The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042813	Treponema phagedenis strain S11.1 chromosome, complete genome	3436741	78986	142514	3436741	tail,transposase,tRNA,integrase	Bacillus_phage(30.0%)	59	70945:70965	149081:149101
70945:70965	attL	CTCACCGTTGCGCCGTGTCGG	NA	NA	NA	NA
WP_148878524.1|78986_80180_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_002701287.1|80566_80929_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_024752848.1|80928_81552_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002701291.1|81556_82921_+|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_002701293.1|83070_83358_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_044634779.1|83877_86280_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_024752851.1|86313_88995_-	transcription elongation factor GreA	NA	A0A248SJQ8	Salicola_phage	27.1	1.3e-07
WP_024752852.1|89012_89960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039943662.1|90564_92967_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002701312.1|93374_94388_-	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_148878525.1|94689_94809_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002701318.1|95198_95897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878526.1|96041_96254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002701322.1|96500_97127_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148878527.1|97119_98487_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_039915987.1|98560_98902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039915994.1|99093_100482_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_148878528.1|100740_101637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148879394.1|101705_103229_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.3	8.0e-07
WP_024752858.1|103718_104894_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_024752859.1|104894_107984_+	exonuclease subunit SbcC	NA	NA	NA	NA	NA
WP_148878529.1|108665_109541_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.4	2.4e-32
WP_148878530.1|110520_111396_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.4	4.8e-33
WP_024752891.1|111380_111698_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_148878531.1|111813_113805_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	1.5e-05
WP_148878532.1|114195_114882_-	site-specific DNA-methyltransferase	NA	A0A1P8CMS8	Staphylococcus_phage	35.2	3.4e-34
WP_024751679.1|115081_115366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751770.1|115651_115837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878533.1|117259_118510_-	DUF935 family protein	NA	NA	NA	NA	NA
WP_002696334.1|118506_120033_-	hypothetical protein	NA	A0A0N7AEF1	Bacillus_phage	29.1	9.0e-51
WP_002696333.1|120029_120566_-	DUF3486 family protein	NA	NA	NA	NA	NA
WP_024751680.1|120581_120872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044634729.1|120898_121297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878534.1|121301_121598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878535.1|121560_121923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751776.1|121906_122242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751777.1|122265_122820_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0B5CTW5	Listeria_phage	35.3	1.4e-22
WP_081718572.1|122936_123161_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024751675.1|123339_123786_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	32.8	1.2e-08
WP_002696309.1|123865_124378_-	bacteriophage Mu Gam like protein	NA	NA	NA	NA	NA
WP_148878536.1|124419_124614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878537.1|124618_125326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878538.1|125328_126264_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_148878539.1|126275_128156_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_148878540.1|128152_128494_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_148878541.1|128688_129276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148883877.1|129384_129831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878543.1|129836_130277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878544.1|130819_131680_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002695871.1|131861_132152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878545.1|132138_132699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878546.1|132751_133090_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_002695879.1|134215_134563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039943637.1|134612_135608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752645.1|135669_136128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081718589.1|136124_136739_+	phage morphogenesis protein	NA	NA	NA	NA	NA
WP_024752646.1|136728_137178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878547.1|137203_138055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878548.1|138755_142514_+|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	32.5	1.2e-27
149081:149101	attR	CCGACACGGCGCAACGGTGAG	NA	NA	NA	NA
>prophage 2
NZ_CP042813	Treponema phagedenis strain S11.1 chromosome, complete genome	3436741	257047	308206	3436741	protease,transposase	Cronobacter_phage(14.29%)	42	NA	NA
WP_024753077.1|257047_259519_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	37.6	3.0e-120
WP_002697999.1|259555_260041_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_024753074.1|261068_262442_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002698671.1|262510_263500_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024753073.1|263795_264752_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.4	3.9e-36
WP_039943739.1|265552_265957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002698660.1|265953_267075_-	ABC transporter	NA	NA	NA	NA	NA
WP_024753071.1|267075_268116_-	ABC transporter	NA	NA	NA	NA	NA
WP_024753070.1|268116_269697_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	2.5e-11
WP_002698654.1|269817_271059_-	DUF3798 domain-containing protein	NA	NA	NA	NA	NA
WP_044634678.1|272222_273416_+	F420-0--gamma-glutamyl ligase	NA	NA	NA	NA	NA
WP_081718784.1|273526_273775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002700292.1|274131_274743_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_024753068.1|274795_275944_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_044634679.1|276090_278514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753066.1|279122_279917_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_002700284.1|279909_280488_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_148878572.1|280727_281060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148879396.1|281172_282477_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_148878573.1|282785_283289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148883879.1|283329_285540_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	50.0	4.0e-07
WP_024752166.1|287099_288881_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	37.3	9.0e-111
WP_039943445.1|288994_289723_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_148878575.1|290027_291104_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_044634523.1|291662_292745_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_148878576.1|292767_294855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753023.1|294910_295534_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	8.8e-29
WP_024753022.1|295533_297180_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002699542.1|297194_298214_-	thiamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002699538.1|298684_299650_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024753019.1|299680_300709_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_024753018.1|300759_301809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753017.1|302018_302633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002699530.1|302673_302955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148879397.1|303039_303216_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_024753016.1|303212_303650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878577.1|303816_305070_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_002696721.1|305194_305395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753013.1|305512_305737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878578.1|305889_306519_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_148878579.1|306466_306589_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024751992.1|307189_308206_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	30.3	9.0e-23
>prophage 3
NZ_CP042813	Treponema phagedenis strain S11.1 chromosome, complete genome	3436741	316998	387749	3436741	tRNA,protease,transposase,integrase	Lactobacillus_phage(12.5%)	56	317740:317786	318663:318709
WP_024752184.1|316998_317280_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047170260.1|317391_317739_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	43.4	4.3e-09
317740:317786	attL	ACATACATTTAGGGGATAAAAATACTGAACTGATATTGACATTTCCA	NA	NA	NA	NA
WP_024753009.1|317921_318203_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047170259.1|318314_318662_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	43.4	5.6e-09
WP_024753008.1|319253_320546_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
318663:318709	attR	ACATACATTTAGGGGATAAAAATACTGAACTGATATTGACATTTCCA	NA	NA	NA	NA
WP_002695388.1|320978_322109_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q6XM27	Feldmannia_irregularis_virus	34.9	2.2e-06
WP_002695389.1|322251_323064_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_002695391.1|323311_323767_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_002695393.1|323741_324335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753007.1|324343_325591_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002695397.1|325651_326614_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_024753006.1|326721_328182_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0U2SJ70	Niemeyer_virus	27.9	8.9e-40
WP_024753005.1|328337_328880_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024753004.1|328863_329577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753003.1|329587_331273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002695411.1|331613_332300_+	UMP kinase	NA	NA	NA	NA	NA
WP_148878581.1|332296_332827_+	DnaJ domain-containing protein	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	46.2	4.4e-13
WP_024753001.1|332832_333051_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024753000.1|333204_333567_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_148878582.1|333595_334960_-	response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	4.0e-34
WP_148878583.1|335035_335551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752998.1|335553_337422_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_024752997.1|337421_338429_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_024752996.1|339044_339812_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_024752995.1|339815_341222_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_148878584.1|342381_343887_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	34.1	8.8e-59
WP_148878585.1|344708_345311_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044634938.1|345349_347065_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	7.8e-35
WP_044634937.1|347064_348795_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	3.2e-28
WP_148883880.1|352247_352433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752213.1|352685_353924_-	OmpA family protein	NA	NA	NA	NA	NA
WP_148883881.1|354688_355441_-	ATP-binding cassette domain-containing protein	NA	A7K9T9	Acanthocystis_turfacea_chlorella_virus	28.3	1.2e-08
WP_024752211.1|355437_356481_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002698061.1|356477_357482_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.1	1.8e-60
WP_148878587.1|359343_359856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148879198.1|359864_360590_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024752208.1|360967_362773_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	44.8	1.2e-22
WP_024752207.1|362786_364493_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.5	3.4e-14
WP_024752206.1|364479_366516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002696680.1|366582_367941_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	22.8	4.7e-11
WP_002696682.1|368000_368636_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002696684.1|368948_369224_-	septation regulator SpoVG	NA	I3PV82	Clostridium_phage	41.7	7.8e-06
WP_024752205.1|369282_370155_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_024752922.1|371625_374748_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_024752923.1|375607_376360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878591.1|376352_377201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002700754.1|377227_377917_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	2.4e-19
WP_081718773.1|377913_379131_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002700756.1|379132_379861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044634994.1|379890_380931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752927.1|380917_381991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044634993.1|382323_383988_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024752929.1|384321_384939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081718774.1|385097_385319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148883882.1|385309_385507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878595.1|386627_387749_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 4
NZ_CP042813	Treponema phagedenis strain S11.1 chromosome, complete genome	3436741	491655	554769	3436741	protease,tail,transposase,integrase	Exiguobacterium_phage(25.0%)	59	495376:495391	554793:554808
WP_148878613.1|491655_492909_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_148878614.1|493076_493541_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_148878615.1|493816_494329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878616.1|494370_494565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878617.1|494569_495271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878618.1|495273_496209_-	AAA family ATPase	NA	NA	NA	NA	NA
495376:495391	attL	TCGATTGATAATCTTT	NA	NA	NA	NA
WP_148878619.1|496220_498101_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_148878620.1|498097_498439_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_148878621.1|498634_499018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878622.1|499485_500382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002695879.1|500408_500756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039943637.1|500805_501801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752645.1|501862_502321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082048222.1|502317_502932_+	phage morphogenesis protein	NA	NA	NA	NA	NA
WP_024751790.1|502921_503371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752647.1|503397_504249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878623.1|504330_504717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878624.1|504948_508707_+|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	32.5	1.2e-27
WP_002695900.1|508732_509170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878625.1|509203_509782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082048223.1|509899_512176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878626.1|512205_513570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024751798.1|513573_514128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752241.1|515687_516974_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_024752242.1|517095_519231_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	2.2e-07
WP_002699748.1|519296_519965_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002699750.1|519968_521219_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_024752243.1|521252_522782_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.9	1.4e-67
WP_024752244.1|522970_523468_-	cell division protein DedD	NA	A7KUY9	Bacillus_phage	47.0	3.5e-28
WP_148883887.1|523860_524196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148883888.1|524192_525197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878627.1|525201_527850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148879399.1|528200_529229_+	KamA family radical SAM protein	NA	NA	NA	NA	NA
WP_024752248.1|529414_530239_+	RNA polymerase sigma factor RpoD/SigA	NA	M4SMP8	Cyanophage	30.6	2.1e-22
WP_024752249.1|530257_531298_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002699771.1|531343_532276_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002699773.1|532272_533148_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_148878628.1|533144_534272_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	7.1e-29
WP_148878629.1|534604_535438_-	DNA adenine methylase	NA	A0A0H3UZK1	Geobacillus_virus	32.7	1.7e-27
WP_024751798.1|535546_536101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878549.1|536104_537406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082048223.1|537435_539712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751795.1|539829_540408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751794.1|540441_540879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878632.1|540903_544662_-|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	32.5	2.0e-27
WP_024751792.1|544893_545280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752647.1|545357_546209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751790.1|546235_546685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878633.1|546674_547289_-	phage morphogenesis protein	NA	NA	NA	NA	NA
WP_024752645.1|547285_547744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039943637.1|547805_548801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002695879.1|548850_549198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878622.1|549224_550121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878634.1|550319_550766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878635.1|550771_551149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878636.1|551220_551517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878637.1|551767_552355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878638.1|552550_552892_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_148878639.1|552888_554769_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
554793:554808	attR	TCGATTGATAATCTTT	NA	NA	NA	NA
>prophage 5
NZ_CP042813	Treponema phagedenis strain S11.1 chromosome, complete genome	3436741	964918	1038015	3436741	transposase,tRNA	uncultured_Mediterranean_phage(16.67%)	48	NA	NA
WP_148878779.1|964918_965941_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	30.3	9.1e-23
WP_148878780.1|966141_967395_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_024752306.1|968097_969324_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_044635033.1|970028_971228_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.6	1.3e-20
WP_148878781.1|971703_972957_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_148878782.1|973206_975108_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_148879412.1|977505_979053_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	41.6	1.3e-76
WP_148878529.1|981097_981973_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.4	2.4e-32
WP_148878783.1|981944_982709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753277.1|984200_985241_+	radical SAM protein	NA	NA	NA	NA	NA
WP_044634801.1|985256_985946_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_052812616.1|986092_987028_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_024753280.1|987069_987552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878784.1|988044_990171_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.5	2.9e-07
WP_002697760.1|991297_992524_+	aminopeptidase	NA	NA	NA	NA	NA
WP_002697758.1|992545_993181_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081718812.1|993171_994200_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_024753283.1|994279_995302_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_024753284.1|995661_997029_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_039914711.1|997122_997776_-	PTS transporter subunit EIIA	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	35.7	2.2e-06
WP_148878785.1|998079_998787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753287.1|998847_999051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148878786.1|999609_1000743_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024753289.1|1000796_1002332_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	1.4e-11
WP_024753290.1|1002321_1003440_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024753291.1|1003432_1004338_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002697730.1|1004549_1005002_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_024753292.1|1005007_1005892_+	DMT family transporter	NA	NA	NA	NA	NA
WP_148878787.1|1005996_1006206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044634501.1|1013001_1013283_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024753293.1|1013932_1015480_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	27.9	5.8e-13
WP_002698745.1|1015905_1016544_+	P13 family porin	NA	NA	NA	NA	NA
WP_044634368.1|1016814_1017534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002698755.1|1017610_1018081_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_148878788.1|1018092_1018467_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_039943845.1|1019005_1020847_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	33.3	8.5e-72
WP_148878789.1|1021383_1022658_-	aminoacetone oxidase family FAD-binding enzyme	NA	A0A2H4PQX1	Staphylococcus_phage	53.9	2.0e-19
WP_148883898.1|1022933_1023131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024753300.1|1023575_1025492_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	43.5	1.5e-135
WP_024753301.1|1025957_1026455_+	flavodoxin	NA	NA	NA	NA	NA
WP_081718814.1|1026703_1026886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024753302.1|1027090_1027420_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024753303.1|1027435_1028191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148879657.1|1028352_1029753_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_002698788.1|1031116_1031614_-	OmpA family protein	NA	NA	NA	NA	NA
WP_024753307.1|1033987_1036135_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	9.2e-09
WP_148878791.1|1036546_1037488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024752184.1|1037733_1038015_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP042813	Treponema phagedenis strain S11.1 chromosome, complete genome	3436741	1487488	1500679	3436741		Escherichia_phage(20.0%)	15	NA	NA
WP_024752513.1|1487488_1487881_+	ParB N-terminal domain-containing protein	NA	Q331U1	Clostridium_botulinum_C_phage	39.4	2.8e-17
WP_002695586.1|1488035_1488509_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002695584.1|1488573_1488954_+	RidA family protein	NA	NA	NA	NA	NA
WP_148883917.1|1488946_1490119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024752515.1|1490570_1491659_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D8EQC0	Escherichia_phage	44.2	7.5e-76
WP_002695569.1|1491658_1492528_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.9	3.7e-33
WP_002695567.1|1492524_1493070_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.7	1.0e-44
WP_002695565.1|1493069_1493945_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.9	6.4e-94
WP_148883918.1|1493954_1494944_-	NAD-dependent epimerase/dehydratase family protein	NA	M4QPK0	Synechococcus_phage	25.0	5.5e-09
WP_148883920.1|1494963_1495791_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002695559.1|1495787_1496834_-	acyltransferase	NA	Q716G0	Shigella_phage	23.6	2.3e-05
WP_002695558.1|1496924_1497875_-	capsular polysaccharide synthesis protein	NA	A0A0N7KVT5	Yellowstone_lake_phycodnavirus	32.5	5.1e-12
WP_002695556.1|1497874_1498699_-	LICD protein	NA	A0A1V0SAS8	Catovirus	35.9	2.8e-06
WP_002695544.1|1498731_1499814_-	EpsG family protein	NA	NA	NA	NA	NA
WP_148883922.1|1499890_1500679_-	glycosyl transferase	NA	A0A2K9L639	Tupanvirus	27.2	2.5e-12
>prophage 7
NZ_CP042813	Treponema phagedenis strain S11.1 chromosome, complete genome	3436741	1918579	1981759	3436741	protease,transposase,tRNA	Staphylococcus_phage(27.27%)	60	NA	NA
WP_002699091.1|1918579_1919173_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.9	3.1e-31
WP_024752388.1|1920964_1922398_+	amino acid permease	NA	NA	NA	NA	NA
WP_148878989.1|1923136_1924075_+	AEC family transporter	NA	NA	NA	NA	NA
WP_081718624.1|1924148_1924337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002699078.1|1924557_1924935_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002699076.1|1924947_1925814_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	2.0e-18
WP_024751880.1|1925815_1926511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878990.1|1926975_1927302_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_024751882.1|1927262_1927514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044634652.1|1927831_1928626_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.5	1.6e-43
WP_002698290.1|1928622_1929909_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.9	1.7e-90
WP_024751884.1|1929927_1930509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751886.1|1931384_1932134_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_148878991.1|1932553_1933198_-	DUF3160 domain-containing protein	NA	NA	NA	NA	NA
WP_148879429.1|1933139_1933238_-	DUF3160 domain-containing protein	NA	NA	NA	NA	NA
WP_148878992.1|1933262_1933820_-	DUF3160 domain-containing protein	NA	NA	NA	NA	NA
WP_082048214.1|1933771_1934425_-	DUF3160 domain-containing protein	NA	NA	NA	NA	NA
WP_024751890.1|1935289_1935673_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_024751891.1|1935717_1936347_-	adenylate kinase	NA	NA	NA	NA	NA
WP_081718631.1|1937061_1937250_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002698319.1|1937264_1937501_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_024751892.1|1937519_1938251_+	ribonuclease III	NA	L7RCJ8	Acanthamoeba_polyphaga_moumouvirus	30.3	1.3e-23
WP_024751992.1|1938414_1939431_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	30.3	9.0e-23
WP_148879972.1|1939629_1940355_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_052335628.1|1940870_1941494_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_024751894.1|1941888_1942608_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_039914919.1|1942597_1943131_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.8	5.8e-21
WP_002698332.1|1943370_1944306_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_002698334.1|1944388_1945423_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024751895.1|1945681_1946509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751896.1|1946523_1947222_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.3e-20
WP_024751897.1|1947224_1947584_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148878994.1|1948513_1951252_-	pyruvate, phosphate dikinase	NA	NA	NA	NA	NA
WP_024751899.1|1951263_1952286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751900.1|1952385_1954425_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_002698356.1|1954583_1955243_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_002698358.1|1955534_1956767_+	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_081718633.1|1956879_1957065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148878995.1|1957267_1958854_-|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_148878996.1|1958993_1959203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751902.1|1959468_1959960_-	universal stress protein	NA	NA	NA	NA	NA
WP_024751903.1|1960049_1960691_-	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_024751904.1|1960795_1965088_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.0	9.3e-69
WP_002698374.1|1965101_1968626_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.0	2.8e-47
WP_024751905.1|1969138_1969528_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002698382.1|1969664_1970294_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_024751906.1|1970295_1970976_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002698386.1|1970977_1971409_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002698388.1|1971491_1972049_-	transcription termination/antitermination factor NusG	NA	NA	NA	NA	NA
WP_024751907.1|1972058_1972238_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002698390.1|1972376_1972547_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_024751908.1|1972958_1973399_-	flavodoxin	NA	NA	NA	NA	NA
WP_024751909.1|1973421_1973997_-	DUF3793 family protein	NA	NA	NA	NA	NA
WP_148879500.1|1974692_1975946_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_002698401.1|1976185_1976578_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_148878999.1|1976587_1978075_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	2.0e-18
WP_024751911.1|1978091_1979036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002698409.1|1979154_1980048_+	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002698414.1|1980353_1980896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024751913.1|1981285_1981759_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP042813	Treponema phagedenis strain S11.1 chromosome, complete genome	3436741	2308306	2312956	3436741		Azospirillum_phage(16.67%)	8	NA	NA
WP_148879072.1|2308306_2308657_-	DUF1064 domain-containing protein	NA	B0VK09	Azospirillum_phage	46.6	1.2e-11
WP_024751714.1|2308653_2308935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024751735.1|2308931_2309261_-	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	41.5	9.4e-14
WP_148879073.1|2309364_2310186_-	oxidoreductase	NA	A0A139ZPI9	Marinitoga_camini_virus	42.1	2.3e-37
WP_081718571.1|2310280_2310622_-	hypothetical protein	NA	D2ECI8	Treponema_phage	64.9	2.8e-05
WP_148878659.1|2310649_2311153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148883949.1|2311461_2312160_-	site-specific DNA-methyltransferase	NA	E8ZD58	Streptococcus_phage	36.0	2.1e-31
WP_148879076.1|2312167_2312956_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	25.7	8.0e-11
>prophage 9
NZ_CP042813	Treponema phagedenis strain S11.1 chromosome, complete genome	3436741	2833728	2842497	3436741		Bacillus_phage(66.67%)	6	NA	NA
WP_044634516.1|2833728_2835525_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	2.0e-25
WP_024753047.1|2835521_2837255_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	1.6e-35
WP_044634515.1|2837428_2839114_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	9.6e-38
WP_044634514.1|2839110_2840844_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	1.8e-34
WP_024753050.1|2840963_2841626_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	26.7	1.2e-07
WP_024753051.1|2841618_2842497_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	4.1e-08
