The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043197	Escherichia coli O16:H48 strain PG20180061 chromosome, complete genome	4594168	308	8127	4594168	integrase,plate,portal	Shigella_phage(45.45%)	14	4433:4445	11561:11573
WP_000383574.1|308_893_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|883_1675_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|1601_2075_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|2074_2257_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|2268_3636_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|3625_3805_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|3980_4538_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
4433:4445	attL	AGTCAGCCGCTTC	NA	NA	NA	NA
WP_000649480.1|4581_4782_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|4872_5547_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|5721_6030_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|5967_6309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|6425_6737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|6773_7019_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|6999_8127_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
11561:11573	attR	AGTCAGCCGCTTC	NA	NA	NA	NA
>prophage 2
NZ_CP043197	Escherichia coli O16:H48 strain PG20180061 chromosome, complete genome	4594168	398729	449074	4594168	lysis,holin,integrase,head,capsid,protease,portal,tail,terminase	Enterobacteria_phage(75.36%)	70	425982:425997	450782:450797
WP_001295303.1|398729_400019_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
WP_000767389.1|400077_400554_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000889231.1|401409_402987_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000735931.1|402983_403874_+	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000162952.1|404464_405697_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_016063193.1|405825_406410_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_001407643.1|406409_408734_-	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_001246632.1|408798_409419_-	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_000515496.1|409480_412879_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_000090889.1|412939_413572_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000194780.1|413508_414252_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|414257_414956_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|414955_415285_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840207.1|415281_417843_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000459457.1|417835_418270_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|418251_418674_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|418689_419430_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|419437_419833_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|419829_420408_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|420419_420773_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158919.1|420784_421183_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000063280.1|421224_422250_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|422305_422638_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123343.1|422647_423967_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001359455.1|423947_425549_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|425545_425752_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|425748_427674_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
425982:425997	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453580.1|427648_428194_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001421937.1|428582_428777_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|428941_429148_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_012775990.1|429433_429844_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_000738492.1|430133_430427_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012738274.1|430517_430700_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000229403.1|430916_431393_-	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_000783735.1|431376_431700_-|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_012767708.1|432070_432265_-	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
WP_001235459.1|432376_433000_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_001271136.1|432996_433662_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_000144614.1|433639_433846_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001108044.1|433842_434454_-	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000566997.1|434446_434617_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_000113775.1|434613_434796_-	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000984218.1|434762_434936_-	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000611491.1|434932_435805_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000736903.1|435801_436242_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145933.1|436315_436606_-	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000788910.1|436602_437304_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000185505.1|437300_438200_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000251069.1|438232_438526_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|438644_438845_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000104863.1|438945_439659_+	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000788349.1|439771_440611_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_001245922.1|440626_441061_+	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_001564525.1|441525_441849_+	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_000281856.1|441849_442332_-	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213975.1|442598_442799_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000065374.1|442981_443350_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|443422_443587_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|443555_443699_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995451.1|443773_444070_+	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000100844.1|444075_444861_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186853.1|444857_445538_+	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000149542.1|445534_445717_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000548551.1|445689_445881_+	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000763367.1|446272_446494_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001289873.1|446490_447039_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000026224.1|447230_447512_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545733.1|447600_447768_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_002414258.1|447807_448026_+	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000533640.1|448003_449074_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
450782:450797	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 3
NZ_CP043197	Escherichia coli O16:H48 strain PG20180061 chromosome, complete genome	4594168	647312	693535	4594168	lysis,integrase,capsid,transposase,protease,terminase	Enterobacteria_phage(53.85%)	50	670387:670433	691689:691735
WP_001300563.1|647312_648425_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|648501_648654_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001130654.1|649106_650225_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|650290_650539_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|650603_650972_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|651065_651719_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|651826_653074_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786319.1|653154_654531_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|654632_657776_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|657787_659011_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|659026_659359_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|659516_660890_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|661046_661730_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|661719_663162_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|663311_665549_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|665535_668508_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|668508_669399_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|669581_670343_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
670387:670433	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|670856_671810_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|672059_672809_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|673711_674338_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071592174.1|674282_674420_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_001027248.1|674392_675136_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|675110_675656_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|676044_676239_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|676403_676610_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|676895_677306_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|677596_677890_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|677980_678163_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|678379_678877_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|678876_679092_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|679664_680732_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|680736_681753_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|682150_682534_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|682619_682760_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|682756_683119_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|683115_683406_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|683398_683569_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|683568_684024_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|684020_684122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|684238_685036_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|685045_685597_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|686061_687588_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|687645_687795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|687842_688175_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_085947771.1|688485_689648_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000145909.1|689710_689806_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|690128_690392_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|690511_691675_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_085947917.1|692261_693535_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
691689:691735	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP043197	Escherichia coli O16:H48 strain PG20180061 chromosome, complete genome	4594168	866123	920652	4594168	transposase	Shigella_phage(11.76%)	50	NA	NA
WP_085947771.1|866123_867285_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000556438.1|867313_868774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295337.1|869297_870272_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004027.1|870378_871230_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114620.1|871226_872054_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939375.1|872050_872818_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
WP_001018417.1|872830_873793_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000362028.1|874408_874966_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_120795375.1|874945_875065_-	protein YkiC	NA	NA	NA	NA	NA
WP_000860444.1|875089_876286_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_085947917.1|876445_877719_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000012218.1|877737_878181_+	transferase	NA	NA	NA	NA	NA
WP_000596084.1|878182_878956_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_001141271.1|879143_879419_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842106.1|879453_880563_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
WP_000419081.1|880656_881490_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001096705.1|881713_882253_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000107627.1|882354_883566_-	3-(3-hydroxy-phenyl)propionate transporter	NA	NA	NA	NA	NA
WP_001013499.1|884143_885157_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|885153_886104_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_000160710.1|886100_886910_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000121907.1|886919_887786_-	2-hydroxy-6-oxonona-2,4-dienedioate hydrolase	NA	NA	NA	NA	NA
WP_000543457.1|887803_888748_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001007407.1|888749_890414_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_001310587.1|890490_891438_+	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_000805902.1|891514_892597_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177906.1|892719_895794_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000749863.1|897713_898769_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|899056_900160_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|900171_901425_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000854672.1|901996_902338_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|902358_902676_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|902694_902916_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|902924_903401_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|903416_903875_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|903972_904212_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|904288_904756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|904778_905222_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|905221_905449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|905852_906674_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|906765_907629_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|907957_908851_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|909271_910423_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|912769_913786_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|913993_915397_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|915383_916316_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|916424_917471_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|918692_919031_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|919053_919404_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|919497_920652_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP043197	Escherichia coli O16:H48 strain PG20180061 chromosome, complete genome	4594168	2387762	2394988	4594168		uncultured_Caudovirales_phage(33.33%)	9	NA	NA
WP_001209680.1|2387762_2388149_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
WP_000820714.1|2388148_2388508_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903373.1|2388515_2388803_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|2388928_2389303_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138045.1|2389399_2389939_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|2389966_2392081_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_148871284.1|2392151_2393243_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.1e-13
WP_046835546.1|2393412_2394129_+	hypothetical protein	NA	A0A1I9LJQ6	Stx_converting_phage	100.0	5.4e-139
WP_069106888.1|2394193_2394988_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	99.2	1.1e-153
>prophage 6
NZ_CP043197	Escherichia coli O16:H48 strain PG20180061 chromosome, complete genome	4594168	3003179	3010318	4594168		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3003179_3003818_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|3003909_3005076_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|3005072_3005981_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001300386.1|3006176_3006944_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141337.1|3006994_3007651_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|3007756_3010318_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 7
NZ_CP043197	Escherichia coli O16:H48 strain PG20180061 chromosome, complete genome	4594168	3384105	3396576	4594168	integrase,transposase,tail	Enterobacteria_phage(43.75%)	17	3380415:3380431	3398586:3398602
3380415:3380431	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|3384105_3384306_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|3384437_3384743_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|3384742_3385105_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|3385095_3385632_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|3385759_3386584_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|3386649_3387012_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000128175.1|3387369_3387738_+	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_001393497.1|3387734_3388229_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|3388228_3388504_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|3388553_3389072_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|3389098_3389539_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|3389837_3390119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|3390153_3391485_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_085947771.1|3392348_3393511_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000915541.1|3393659_3394022_-	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|3394174_3395332_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|3395643_3396576_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
3398586:3398602	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 8
NZ_CP043197	Escherichia coli O16:H48 strain PG20180061 chromosome, complete genome	4594168	4215758	4234969	4594168	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|4215758_4215914_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|4216080_4216488_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|4216571_4216802_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|4217098_4217248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|4217684_4218017_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|4218219_4218525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|4218549_4218789_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|4218788_4219076_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|4219147_4219303_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|4219519_4219771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|4219837_4220116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|4220117_4221167_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|4221180_4221933_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|4222210_4222300_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|4222354_4222567_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|4222867_4223083_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|4223836_4224052_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|4224056_4224368_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|4224364_4224898_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|4224894_4225392_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|4225754_4225967_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|4225977_4226166_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|4226168_4226234_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|4226312_4226468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|4226639_4226813_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|4226964_4227375_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|4227432_4227666_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|4228054_4228624_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|4228574_4229537_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_001698950.1|4229536_4230112_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000078178.1|4230209_4230800_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|4231116_4231350_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4231418_4231532_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|4232136_4233420_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|4233508_4234969_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 9
NZ_CP043197	Escherichia coli O16:H48 strain PG20180061 chromosome, complete genome	4594168	4395248	4459195	4594168	lysis,integrase,transposase,tRNA,tail	Escherichia_phage(39.39%)	63	4438143:4438161	4468518:4468536
WP_001254932.1|4395248_4396400_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_085947917.1|4396563_4397836_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_010723099.1|4400527_4400593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|4400696_4401287_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|4401268_4402219_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|4402319_4403633_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|4403659_4404865_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|4404864_4405287_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|4405276_4406704_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|4406705_4407494_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|4407493_4408261_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|4408257_4409328_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|4409335_4409833_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|4409847_4410594_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|4410602_4410890_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|4410901_4411831_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|4412115_4414161_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|4414408_4416682_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|4416739_4418239_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|4418474_4419380_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|4419551_4419878_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|4419885_4420071_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|4420067_4422707_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|4422914_4423904_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|4424014_4424437_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|4424433_4424700_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|4424973_4428498_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|4428864_4429998_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|4430138_4430573_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|4431351_4431465_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|4431533_4431767_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|4432083_4432674_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|4432771_4433347_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|4433346_4436709_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_089418980.1|4436773_4436989_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
WP_000019448.1|4437031_4438012_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
4438143:4438161	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_001755909.1|4439469_4439670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091628.1|4439777_4440137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|4440117_4440381_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|4440518_4441976_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|4442172_4442358_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|4442445_4443006_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|4443028_4443775_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|4443781_4444639_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|4444651_4445074_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|4445096_4445393_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|4445516_4445993_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000233809.1|4446301_4446436_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|4446446_4446602_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|4446598_4447087_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|4447528_4447750_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|4447749_4447920_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|4447994_4448270_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|4448371_4450972_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|4450964_4451774_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|4451830_4452025_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|4452017_4452227_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|4452305_4452521_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|4452522_4453758_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|4453809_4454745_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|4454873_4456247_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|4456724_4457708_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|4457962_4459195_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
4468518:4468536	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
