The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041996	Escherichia coli strain AR Bank #0349 chromosome, complete genome	4995442	98903	103557	4995442	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_000624622.1|98903_99251_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|99250_99928_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_089075440.1|99904_100012_+	copper resistance protein	NA	NA	NA	NA	NA
WP_096427327.1|99977_100181_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	2.5e-33
WP_061092934.1|100837_102100_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	45.8	6.0e-93
WP_061092935.1|102096_102735_+	aldolase	NA	A0A077SK32	Escherichia_phage	52.7	6.6e-56
WP_061092936.1|102750_103557_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	42.1	4.2e-47
>prophage 2
NZ_CP041996	Escherichia coli strain AR Bank #0349 chromosome, complete genome	4995442	1109704	1199913	4995442	tail,plate,tRNA,head,transposase,integrase	Burkholderia_virus(37.5%)	102	1112359:1112374	1161188:1161203
WP_000889991.1|1109704_1110487_+|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_000807747.1|1110504_1110954_+	flavodoxin	NA	NA	NA	NA	NA
WP_000097082.1|1111388_1112741_+	MFS transporter	NA	NA	NA	NA	NA
1112359:1112374	attL	TTGCGCGTAAAACACC	NA	NA	NA	NA
WP_000211776.1|1112742_1114083_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	9.1e-07
WP_110826424.1|1114103_1115369_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_001571573.1|1115717_1116350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281696.1|1116464_1116863_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_000988473.1|1116834_1117287_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
WP_000123379.1|1117276_1117492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631814.1|1117481_1117712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131939.1|1117708_1118392_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	4.5e-34
WP_000197789.1|1118388_1118694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042203510.1|1118703_1118976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050559426.1|1119032_1119254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001381528.1|1119264_1119795_-	bacteriophage Mu Gam like family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|1119822_1120092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960680.1|1120094_1121261_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_110826423.1|1121271_1123041_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.6	3.1e-228
WP_061092904.1|1123056_1123374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106631226.1|1123373_1124291_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.0	2.4e-75
WP_029490537.1|1124301_1124610_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_021518100.1|1124663_1124852_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	1.8e-17
WP_029490538.1|1124940_1125306_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_110826422.1|1125424_1126189_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
WP_001069609.1|1126380_1126596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972292.1|1126594_1126999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194949.1|1126974_1127718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793145.1|1127848_1128199_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_001104438.1|1128201_1128939_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_001299256.1|1128967_1129579_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
WP_000175097.1|1129575_1129902_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227704.1|1129901_1130213_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000533684.1|1130215_1130758_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000137893.1|1130754_1132278_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
WP_021512536.1|1132277_1133774_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	6.1e-169
WP_000117556.1|1133754_1134576_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_000135514.1|1134578_1135037_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|1135251_1136367_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|1136381_1137335_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|1137344_1137683_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|1137684_1138131_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_021539012.1|1138130_1138595_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.0	1.3e-37
WP_012602372.1|1138591_1138846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|1138835_1140263_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|1140262_1140784_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|1140786_1141068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|1141165_1141501_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|1141424_1141583_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001529030.1|1141658_1144871_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	5.8e-84
WP_000458387.1|1144870_1145755_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|1145751_1145967_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_001529032.1|1145954_1147127_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
WP_000148265.1|1147123_1147720_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_000859116.1|1147774_1148122_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_001529034.1|1148112_1149216_+	hypothetical protein	NA	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000138756.1|1149208_1149787_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_096976434.1|1149789_1151721_+	short-chain fatty acid transporter	NA	A0A0K2FIZ6	Escherichia_phage	44.4	9.0e-40
WP_001529037.1|1151720_1152335_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_001529038.1|1152341_1152815_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
WP_000904922.1|1152886_1153459_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000186450.1|1153861_1156618_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046818.1|1156674_1157976_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.6e-38
WP_000226815.1|1158023_1160258_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_000581940.1|1160335_1160584_+	type II toxin-antitoxin system antitoxin MazE	NA	NA	NA	NA	NA
WP_000254738.1|1160583_1160919_+	endoribonuclease MazF	NA	NA	NA	NA	NA
WP_001071641.1|1160990_1161782_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
1161188:1161203	attR	GGTGTTTTACGCGCAA	NA	NA	NA	NA
WP_000210878.1|1162009_1163647_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|1163733_1165032_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_089075444.1|1165091_1165964_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001217974.1|1165969_1167118_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001243483.1|1167132_1168026_-	YgcG family protein	NA	NA	NA	NA	NA
WP_000944228.1|1168039_1168642_-	LemA family protein	NA	NA	NA	NA	NA
WP_001199974.1|1168814_1169486_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
WP_001232705.1|1169570_1170578_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032245922.1|1170603_1172013_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	22.7	5.6e-15
WP_061092716.1|1172012_1173383_-	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000277206.1|1173443_1174961_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001276284.1|1175131_1176049_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000039729.1|1176213_1177692_-	sugar kinase	NA	NA	NA	NA	NA
WP_001164562.1|1177718_1178996_-	MFS transporter	NA	NA	NA	NA	NA
WP_001361315.1|1179313_1180099_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.1e-20
WP_000059294.1|1180168_1181623_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_024179464.1|1181716_1183054_+	MFS transporter	NA	NA	NA	NA	NA
WP_001361314.1|1183031_1183811_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_001361313.1|1183807_1184668_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_001130256.1|1184814_1185390_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000109536.1|1185406_1185667_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_001361312.1|1185657_1186929_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000987944.1|1187006_1187372_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_000211339.1|1187687_1189487_+	NADPH-dependent assimilatory sulfite reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_001290706.1|1189486_1191199_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_000039852.1|1191272_1192007_+	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000956458.1|1192271_1192424_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000490426.1|1192549_1193587_-	alkaline phosphatase isozyme conversion aminopeptidase	NA	NA	NA	NA	NA
WP_000372392.1|1193838_1194747_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_001090363.1|1194748_1196176_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|1196175_1196781_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001246103.1|1196830_1197154_+	DUF3561 family protein	NA	NA	NA	NA	NA
WP_000517476.1|1197347_1197659_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_000246153.1|1197677_1198388_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001219237.1|1198387_1198867_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_000568908.1|1198863_1199913_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041996	Escherichia coli strain AR Bank #0349 chromosome, complete genome	4995442	1576789	1589717	4995442	integrase	Escherichia_phage(83.33%)	6	1571750:1571763	1578889:1578902
1571750:1571763	attL	GCGTATTTATTTTA	NA	NA	NA	NA
WP_001224627.1|1576789_1577359_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	9.1e-49
WP_001181154.1|1578107_1578737_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
WP_000243052.1|1579054_1579675_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
1578889:1578902	attR	TAAAATAAATACGC	NA	NA	NA	NA
WP_001361862.1|1579699_1587619_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	97.9	0.0e+00
WP_000100042.1|1587666_1588197_+	hypothetical protein	NA	A0A2L1IV11	Escherichia_phage	97.7	3.3e-85
WP_000368135.1|1588784_1589717_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
>prophage 4
NZ_CP041996	Escherichia coli strain AR Bank #0349 chromosome, complete genome	4995442	2886921	2932324	4995442	transposase,integrase,plate	Ralstonia_phage(20.0%)	45	2900847:2900861	2911382:2911396
WP_061093005.1|2886921_2888142_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	6.2e-79
WP_061093006.1|2888343_2888733_+	glyoxalase	NA	NA	NA	NA	NA
WP_061093007.1|2888875_2890339_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_000243502.1|2890391_2890949_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_061093008.1|2891344_2891650_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_061093009.1|2891646_2892012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001608346.1|2892316_2893195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001608347.1|2893198_2893507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093010.1|2894156_2895638_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_001142313.1|2895716_2896199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000177655.1|2896257_2896830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021513669.1|2896923_2897454_-	lipoprotein	NA	NA	NA	NA	NA
WP_061093011.1|2897888_2898362_+	DUF4755 domain-containing protein	NA	NA	NA	NA	NA
WP_001519851.1|2898393_2898771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519852.1|2898820_2899432_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001519853.1|2899448_2900885_-	hypothetical protein	NA	NA	NA	NA	NA
2900847:2900861	attL	ATCTTTTATGAAAAC	NA	NA	NA	NA
WP_021513673.1|2902188_2902575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021513674.1|2902702_2902927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519857.1|2903841_2904387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093067.1|2904541_2905021_+	DUF4756 family protein	NA	NA	NA	NA	NA
WP_061093068.1|2905178_2905583_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000505227.1|2905646_2905997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519860.1|2906101_2906344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032283297.1|2906417_2906714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059256365.1|2906758_2907049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021580845.1|2907130_2907349_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_021524272.1|2907564_2908401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302302.1|2908862_2909660_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_072652861.1|2910002_2911265_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.3	3.8e-71
WP_096427310.1|2911565_2912779_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	1.1e-102
2911382:2911396	attR	ATCTTTTATGAAAAC	NA	NA	NA	NA
WP_061093050.1|2912799_2913528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093049.1|2913807_2914599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061093048.1|2914807_2915107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061093047.1|2915159_2915639_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_061093046.1|2915660_2917016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123056338.1|2917026_2920458_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_061093044.1|2920566_2921994_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_061093043.1|2921998_2922742_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_061093042.1|2922738_2925477_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.1	2.9e-84
WP_123056339.1|2925488_2926229_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_061093041.1|2926311_2927655_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_061093040.1|2927657_2928191_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_061093052.1|2928187_2929474_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_061093053.1|2929490_2930534_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_061093039.1|2930500_2932324_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP041996	Escherichia coli strain AR Bank #0349 chromosome, complete genome	4995442	2958069	2968727	4995442	transposase,integrase	uncultured_Caudovirales_phage(33.33%)	11	2957826:2957885	2975138:2975219
2957826:2957885	attL	ATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGA	NA	NA	NA	NA
WP_072693178.1|2958069_2959332_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.8	2.5e-70
WP_021550960.1|2959455_2959773_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	41.9	9.3e-11
WP_016248851.1|2959776_2960085_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_052895708.1|2960207_2960501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249107.1|2960503_2961217_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.5	8.2e-23
WP_061093069.1|2961261_2961603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148906086.1|2961613_2965702_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	35.6	1.5e-23
WP_085949836.1|2965849_2967062_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_061092891.1|2967066_2967402_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_077249124.1|2967840_2968476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061092889.1|2968472_2968727_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.2	1.7e-15
2975138:2975219	attR	ATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATT	NA	NA	NA	NA
>prophage 6
NZ_CP041996	Escherichia coli strain AR Bank #0349 chromosome, complete genome	4995442	3015859	3027117	4995442		Acanthocystis_turfacea_Chlorella_virus(25.0%)	10	NA	NA
WP_000704860.1|3015859_3017026_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
WP_000043484.1|3017273_3018680_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000736848.1|3018843_3020214_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	6.4e-32
WP_000868618.1|3020238_3020985_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	41.6	2.1e-08
WP_001361571.1|3021068_3022454_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	1.9e-47
WP_001042472.1|3022465_3022921_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000163129.1|3022923_3023889_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.7	9.9e-88
WP_000335121.1|3023892_3025014_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.7	2.2e-131
WP_000699784.1|3025024_3026032_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000026026.1|3026100_3027117_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.3	6.3e-77
>prophage 7
NZ_CP041996	Escherichia coli strain AR Bank #0349 chromosome, complete genome	4995442	3139257	3148699	4995442		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292746.1|3139257_3140394_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
WP_001361589.1|3140390_3142391_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	94.9	0.0e+00
WP_001296231.1|3142515_3142977_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001361590.1|3143017_3143488_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.5e-81
WP_001308766.1|3143534_3144254_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001334139.1|3144250_3145936_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001240398.1|3146157_3146889_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|3146948_3147056_+	protein YohO	NA	NA	NA	NA	NA
WP_000783133.1|3147036_3147768_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569365.1|3147772_3148699_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 8
NZ_CP041996	Escherichia coli strain AR Bank #0349 chromosome, complete genome	4995442	3503509	3551752	4995442	tail,protease,lysis,terminase,head,capsid,integrase,holin,portal	Enterobacteria_phage(50.0%)	67	3503041:3503087	3551766:3551812
3503041:3503087	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_061092798.1|3503509_3504463_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226375.1|3504649_3506134_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|3506672_3507341_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001309429.1|3507285_3507423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016245272.1|3507533_3507827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235975.1|3507837_3508542_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	62.3	5.4e-59
WP_061092797.1|3508551_3508833_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	2.7e-17
WP_061092796.1|3508832_3511205_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	68.8	7.9e-163
WP_001228252.1|3511269_3511869_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_061092795.1|3511936_3515416_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_000090882.1|3515476_3516079_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_024177847.1|3516015_3516759_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.8e-145
WP_001518412.1|3516763_3517462_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	9.9e-130
WP_000847401.1|3517461_3517791_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001567091.1|3517787_3520349_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.2	0.0e+00
WP_001518410.1|3520341_3520731_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.1	3.4e-55
WP_001518409.1|3520757_3521180_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
WP_001518408.1|3521195_3521936_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.5	2.4e-126
WP_000683145.1|3521943_3522339_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001518407.1|3522335_3522914_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752994.1|3522925_3523279_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001518405.1|3523290_3523689_-	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	84.1	5.2e-51
WP_000063252.1|3523730_3524756_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	3.9e-191
WP_001299443.1|3524811_3525144_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_001518402.1|3525153_3526473_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	4.8e-234
WP_001518401.1|3526453_3528055_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.1e-309
WP_000198149.1|3528051_3528258_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001518400.1|3528254_3530180_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453566.1|3530154_3530700_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001307652.1|3531088_3531283_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|3531645_3531939_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3532029_3532212_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001518397.1|3532428_3532905_-	glycoside hydrolase family protein	NA	K7PKX1	Enterobacterial_phage	96.1	9.5e-84
WP_001120496.1|3532908_3533235_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_000355468.1|3533526_3534702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150292.1|3534704_3535919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205470.1|3535898_3536255_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_032139865.1|3536339_3536480_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|3536476_3536839_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|3536835_3537126_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224919.1|3537118_3537289_-	NinE family protein	NA	NA	NA	NA	NA
WP_001053033.1|3537288_3537744_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_001309322.1|3537740_3537842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|3537940_3538870_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001567061.1|3539074_3539392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|3539503_3541030_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_032139864.1|3541087_3541195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|3541286_3541619_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145912.1|3541686_3541989_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	94.6	2.6e-42
WP_001566186.1|3541985_3542687_-	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.0	7.9e-127
WP_061092802.1|3542683_3543613_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.4	4.7e-111
WP_061092794.1|3543699_3544239_-	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_001067459.1|3544320_3544551_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_064767403.1|3544655_3545345_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.4	1.2e-92
WP_061092792.1|3545425_3545695_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	75.3	4.8e-32
WP_061092791.1|3545826_3546144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061092790.1|3546699_3546906_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.3	4.2e-28
WP_000995439.1|3546981_3547278_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_052953584.1|3547283_3548069_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_024228451.1|3548065_3548746_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_045173744.1|3548742_3548901_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	1.8e-23
WP_032255841.1|3548897_3549455_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.9	3.2e-62
WP_001386642.1|3549465_3549747_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|3549845_3550064_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3550111_3550390_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|3550361_3550733_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_061092788.1|3550588_3551752_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	3.7e-198
3551766:3551812	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP041996	Escherichia coli strain AR Bank #0349 chromosome, complete genome	4995442	4547499	4592888	4995442	tRNA,tail,plate	Burkholderia_phage(31.58%)	46	NA	NA
WP_012602639.1|4547499_4548537_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_022646425.1|4548898_4549903_-	DUF2713 family protein	NA	NA	NA	NA	NA
WP_061092769.1|4550220_4550736_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001296638.1|4550777_4550987_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001562441.1|4551102_4552428_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|4552500_4553109_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|4553218_4553587_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|4553757_4556181_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455227.1|4556335_4557208_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001308201.1|4557220_4557718_-	chorismate lyase	NA	NA	NA	NA	NA
WP_061092770.1|4557940_4559521_-	SopA family protein	NA	NA	NA	NA	NA
WP_001361468.1|4559748_4560669_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973665.1|4560911_4562252_-	maltoporin LamB	NA	NA	NA	NA	NA
WP_000179165.1|4562323_4563439_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000695387.1|4563803_4564994_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_001361466.1|4565147_4566692_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252058.1|4566706_4567597_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000202902.1|4567690_4568101_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001328330.1|4568315_4568594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000745730.1|4568640_4570737_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000595548.1|4570736_4571474_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001361463.1|4571470_4572109_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757333.1|4572222_4572465_-	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_000789981.1|4572818_4574468_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001290321.1|4574992_4576342_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000619864.1|4576396_4576744_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_000758131.1|4577281_4577569_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	1.5e-15
WP_000266448.1|4577571_4578177_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_000777272.1|4578189_4578504_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_000404767.1|4578648_4579104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|4579100_4579298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729835.1|4579287_4580712_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.4	3.2e-191
WP_000907502.1|4580711_4581236_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_000658214.1|4581286_4581604_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_015674804.1|4581563_4581692_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000271436.1|4584168_4585122_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_001269711.1|4585121_4585331_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_001361462.1|4585318_4586359_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	44.8	4.4e-73
WP_000679401.1|4586368_4587070_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	4.9e-12
WP_001093498.1|4587168_4587528_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000951744.1|4587518_4588634_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.4	6.9e-101
WP_000359520.1|4588626_4589343_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	1.8e-22
WP_000135569.1|4589345_4590926_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.8	1.3e-84
WP_061092771.1|4590922_4591630_+	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	4.1e-14
WP_061092772.1|4591626_4592082_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	2.3e-26
WP_061092773.1|4592096_4592888_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
>prophage 1
NZ_CP041997	Escherichia coli strain AR Bank #0349 plasmid pAR349, complete sequence	278067	7170	45277	278067	transposase,integrase	Salmonella_phage(30.77%)	31	NA	NA
WP_000608644.1|7170_8433_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015387340.1|8688_9564_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001393253.1|9610_9943_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_072794551.1|9866_10091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089727.1|10120_11200_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|11304_11628_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071819239.1|11788_12271_+	hypothetical protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	2.9e-40
WP_001067855.1|12161_12866_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|14503_14746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|14777_15455_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001351729.1|17783_18176_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000844627.1|19988_20231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000058717.1|22247_23132_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|23269_23662_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000470728.1|25746_26424_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000058717.1|27732_28617_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|28754_29147_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001067855.1|30780_31485_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015344971.1|32029_32314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|32282_33296_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|33451_33925_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|33994_34699_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_072794601.1|35069_38036_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_000427619.1|38114_39119_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|39300_39477_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001082320.1|40680_41484_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|41483_42320_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000027057.1|42550_43411_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|43593_44151_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_012512979.1|44296_44476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|44572_45277_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP041997	Escherichia coli strain AR Bank #0349 plasmid pAR349, complete sequence	278067	99547	145093	278067	transposase,integrase,protease	Escherichia_phage(23.08%)	51	94496:94509	107013:107026
94496:94509	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_012478345.1|99547_100522_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_049589868.1|100717_102343_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_077248209.1|102390_103137_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_001805195.1|103162_103507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|103528_104704_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|104874_105087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|105447_106530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|106696_108196_-	kinase	NA	NA	NA	NA	NA
107013:107026	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|108221_109859_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|109858_110899_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|110984_111623_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|111622_112264_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|112286_112925_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|113387_113855_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|113872_115081_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|115091_116048_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|116047_117127_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|117128_117902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|117894_119037_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|119046_120105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|120428_121010_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|121009_122167_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|122189_122645_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_062914744.1|122667_123708_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|123756_124335_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|124402_124978_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|125406_126648_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|127210_127492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|127541_127733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|127824_128196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|128538_128931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624349.1|128909_129221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|129534_129828_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|129832_131158_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|131218_131425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|131526_131937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053276223.1|131949_132765_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_001043843.1|133018_133444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|133992_134301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|134316_135174_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_071940961.1|135235_135484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077250418.1|136022_136448_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	7.6e-08
WP_063120614.1|137147_138281_-	permease	NA	NA	NA	NA	NA
WP_001175593.1|138386_138710_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|139252_139957_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032193599.1|139986_140691_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_076751466.1|140893_141082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|141263_142268_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000105383.1|142685_144122_-	glutathione synthase	NA	NA	NA	NA	NA
WP_071525219.1|144209_144398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|144388_145093_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP041997	Escherichia coli strain AR Bank #0349 plasmid pAR349, complete sequence	278067	148431	189020	278067	transposase,protease	Escherichia_phage(53.85%)	43	NA	NA
WP_001389365.1|148431_149196_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067858.1|149363_150068_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000490638.1|150385_151051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|151108_151489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|152131_152950_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|152946_154152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121165.1|154215_154419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|154431_155751_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|156001_157429_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|157643_158159_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|158161_159058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|159279_159513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|159558_159813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136338.1|159850_160138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|160174_160405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|160741_161203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|161232_161640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|161690_162008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|162384_162735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|164424_165129_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071448054.1|165134_165881_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839979.1|165880_166399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|166403_166820_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001617865.1|167431_168307_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_001067855.1|168609_169314_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|169427_170204_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000171321.1|170224_170446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000742814.1|170432_171458_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|171879_172632_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|174442_174928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|175124_176215_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_110826437.1|176304_177120_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.2	1.3e-08
WP_000251875.1|177206_177509_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|177402_177654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|177684_179178_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|179289_179595_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|179622_180837_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|181053_181938_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|182539_183244_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001317540.1|185655_186372_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
WP_001398199.1|187682_188084_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|188016_188274_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|188366_189020_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP041997	Escherichia coli strain AR Bank #0349 plasmid pAR349, complete sequence	278067	257155	268636	278067	transposase,integrase,protease	Macacine_betaherpesvirus(33.33%)	14	245087:245103	275952:275968
245087:245103	attL	TTTCACGCAGGGAAAAC	NA	NA	NA	NA
WP_001066954.1|257155_257896_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|258016_258205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|258578_259487_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|259549_260659_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_001332051.1|260717_261002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000280980.1|261091_262045_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001332050.1|262148_262538_+|protease	outer membrane protease	protease	NA	NA	NA	NA
WP_001513519.1|262904_263168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077248528.1|263317_263500_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085949156.1|263659_264872_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_001259759.1|266053_266257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014640552.1|266234_266471_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|266934_267216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012478345.1|267661_268636_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
275952:275968	attR	GTTTTCCCTGCGTGAAA	NA	NA	NA	NA
