The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043213	Escherichia coli O16:H48 strain CV601gfp chromosome, complete genome	4698238	706125	766760	4698238	integrase,transposase	Acinetobacter_phage(28.57%)	57	715947:715962	773142:773157
WP_000006255.1|706125_706623_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|706846_708586_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|708545_709316_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|709386_710442_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|710493_710787_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|710789_711188_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|711197_711650_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|711955_712222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|712154_712691_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|712747_714205_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|714465_714924_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|715015_716260_+	esterase FrsA	NA	NA	NA	NA	NA
715947:715962	attL	AACAGGTGCCGGAAAT	NA	NA	NA	NA
WP_072647358.1|716317_716647_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_001102108.1|718533_719253_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|719779_720634_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|720859_722185_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|722293_722530_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|722541_723135_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085947771.1|724407_725570_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000020224.1|725616_726504_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|727618_727720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|728083_728347_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|728346_728487_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|728521_728749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|729572_730115_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|730189_730777_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|730834_731503_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|731528_734054_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|734043_735687_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|735655_736366_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|736678_737008_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|737255_737870_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|738287_738977_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|738973_739930_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|739926_742125_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|742134_743091_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|743069_743480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|743764_745165_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|745281_745722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|745718_745943_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|746061_746916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|746942_747641_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|747912_748539_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|748629_749361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|750555_751560_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|751698_752457_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|752461_754072_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|754083_755466_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|755692_757660_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|757674_758583_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|758877_760032_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001030800.1|760125_760476_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000015532.1|760498_760837_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_000192349.1|762058_763105_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000081352.1|763213_764146_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001393629.1|764132_765536_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_010723085.1|765743_766760_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
773142:773157	attR	AACAGGTGCCGGAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP043213	Escherichia coli O16:H48 strain CV601gfp chromosome, complete genome	4698238	940842	1005136	4698238	terminase,lysis,tRNA,transposase,integrase,protease	Enterobacteria_phage(48.28%)	64	987794:987840	1009096:1009142
WP_001295836.1|940842_941466_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|941436_942123_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|942119_944534_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|944964_949245_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|949284_949653_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|950343_950604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|951835_952930_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|952998_953925_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|954154_954637_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|954714_955530_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|955619_957401_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|957413_958190_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|958289_959168_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|959336_960791_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|960850_962212_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|962268_963570_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|963591_964737_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|964964_965750_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|965760_966996_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|967017_968067_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|968383_970051_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|970060_971320_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|971330_972146_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|972142_973036_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|973230_974298_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|974294_974804_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|974921_975644_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|975646_976141_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|976314_977700_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|977735_978257_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|978364_978577_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|978578_979445_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|979915_980458_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|980677_981370_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001350487.1|983981_985022_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|985032_985548_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_085947917.1|985993_987266_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
987794:987840	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|987853_989017_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|989136_989400_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|989722_989818_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|989880_991042_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|991353_991686_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|991733_991883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|991940_993467_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|993931_994483_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|994492_995290_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|995406_995508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|995504_995960_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|995959_996130_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|996122_996413_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|996409_996772_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|996768_996909_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|996994_997378_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|997775_998792_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|998796_999864_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|1000436_1000652_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1000651_1001149_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1001365_1001548_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1001638_1001932_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1002222_1002633_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1002918_1003125_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1003289_1003484_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|1003872_1004418_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|1004392_1005136_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1009096:1009142	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP043213	Escherichia coli O16:H48 strain CV601gfp chromosome, complete genome	4698238	1230453	1280798	4698238	terminase,lysis,tail,holin,capsid,portal,integrase,head,protease	Enterobacteria_phage(75.36%)	70	1228731:1228746	1253531:1253546
1228731:1228746	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533640.1|1230453_1231524_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|1231501_1231720_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|1231759_1231927_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|1232015_1232297_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|1232488_1233037_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|1233033_1233255_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000548551.1|1233646_1233838_-	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000149542.1|1233810_1233993_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|1233989_1234670_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|1234666_1235452_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|1235457_1235754_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|1235828_1235972_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1235940_1236105_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|1236177_1236546_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|1236728_1236929_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|1237195_1237678_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001564525.1|1237678_1238002_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_001245922.1|1238466_1238901_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|1238916_1239756_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104863.1|1239868_1240582_-	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000437875.1|1240682_1240883_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|1241001_1241295_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|1241327_1242227_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|1242223_1242925_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|1242921_1243212_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|1243285_1243726_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|1243722_1244595_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|1244591_1244765_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|1244731_1244914_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|1244910_1245081_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|1245073_1245685_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000144614.1|1245681_1245888_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271136.1|1245865_1246531_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|1246527_1247151_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_012767708.1|1247262_1247457_+	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
WP_000783735.1|1247827_1248151_+|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_000229403.1|1248134_1248611_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_012738274.1|1248827_1249010_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|1249100_1249394_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012775990.1|1249683_1250094_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|1250379_1250586_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1250750_1250945_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453580.1|1251333_1251879_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|1251853_1253779_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
1253531:1253546	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000198149.1|1253775_1253982_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|1253978_1255580_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|1255560_1256880_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|1256889_1257222_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|1257277_1258303_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|1258344_1258743_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|1258754_1259108_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|1259119_1259698_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|1259694_1260090_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|1260097_1260838_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|1260853_1261276_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1261257_1261692_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840207.1|1261684_1264246_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000847379.1|1264242_1264572_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|1264571_1265270_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|1265275_1266019_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090889.1|1265955_1266588_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000515496.1|1266648_1270047_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_001246632.1|1270108_1270729_+	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_001407643.1|1270793_1273118_+	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_016063193.1|1273117_1273702_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_000162952.1|1273830_1275063_-	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_000735931.1|1275653_1276544_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000889231.1|1276540_1278118_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000767389.1|1278973_1279450_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001295303.1|1279508_1280798_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 4
NZ_CP043213	Escherichia coli O16:H48 strain CV601gfp chromosome, complete genome	4698238	1671400	1685777	4698238	integrase,plate,portal,tail	Shigella_phage(29.41%)	23	1670362:1670375	1688389:1688402
1670362:1670375	attL	ATTCATCTTATTTT	NA	NA	NA	NA
WP_000741310.1|1671400_1672528_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1672508_1672754_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1672790_1673102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1673218_1673560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1673497_1673806_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1673980_1674655_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1674745_1674946_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1674989_1675547_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1675722_1675902_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1675891_1677259_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1677270_1677453_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1677452_1677926_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1677852_1678644_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1678634_1679219_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_126505487.1|1679890_1680265_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	6.4e-27
WP_000548498.1|1680236_1680839_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_000905001.1|1681402_1681957_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1682063_1682897_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943927.1|1683130_1683295_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1683397_1683721_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1684257_1684368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1684420_1684825_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1685045_1685777_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1688389:1688402	attR	ATTCATCTTATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP043213	Escherichia coli O16:H48 strain CV601gfp chromosome, complete genome	4698238	1866594	1907412	4698238	lysis,tail,tRNA,transposase,integrase	Escherichia_phage(43.75%)	46	1867741:1867759	1898116:1898134
WP_010723085.1|1866594_1867611_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1867741:1867759	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1867883_1868141_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1868190_1869141_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1869292_1870045_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1870239_1870755_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1870765_1872292_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1872328_1873774_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1873773_1875084_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1875259_1876168_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1876497_1877061_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1877081_1878314_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1878568_1879552_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1880029_1881403_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1881531_1882467_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1882518_1883754_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1883755_1883971_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1884049_1884259_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1884251_1884446_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1884502_1885312_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1885304_1887905_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1888006_1888282_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1888356_1888527_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1888526_1888748_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1889189_1889678_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1889674_1889830_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|1889840_1889975_-	phage protein	NA	NA	NA	NA	NA
WP_000948459.1|1890283_1890760_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1890883_1891180_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1891202_1891625_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1891637_1892495_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1892501_1893248_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1893270_1893831_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1893918_1894104_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1894300_1895758_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1895895_1896159_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1896139_1896499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|1896606_1896807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1898264_1899245_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1898116:1898134	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_089418980.1|1899287_1899503_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
WP_000279097.1|1899567_1902930_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1902929_1903505_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1903602_1904193_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1904509_1904743_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1904811_1904925_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1905703_1906138_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1906278_1907412_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 6
NZ_CP043213	Escherichia coli O16:H48 strain CV601gfp chromosome, complete genome	4698238	2101307	2120518	4698238	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2101307_2102768_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2102856_2104140_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2104744_2104858_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2104926_2105160_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|2105476_2106067_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2106164_2106740_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2106739_2107702_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2107652_2108222_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2108610_2108844_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2108901_2109312_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2109463_2109637_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2109808_2109964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2110042_2110108_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2110110_2110299_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2110309_2110522_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2110884_2111382_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2111378_2111912_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2111908_2112220_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2112224_2112440_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2113193_2113409_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2113709_2113922_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2113976_2114066_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2114343_2115096_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2115109_2116159_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2116160_2116439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2116505_2116757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2116973_2117129_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2117200_2117488_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2117487_2117727_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2117751_2118057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2118259_2118592_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2119028_2119178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2119474_2119705_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2119788_2120196_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2120362_2120518_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 7
NZ_CP043213	Escherichia coli O16:H48 strain CV601gfp chromosome, complete genome	4698238	2938694	2951165	4698238	integrase,transposase,tail	Enterobacteria_phage(43.75%)	17	2936669:2936685	2954840:2954856
2936669:2936685	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2938694_2939627_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2939938_2941096_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2941248_2941611_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_085947771.1|2941759_2942921_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001030215.1|2943785_2945117_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2945151_2945433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2945731_2946172_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2946198_2946717_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2946766_2947042_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2947041_2947536_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2947532_2947901_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2948258_2948621_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2948686_2949511_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2949638_2950175_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2950165_2950528_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2950527_2950833_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2950964_2951165_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2954840:2954856	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP043213	Escherichia coli O16:H48 strain CV601gfp chromosome, complete genome	4698238	3324950	3332089	4698238		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3324950_3327512_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3327617_3328274_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|3328324_3329092_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|3329287_3330196_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3330192_3331359_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|3331450_3332089_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 9
NZ_CP043213	Escherichia coli O16:H48 strain CV601gfp chromosome, complete genome	4698238	3940279	3947505	4698238		Streptococcus_phage(33.33%)	9	NA	NA
WP_069106888.1|3940279_3941074_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	99.2	1.1e-153
WP_046835546.1|3941138_3941855_-	hypothetical protein	NA	A0A1I9LJQ6	Stx_converting_phage	100.0	5.4e-139
WP_148871284.1|3942024_3943116_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.1e-13
WP_000124700.1|3943186_3945301_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138045.1|3945328_3945868_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|3945964_3946339_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|3946464_3946752_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|3946759_3947119_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|3947118_3947505_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
