The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043199	Escherichia coli O16:H48 strain PG20180060 chromosome, complete genome	4668071	1267510	1328145	4668071	integrase,transposase	Acinetobacter_phage(28.57%)	57	1277332:1277347	1334527:1334542
WP_000006255.1|1267510_1268008_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|1268231_1269971_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|1269930_1270701_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1270771_1271827_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|1271878_1272172_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|1272174_1272573_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1272582_1273035_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|1273340_1273607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1273539_1274076_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|1274132_1275590_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1275850_1276309_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|1276400_1277645_+	esterase FrsA	NA	NA	NA	NA	NA
1277332:1277347	attL	AACAGGTGCCGGAAAT	NA	NA	NA	NA
WP_072647358.1|1277702_1278032_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_001102108.1|1279918_1280638_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|1281164_1282019_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|1282244_1283570_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|1283678_1283915_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|1283926_1284520_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085947771.1|1285792_1286955_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000020224.1|1287001_1287889_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000662258.1|1289003_1289105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|1289468_1289732_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|1289731_1289872_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|1289906_1290134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|1290957_1291500_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|1291574_1292162_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|1292219_1292888_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|1292913_1295439_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|1295428_1297072_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|1297040_1297751_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|1298063_1298393_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|1298640_1299255_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|1299672_1300362_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|1300358_1301315_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|1301311_1303510_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|1303519_1304476_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|1304454_1304865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1305149_1306550_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|1306666_1307107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1307103_1307328_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|1307446_1308301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|1308327_1309026_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|1309297_1309924_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|1310014_1310746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|1311940_1312945_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|1313083_1313842_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|1313846_1315457_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|1315468_1316851_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|1317077_1319045_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|1319059_1319968_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|1320262_1321417_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001030800.1|1321510_1321861_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000015532.1|1321883_1322222_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_000192349.1|1323443_1324490_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000081352.1|1324598_1325531_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001393629.1|1325517_1326921_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_010723085.1|1327128_1328145_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1334527:1334542	attR	AACAGGTGCCGGAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP043199	Escherichia coli O16:H48 strain PG20180060 chromosome, complete genome	4668071	1502227	1566522	4668071	lysis,tRNA,transposase,terminase,protease,integrase	Enterobacteria_phage(48.28%)	65	1549180:1549226	1570482:1570528
WP_001295836.1|1502227_1502851_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1502821_1503508_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1503504_1505919_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1506349_1510630_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1510669_1511038_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1511728_1511989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1513220_1514315_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1514383_1515310_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1515539_1516022_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1516099_1516915_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1517004_1518786_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1518798_1519575_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1519674_1520553_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1520721_1522176_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1522235_1523597_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1523653_1524955_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1524976_1526122_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|1526349_1527135_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1527145_1528381_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1528402_1529452_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1529768_1531436_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1531445_1532705_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1532715_1533531_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1533527_1534421_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1534615_1535683_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1535679_1536189_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1536306_1537029_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1537031_1537526_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1537699_1539085_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1539120_1539642_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1539749_1539962_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1539963_1540830_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1541300_1541843_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1542062_1542755_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1542785_1545389_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1545367_1546408_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1546418_1546934_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_085947917.1|1547379_1548652_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
1549180:1549226	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1549239_1550403_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1550522_1550786_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1551108_1551204_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|1551266_1552428_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|1552739_1553072_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1553119_1553269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1553326_1554853_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1555317_1555869_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1555878_1556676_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1556792_1556894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1556890_1557346_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1557345_1557516_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1557508_1557799_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1557795_1558158_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1558154_1558295_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1558380_1558764_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|1559161_1560178_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|1560182_1561250_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|1561822_1562038_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1562037_1562535_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1562751_1562934_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1563024_1563318_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1563608_1564019_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1564304_1564511_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1564675_1564870_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|1565258_1565804_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|1565778_1566522_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1570482:1570528	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP043199	Escherichia coli O16:H48 strain PG20180060 chromosome, complete genome	4668071	1791840	1842185	4668071	tail,capsid,lysis,head,terminase,protease,portal,holin,integrase	Enterobacteria_phage(75.36%)	70	1790118:1790133	1814918:1814933
1790118:1790133	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533640.1|1791840_1792911_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|1792888_1793107_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|1793146_1793314_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|1793402_1793684_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|1793875_1794424_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|1794420_1794642_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000548551.1|1795033_1795225_-	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000149542.1|1795197_1795380_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|1795376_1796057_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|1796053_1796839_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|1796844_1797141_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|1797215_1797359_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1797327_1797492_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|1797564_1797933_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|1798115_1798316_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|1798582_1799065_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001564525.1|1799065_1799389_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_001245922.1|1799853_1800288_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|1800303_1801143_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104863.1|1801255_1801969_-	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000437875.1|1802069_1802270_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|1802388_1802682_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|1802714_1803614_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|1803610_1804312_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|1804308_1804599_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|1804672_1805113_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|1805109_1805982_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|1805978_1806152_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|1806118_1806301_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|1806297_1806468_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|1806460_1807072_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000144614.1|1807068_1807275_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271136.1|1807252_1807918_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|1807914_1808538_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_012767708.1|1808649_1808844_+	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
WP_000783735.1|1809214_1809538_+|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_000229403.1|1809521_1809998_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_012738274.1|1810214_1810397_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|1810487_1810781_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012775990.1|1811070_1811481_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|1811766_1811973_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1812137_1812332_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453580.1|1812720_1813266_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|1813240_1815166_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
1814918:1814933	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000198149.1|1815162_1815369_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|1815365_1816967_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|1816947_1818267_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|1818276_1818609_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|1818664_1819690_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|1819731_1820130_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|1820141_1820495_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|1820506_1821085_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|1821081_1821477_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|1821484_1822225_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|1822240_1822663_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1822644_1823079_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840207.1|1823071_1825633_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000847379.1|1825629_1825959_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|1825958_1826657_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|1826662_1827406_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090889.1|1827342_1827975_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000515496.1|1828035_1831434_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_001246632.1|1831495_1832116_+	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_001407643.1|1832180_1834505_+	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_016063193.1|1834504_1835089_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_000162952.1|1835217_1836450_-	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_000735931.1|1837040_1837931_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000889231.1|1837927_1839505_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000767389.1|1840360_1840837_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001295303.1|1840895_1842185_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 4
NZ_CP043199	Escherichia coli O16:H48 strain PG20180060 chromosome, complete genome	4668071	2225775	2247168	4668071	tail,tRNA,portal,plate,integrase	Shigella_phage(25.0%)	32	2217770:2217784	2253871:2253885
2217770:2217784	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|2225775_2226882_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2226935_2227397_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|2227406_2228060_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|2228231_2229482_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|2229975_2230641_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|2230641_2231346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|2231803_2232697_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|2232787_2233915_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|2233895_2234141_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|2234177_2234489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|2234605_2234947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|2234884_2235193_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|2235367_2236042_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|2236132_2236333_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|2236376_2236934_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|2237109_2237289_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|2237278_2238646_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|2238657_2238840_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|2238839_2239313_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|2239239_2240031_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|2240021_2240606_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|2240609_2241239_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|2241240_2241654_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|2241625_2242228_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|2242227_2242722_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|2242793_2243348_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|2243454_2244288_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943927.1|2244521_2244686_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|2244788_2245112_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|2245648_2245759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|2245811_2246216_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|2246436_2247168_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
2253871:2253885	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 5
NZ_CP043199	Escherichia coli O16:H48 strain PG20180060 chromosome, complete genome	4668071	2427985	2468803	4668071	tail,lysis,tRNA,transposase,integrase	Escherichia_phage(43.75%)	46	2429132:2429150	2459507:2459525
WP_010723085.1|2427985_2429002_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
2429132:2429150	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|2429274_2429532_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|2429581_2430532_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|2430683_2431436_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|2431630_2432146_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|2432156_2433683_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|2433719_2435165_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|2435164_2436475_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|2436650_2437559_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|2437888_2438452_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|2438472_2439705_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2439959_2440943_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2441420_2442794_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2442922_2443858_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2443909_2445145_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2445146_2445362_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2445440_2445650_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2445642_2445837_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2445893_2446703_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2446695_2449296_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2449397_2449673_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2449747_2449918_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2449917_2450139_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2450580_2451069_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2451065_2451221_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|2451231_2451366_-	phage protein	NA	NA	NA	NA	NA
WP_000948459.1|2451674_2452151_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2452274_2452571_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2452593_2453016_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2453028_2453886_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2453892_2454639_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2454661_2455222_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2455309_2455495_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2455691_2457149_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2457286_2457550_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2457530_2457890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|2457997_2458198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2459655_2460636_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2459507:2459525	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_089418980.1|2460678_2460894_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
WP_000279097.1|2460958_2464321_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000885611.1|2464320_2464896_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086525.1|2464993_2465584_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2465900_2466134_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2466202_2466316_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2467094_2467529_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2467669_2468803_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 6
NZ_CP043199	Escherichia coli O16:H48 strain PG20180060 chromosome, complete genome	4668071	2662698	2681909	4668071	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2662698_2664159_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2664247_2665531_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2666135_2666249_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2666317_2666551_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086525.1|2666867_2667458_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2667555_2668131_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2668130_2669093_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2669043_2669613_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2670001_2670235_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2670292_2670703_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2670854_2671028_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2671199_2671355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2671433_2671499_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2671501_2671690_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2671700_2671913_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2672275_2672773_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2672769_2673303_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2673299_2673611_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2673615_2673831_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2674584_2674800_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2675100_2675313_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2675367_2675457_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2675734_2676487_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2676500_2677550_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2677551_2677830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2677896_2678148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2678364_2678520_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2678591_2678879_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2678878_2679118_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2679142_2679448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2679650_2679983_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2680419_2680569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2680865_2681096_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2681179_2681587_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2681753_2681909_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 7
NZ_CP043199	Escherichia coli O16:H48 strain PG20180060 chromosome, complete genome	4668071	3501091	3513562	4668071	tail,transposase,integrase	Enterobacteria_phage(43.75%)	17	3499066:3499082	3517237:3517253
3499066:3499082	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3501091_3502024_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3502335_3503493_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3503645_3504008_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_085947771.1|3504156_3505318_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001030215.1|3506182_3507514_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3507548_3507830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3508128_3508569_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3508595_3509114_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3509163_3509439_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3509438_3509933_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3509929_3510298_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3510655_3511018_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3511083_3511908_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3512035_3512572_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3512562_3512925_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3512924_3513230_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3513361_3513562_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3517237:3517253	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP043199	Escherichia coli O16:H48 strain PG20180060 chromosome, complete genome	4668071	3899347	3906486	4668071		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3899347_3901909_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3902014_3902671_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|3902721_3903489_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|3903684_3904593_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3904589_3905756_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|3905847_3906486_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 9
NZ_CP043199	Escherichia coli O16:H48 strain PG20180060 chromosome, complete genome	4668071	4514677	4521903	4668071		Streptococcus_phage(33.33%)	9	NA	NA
WP_069106888.1|4514677_4515472_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	99.2	1.1e-153
WP_046835546.1|4515536_4516253_-	hypothetical protein	NA	A0A1I9LJQ6	Stx_converting_phage	100.0	5.4e-139
WP_148871284.1|4516422_4517514_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.1e-13
WP_000124700.1|4517584_4519699_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138045.1|4519726_4520266_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4520362_4520737_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|4520862_4521150_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|4521157_4521517_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|4521516_4521903_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
