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878990.1|2253022_2253349_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_024751882.1|2253309_2253561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148884561.1|2253878_2254673_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.1	3.6e-43
WP_002698290.1|2254669_2255956_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.9	1.7e-90
WP_024751884.1|2255974_2256556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751886.1|2257431_2258181_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_148878991.1|2258600_2259245_-	DUF3160 domain-containing protein	NA	NA	NA	NA	NA
WP_148879429.1|2259186_2259285_-	DUF3160 domain-containing protein	NA	NA	NA	NA	NA
WP_082048215.1|2259309_2259867_-	DUF3160 domain-containing protein	NA	NA	NA	NA	NA
WP_082048214.1|2259818_2260472_-	DUF3160 domain-containing protein	NA	NA	NA	NA	NA
WP_024751890.1|2261336_2261720_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_024751891.1|2261764_2262394_-	adenylate kinase	NA	NA	NA	NA	NA
WP_081718631.1|2263108_2263297_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002698319.1|2263311_2263548_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_024751892.1|2263566_2264298_+	ribonuclease III	NA	L7RCJ8	Acanthamoeba_polyphaga_moumouvirus	30.3	1.3e-23
WP_024751992.1|2264396_2265413_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	30.3	9.0e-23
WP_148879972.1|2265676_2266402_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_052335628.1|2266917_2267541_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_148878993.1|2267935_2268661_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_039914919.1|2268644_2269178_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.8	5.8e-21
WP_002698332.1|2269417_2270353_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_002698334.1|2270435_2271470_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024751895.1|2271728_2272556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751896.1|2272570_2273269_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.3e-20
WP_024751897.1|2273271_2273631_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148878994.1|2274560_2277299_-	pyruvate, phosphate dikinase	NA	NA	NA	NA	NA
WP_024751899.1|2277310_2278333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751900.1|2278432_2280472_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_002698356.1|2280630_2281290_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_148884562.1|2281581_2282814_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_081718633.1|2282926_2283112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878995.1|2283314_2284901_-|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_148878996.1|2285040_2285250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751902.1|2285515_2286007_-	universal stress protein	NA	NA	NA	NA	NA
WP_024751903.1|2286096_2286738_-	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_024751904.1|2286842_2291135_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.0	9.3e-69
WP_002698374.1|2291148_2294673_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.0	2.8e-47
WP_024751905.1|2295185_2295575_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002698382.1|2295711_2296341_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_024751906.1|2296342_2297023_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002698386.1|2297024_2297456_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002698388.1|2297538_2298096_-	transcription termination/antitermination factor NusG	NA	NA	NA	NA	NA
WP_024751907.1|2298105_2298285_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002698390.1|2298423_2298594_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_024751908.1|2299005_2299446_-	flavodoxin	NA	NA	NA	NA	NA
WP_024751909.1|2299468_2300044_-	DUF3793 family protein	NA	NA	NA	NA	NA
WP_024751992.1|2300331_2301348_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	30.3	9.0e-23
WP_148884563.1|2301953_2303207_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP042817	Treponema phagedenis strain B36.5 chromosome, complete genome	3708782	2635909	2640472	3708782		Abalone_shriveling_syndrome-associated_virus(16.67%)	8	NA	NA
WP_081718583.1|2635909_2636173_-	DUF1064 domain-containing protein	NA	B8Q5A6	Abalone_shriveling_syndrome-associated_virus	46.3	2.3e-07
WP_024751714.1|2636256_2636538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751735.1|2636534_2636864_-	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	41.5	9.4e-14
WP_148884590.1|2636967_2637789_-	hypothetical protein	NA	A0A139ZPI9	Marinitoga_camini_virus	40.8	1.4e-34
WP_081718571.1|2637883_2638225_-	hypothetical protein	NA	D2ECI8	Treponema_phage	64.9	2.8e-05
WP_024751626.1|2638252_2638756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148884674.1|2638977_2639676_-	site-specific DNA-methyltransferase	NA	E8ZD58	Streptococcus_phage	35.6	8.1e-31
WP_148884591.1|2639683_2640472_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	25.7	1.4e-10
>prophage 9
NZ_CP042817	Treponema phagedenis strain B36.5 chromosome, complete genome	3708782	3123468	3132237	3708782		Bacillus_phage(66.67%)	6	NA	NA
WP_044634516.1|3123468_3125265_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	2.0e-25
WP_024753047.1|3125261_3126995_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	1.6e-35
WP_044634515.1|3127168_3128854_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	9.6e-38
WP_044634514.1|3128850_3130584_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	1.8e-34
WP_024753050.1|3130703_3131366_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	26.7	1.2e-07
WP_024753051.1|3131358_3132237_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	4.1e-08
