The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042815	Treponema phagedenis strain S2.3 chromosome, complete genome	3446583	78987	142514	3446583	transposase,tRNA,integrase,tail	Bacillus_phage(30.0%)	60	70946:70966	149081:149101
70946:70966	attL	CTCACCGTTGCGCCGTGTCGG	NA	NA	NA	NA
WP_148878524.1|78987_80181_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_002701287.1|80567_80930_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_024752848.1|80929_81553_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002701291.1|81557_82922_+|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_002701293.1|83071_83359_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_044634779.1|83878_86281_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_024752851.1|86314_88996_-	transcription elongation factor GreA	NA	A0A248SJQ8	Salicola_phage	27.1	1.3e-07
WP_024752852.1|89013_89961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039943662.1|90565_92968_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002701312.1|93375_94389_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_148878525.1|94690_94810_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002701318.1|95199_95898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878526.1|96042_96255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002701322.1|96501_97128_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148878527.1|97120_98488_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_039915987.1|98561_98903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039915994.1|99094_100483_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_148878528.1|100741_101638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148879394.1|101706_103230_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.3	8.0e-07
WP_024752858.1|103719_104895_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_024752859.1|104895_107985_+	exonuclease subunit SbcC	NA	NA	NA	NA	NA
WP_148878529.1|108666_109542_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.4	2.4e-32
WP_148878530.1|110521_111397_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.4	4.8e-33
WP_024752891.1|111381_111699_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148878531.1|111814_113806_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	1.5e-05
WP_148878532.1|114196_114883_-	site-specific DNA-methyltransferase	NA	A0A1P8CMS8	Staphylococcus_phage	35.2	3.4e-34
WP_024751679.1|115082_115367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751770.1|115652_115838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878533.1|117260_118511_-	DUF935 family protein	NA	NA	NA	NA	NA
WP_002696334.1|118507_120034_-	hypothetical protein	NA	A0A0N7AEF1	Bacillus_phage	29.1	9.0e-51
WP_002696333.1|120030_120567_-	DUF3486 family protein	NA	NA	NA	NA	NA
WP_024751680.1|120582_120873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044634729.1|120899_121298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878534.1|121302_121599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878535.1|121561_121924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751776.1|121907_122243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751777.1|122266_122821_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0B5CTW5	Listeria_phage	35.3	1.4e-22
WP_081718572.1|122937_123162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024751675.1|123340_123787_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	32.8	1.2e-08
WP_002696309.1|123866_124379_-	bacteriophage Mu Gam like protein	NA	NA	NA	NA	NA
WP_148878536.1|124420_124615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878537.1|124619_125327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878538.1|125329_126265_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_148878539.1|126276_128157_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_148878540.1|128153_128495_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_148878541.1|128689_129277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878542.1|129385_129826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878543.1|129837_130278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878544.1|130820_131681_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002695871.1|131862_132153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878545.1|132139_132700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878546.1|132752_133091_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_002695879.1|134216_134564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039943637.1|134613_135609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752645.1|135670_136129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081718589.1|136125_136740_+	phage morphogenesis protein	NA	NA	NA	NA	NA
WP_024752646.1|136729_137179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878547.1|137204_138056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024751792.1|138137_138524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878548.1|138755_142514_+|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	32.5	1.2e-27
149081:149101	attR	CCGACACGGCGCAACGGTGAG	NA	NA	NA	NA
>prophage 2
NZ_CP042815	Treponema phagedenis strain S2.3 chromosome, complete genome	3446583	257049	308207	3446583	transposase,protease	Cronobacter_phage(14.29%)	42	NA	NA
WP_024753077.1|257049_259521_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	37.6	3.0e-120
WP_002697999.1|259557_260043_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_024753074.1|261070_262444_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002698671.1|262512_263502_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024753073.1|263797_264754_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.4	3.9e-36
WP_039943739.1|265554_265959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002698660.1|265955_267077_-	ABC transporter	NA	NA	NA	NA	NA
WP_024753071.1|267077_268118_-	ABC transporter	NA	NA	NA	NA	NA
WP_024753070.1|268118_269699_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	2.5e-11
WP_002698654.1|269819_271061_-	DUF3798 domain-containing protein	NA	NA	NA	NA	NA
WP_044634678.1|272224_273418_+	F420-0--gamma-glutamyl ligase	NA	NA	NA	NA	NA
WP_081718784.1|273528_273777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002700292.1|274133_274745_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_024753068.1|274797_275946_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_044634679.1|276092_278516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753066.1|279124_279919_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_002700284.1|279911_280490_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_148878572.1|280729_281062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148879396.1|281174_282479_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_148878573.1|282787_283291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878574.1|283331_285581_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	50.0	4.0e-07
WP_024752166.1|287100_288882_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	37.3	9.0e-111
WP_039943445.1|288995_289724_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_148878575.1|290028_291105_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_044634523.1|291663_292746_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_148878576.1|292768_294856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753023.1|294911_295535_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	8.8e-29
WP_024753022.1|295534_297181_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002699542.1|297195_298215_-	thiamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002699538.1|298685_299651_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024753019.1|299681_300710_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_024753018.1|300760_301810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753017.1|302019_302634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002699530.1|302674_302956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148879397.1|303040_303217_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_024753016.1|303213_303651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878577.1|303817_305071_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_002696721.1|305195_305396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753013.1|305513_305738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878578.1|305890_306520_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_148878579.1|306467_306590_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024751992.1|307190_308207_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	30.3	9.0e-23
>prophage 3
NZ_CP042815	Treponema phagedenis strain S2.3 chromosome, complete genome	3446583	316999	387554	3446583	transposase,tRNA,integrase,protease	Lactobacillus_phage(12.5%)	58	317741:317787	318664:318710
WP_024752184.1|316999_317281_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047170260.1|317392_317740_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	43.4	4.3e-09
317741:317787	attL	ACATACATTTAGGGGATAAAAATACTGAACTGATATTGACATTTCCA	NA	NA	NA	NA
WP_024753009.1|317922_318204_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047170259.1|318315_318663_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	43.4	5.6e-09
WP_024753008.1|319254_320547_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
318664:318710	attR	ACATACATTTAGGGGATAAAAATACTGAACTGATATTGACATTTCCA	NA	NA	NA	NA
WP_002695388.1|320979_322110_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q6XM27	Feldmannia_irregularis_virus	34.9	2.2e-06
WP_002695389.1|322252_323065_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_002695391.1|323312_323768_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_002695393.1|323742_324336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753007.1|324344_325592_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002695397.1|325652_326615_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_024753006.1|326722_328183_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0U2SJ70	Niemeyer_virus	27.9	8.9e-40
WP_024753005.1|328338_328881_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024753004.1|328864_329578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753003.1|329588_331274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002695411.1|331614_332301_+	UMP kinase	NA	NA	NA	NA	NA
WP_148878581.1|332297_332828_+	DnaJ domain-containing protein	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	46.2	4.4e-13
WP_024753001.1|332833_333052_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024753000.1|333205_333568_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_148878582.1|333596_334961_-	response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	4.0e-34
WP_148878583.1|335036_335552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752998.1|335554_337423_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_024752997.1|337422_338430_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_024752996.1|339045_339813_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_024752995.1|339816_341223_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_148878584.1|342382_343888_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.1	8.8e-59
WP_148878585.1|344709_345312_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044634938.1|345350_347066_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	7.8e-35
WP_044634937.1|347065_348796_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	3.2e-28
WP_148878586.1|352248_352434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752213.1|352686_353925_-	OmpA family protein	NA	NA	NA	NA	NA
WP_024752212.1|354491_355244_-	ATP-binding cassette domain-containing protein	NA	A7K9T9	Acanthocystis_turfacea_chlorella_virus	28.3	2.1e-08
WP_024752211.1|355240_356284_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002698061.1|356280_357285_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.1	1.8e-60
WP_148878587.1|359146_359659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878588.1|359746_360394_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024752208.1|360771_362577_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	44.8	1.2e-22
WP_024752207.1|362590_364297_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.5	3.4e-14
WP_148878589.1|364283_365780_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_148878590.1|365715_366321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002696680.1|366387_367746_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	22.8	4.7e-11
WP_002696682.1|367805_368441_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002696684.1|368753_369029_-	septation regulator SpoVG	NA	I3PV82	Clostridium_phage	41.7	7.8e-06
WP_024752205.1|369087_369960_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_024752922.1|371430_374553_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_024752923.1|375412_376165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878591.1|376157_377006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002700754.1|377032_377722_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	2.4e-19
WP_081718773.1|377718_378936_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002700756.1|378937_379666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044634994.1|379695_380736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878592.1|380722_381256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878593.1|381221_381797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044634993.1|382129_383794_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024752929.1|384127_384745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081718774.1|384903_385125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878594.1|385115_385334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878595.1|386432_387554_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 4
NZ_CP042815	Treponema phagedenis strain S2.3 chromosome, complete genome	3446583	491469	554647	3446583	transposase,protease,integrase,tail	Exiguobacterium_phage(25.0%)	58	495190:495205	554671:554686
WP_148878613.1|491469_492723_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_148878614.1|492890_493355_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_148878615.1|493630_494143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878616.1|494184_494379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878617.1|494383_495085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878618.1|495087_496023_-	AAA family ATPase	NA	NA	NA	NA	NA
495190:495205	attL	TCGATTGATAATCTTT	NA	NA	NA	NA
WP_148878619.1|496034_497915_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_148878620.1|497911_498253_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_148878621.1|498448_498832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878622.1|499299_500196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002695879.1|500222_500570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039943637.1|500619_501615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752645.1|501676_502135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082048222.1|502131_502746_+	phage morphogenesis protein	NA	NA	NA	NA	NA
WP_024751790.1|502735_503185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752647.1|503211_504063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878623.1|504144_504531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878624.1|504762_508521_+|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	32.5	1.2e-27
WP_002695900.1|508546_508984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878625.1|509017_509596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082048223.1|509713_511990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878626.1|512019_513384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024751798.1|513387_513942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752241.1|515501_516788_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_024752242.1|516909_519045_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	2.2e-07
WP_002699748.1|519110_519779_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002699750.1|519782_521033_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_024752243.1|521066_522596_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.9	1.4e-67
WP_024752244.1|522784_523282_-	cell division protein DedD	NA	A7KUY9	Bacillus_phage	47.0	3.5e-28
WP_024752245.1|523674_525012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878627.1|525016_527665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148879399.1|528015_529044_+	KamA family radical SAM protein	NA	NA	NA	NA	NA
WP_024752248.1|529229_530054_+	RNA polymerase sigma factor RpoD/SigA	NA	M4SMP8	Cyanophage	30.6	2.1e-22
WP_024752249.1|530072_531113_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002699771.1|531158_532091_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002699773.1|532087_532963_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_148878628.1|532959_534087_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	7.1e-29
WP_148878629.1|534419_535253_-	DNA adenine methylase	NA	A0A0H3UZK1	Geobacillus_virus	32.7	1.7e-27
WP_024751798.1|535361_535916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878630.1|535919_537284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081718592.1|537313_539590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878631.1|539707_540286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751794.1|540319_540757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878632.1|540781_544540_-|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	32.5	2.0e-27
WP_024751792.1|544771_545158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752647.1|545235_546087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751790.1|546113_546563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878633.1|546552_547167_-	phage morphogenesis protein	NA	NA	NA	NA	NA
WP_024752645.1|547163_547622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039943637.1|547683_548679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002695879.1|548728_549076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878622.1|549102_549999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878634.1|550197_550644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878635.1|550649_551027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878636.1|551098_551395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878637.1|551645_552233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878638.1|552428_552770_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_148878639.1|552766_554647_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
554671:554686	attR	TCGATTGATAATCTTT	NA	NA	NA	NA
>prophage 5
NZ_CP042815	Treponema phagedenis strain S2.3 chromosome, complete genome	3446583	574738	579261	3446583		Abalone_shriveling_syndrome-associated_virus(16.67%)	8	NA	NA
WP_148879401.1|574738_575002_-	DUF1064 domain-containing protein	NA	B8Q5A6	Abalone_shriveling_syndrome-associated_virus	46.3	2.3e-07
WP_024751714.1|575085_575367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878655.1|575363_575693_-	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	41.5	5.5e-14
WP_148878656.1|575689_576568_-	DNA adenine methylase	NA	A0A0H3UZK1	Geobacillus_virus	33.2	9.5e-29
WP_148878657.1|576564_577386_-	oxidoreductase	NA	A0A139ZPI9	Marinitoga_camini_virus	42.1	3.0e-37
WP_148878658.1|577480_577822_-	hypothetical protein	NA	D2ECI8	Treponema_phage	64.9	2.8e-05
WP_148878659.1|577849_578353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878660.1|578574_579261_-	site-specific DNA-methyltransferase	NA	A0A1P8CMS8	Staphylococcus_phage	36.1	1.4e-35
>prophage 6
NZ_CP042815	Treponema phagedenis strain S2.3 chromosome, complete genome	3446583	964816	1037916	3446583	transposase,tRNA	uncultured_Mediterranean_phage(16.67%)	48	NA	NA
WP_148878779.1|964816_965839_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	30.3	9.1e-23
WP_148878780.1|966039_967293_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_024752306.1|967995_969222_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_044635033.1|969926_971126_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.6	1.3e-20
WP_148878781.1|971601_972855_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_148878782.1|973104_975006_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_148879412.1|977403_978951_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	41.6	1.3e-76
WP_148878529.1|980995_981871_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.4	2.4e-32
WP_148878783.1|981842_982607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753277.1|984098_985139_+	radical SAM protein	NA	NA	NA	NA	NA
WP_044634801.1|985154_985844_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_052812616.1|985990_986926_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_024753280.1|986967_987450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878784.1|987942_990069_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.5	2.9e-07
WP_002697760.1|991195_992422_+	aminopeptidase	NA	NA	NA	NA	NA
WP_002697758.1|992443_993079_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081718812.1|993069_994098_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_024753283.1|994177_995200_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_024753284.1|995559_996927_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_039914711.1|997020_997674_-	PTS transporter subunit EIIA	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	35.7	2.2e-06
WP_148878785.1|997977_998685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753287.1|998745_998949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878786.1|999507_1000641_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024753289.1|1000694_1002230_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	1.4e-11
WP_024753290.1|1002219_1003338_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024753291.1|1003330_1004236_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002697730.1|1004447_1004900_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_024753292.1|1004905_1005790_+	DMT family transporter	NA	NA	NA	NA	NA
WP_148878787.1|1005894_1006104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044634501.1|1012899_1013181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024753293.1|1013830_1015378_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	27.9	5.8e-13
WP_002698745.1|1015803_1016442_+	P13 family porin	NA	NA	NA	NA	NA
WP_044634368.1|1016712_1017432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002698755.1|1017508_1017979_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_148878788.1|1017990_1018365_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_039943845.1|1018903_1020745_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	33.3	8.5e-72
WP_148878789.1|1021281_1022556_-	aminoacetone oxidase family FAD-binding enzyme	NA	A0A2H4PQX1	Staphylococcus_phage	53.9	2.0e-19
WP_024753300.1|1023473_1025390_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	43.5	1.5e-135
WP_024753301.1|1025855_1026353_+	flavodoxin	NA	NA	NA	NA	NA
WP_081718814.1|1026602_1026785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753302.1|1026989_1027319_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024753303.1|1027334_1028090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753304.1|1028251_1029115_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_148878790.1|1029178_1029652_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_002698788.1|1031015_1031513_-	OmpA family protein	NA	NA	NA	NA	NA
WP_024753307.1|1033888_1036036_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	9.2e-09
WP_148878791.1|1036447_1037389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752184.1|1037634_1037916_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP042815	Treponema phagedenis strain S2.3 chromosome, complete genome	3446583	2317366	2322016	3446583		Azospirillum_phage(16.67%)	8	NA	NA
WP_148879072.1|2317366_2317717_-	DUF1064 domain-containing protein	NA	B0VK09	Azospirillum_phage	46.6	1.2e-11
WP_024751714.1|2317713_2317995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751735.1|2317991_2318321_-	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	41.5	9.4e-14
WP_148879073.1|2318424_2319246_-	oxidoreductase	NA	A0A139ZPI9	Marinitoga_camini_virus	42.1	2.3e-37
WP_148878658.1|2319340_2319682_-	hypothetical protein	NA	D2ECI8	Treponema_phage	64.9	2.8e-05
WP_148879074.1|2319709_2320213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148879075.1|2320521_2321220_-	site-specific DNA-methyltransferase	NA	E8ZD58	Streptococcus_phage	36.0	2.1e-31
WP_148879076.1|2321227_2322016_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	25.7	8.0e-11
>prophage 8
NZ_CP042815	Treponema phagedenis strain S2.3 chromosome, complete genome	3446583	2808536	2817305	3446583		Bacillus_phage(66.67%)	6	NA	NA
WP_044634516.1|2808536_2810333_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	2.0e-25
WP_024753047.1|2810329_2812063_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	1.6e-35
WP_044634515.1|2812236_2813922_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	9.6e-38
WP_044634514.1|2813918_2815652_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	1.8e-34
WP_024753050.1|2815771_2816434_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	26.7	1.2e-07
WP_024753051.1|2816426_2817305_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	4.1e-08
