The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043195	Escherichia coli O16:H48 strain PG20180062 chromosome, complete genome	4656685	696078	703304	4656685		uncultured_Caudovirales_phage(33.33%)	9	NA	NA
WP_001209680.1|696078_696465_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
WP_000820714.1|696464_696824_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903373.1|696831_697119_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|697244_697619_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138045.1|697715_698255_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|698282_700397_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_148871284.1|700467_701559_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.1e-13
WP_046835546.1|701728_702445_+	hypothetical protein	NA	A0A1I9LJQ6	Stx_converting_phage	100.0	5.4e-139
WP_069106888.1|702509_703304_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	99.2	1.1e-153
>prophage 2
NZ_CP043195	Escherichia coli O16:H48 strain PG20180062 chromosome, complete genome	4656685	1311495	1318634	4656685		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1311495_1312134_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|1312225_1313392_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|1313388_1314297_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001300386.1|1314492_1315260_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141337.1|1315310_1315967_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|1316072_1318634_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
NZ_CP043195	Escherichia coli O16:H48 strain PG20180062 chromosome, complete genome	4656685	1692418	1703645	4656685	integrase,transposase,tail	Enterobacteria_phage(40.0%)	16	1688728:1688744	1706899:1706915
1688728:1688744	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1692418_1692619_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|1692750_1693056_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|1693055_1693418_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|1693408_1693945_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|1694072_1694897_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|1694962_1695325_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000128175.1|1695682_1696051_+	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_001393497.1|1696047_1696542_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|1696541_1696817_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|1696866_1697385_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|1697411_1697852_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|1698150_1698432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|1698466_1699798_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_085947771.1|1700661_1701824_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000915541.1|1701972_1702335_-	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|1702487_1703645_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
1706899:1706915	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP043195	Escherichia coli O16:H48 strain PG20180062 chromosome, complete genome	4656685	2524071	2543282	4656685	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|2524071_2524227_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2524393_2524801_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2524884_2525115_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2525411_2525561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2525997_2526330_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2526532_2526838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2526862_2527102_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2527101_2527389_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2527460_2527616_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2527832_2528084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2528150_2528429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2528430_2529480_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2529493_2530246_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2530523_2530613_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2530667_2530880_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2531180_2531396_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2532149_2532365_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2532369_2532681_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2532677_2533211_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2533207_2533705_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2534067_2534280_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2534290_2534479_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2534481_2534547_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2534625_2534781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2534952_2535126_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2535277_2535688_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2535745_2535979_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453588.1|2536367_2536937_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.7e-92
WP_001027733.1|2536887_2537850_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|2537849_2538425_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086527.1|2538522_2539113_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2539429_2539663_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2539731_2539845_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2540449_2541733_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|2541821_2543282_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
NZ_CP043195	Escherichia coli O16:H48 strain PG20180062 chromosome, complete genome	4656685	2703561	2767508	4656685	transposase,lysis,integrase,tail,tRNA	Escherichia_phage(39.39%)	63	2746456:2746474	2776831:2776849
WP_001254932.1|2703561_2704713_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_085947917.1|2704876_2706149_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_010723099.1|2708840_2708906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|2709009_2709600_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|2709581_2710532_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2710632_2711946_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2711972_2713178_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2713177_2713600_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|2713589_2715017_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|2715018_2715807_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2715806_2716574_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2716570_2717641_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2717648_2718146_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2718160_2718907_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2718915_2719203_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2719214_2720144_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|2720428_2722474_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|2722721_2724995_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2725052_2726552_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|2726787_2727693_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2727864_2728191_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2728198_2728384_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|2728380_2731020_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2731227_2732217_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2732327_2732750_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2732746_2733013_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|2733286_2736811_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|2737177_2738311_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|2738451_2738886_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|2739664_2739778_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2739846_2740080_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2740396_2740987_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2741084_2741660_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279097.1|2741659_2745022_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_089418980.1|2745086_2745302_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
WP_000019448.1|2745344_2746325_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2746456:2746474	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_001755909.1|2747782_2747983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091628.1|2748090_2748450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|2748430_2748694_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|2748831_2750289_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2750485_2750671_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|2750758_2751319_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|2751341_2752088_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|2752094_2752952_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|2752964_2753387_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2753409_2753706_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2753829_2754306_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000233809.1|2754614_2754749_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|2754759_2754915_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2754911_2755400_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2755841_2756063_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2756062_2756233_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2756307_2756583_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|2756684_2759285_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|2759277_2760087_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2760143_2760338_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2760330_2760540_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2760618_2760834_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2760835_2762071_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2762122_2763058_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2763186_2764560_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2765037_2766021_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2766275_2767508_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2776831:2776849	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP043195	Escherichia coli O16:H48 strain PG20180062 chromosome, complete genome	4656685	2958812	2973193	4656685	integrase,portal,plate,tail	Escherichia_phage(26.32%)	25	2956188:2956201	2974219:2974232
2956188:2956201	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_000332303.1|2958812_2959544_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2959764_2960169_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|2960221_2960332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|2960868_2961192_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000943927.1|2961294_2961459_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|2961692_2962526_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000905001.1|2962632_2963187_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_024184299.1|2963258_2963753_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000548498.1|2963752_2964355_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|2964326_2964740_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000554703.1|2964741_2965371_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_000383574.1|2965374_2965959_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|2965949_2966741_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|2966667_2967141_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|2967140_2967323_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|2967334_2968702_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|2968691_2968871_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|2969046_2969604_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|2969647_2969848_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|2969938_2970613_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|2970787_2971096_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|2971033_2971375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|2971491_2971803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|2971839_2972085_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|2972065_2973193_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
2974219:2974232	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP043195	Escherichia coli O16:H48 strain PG20180062 chromosome, complete genome	4656685	3363795	3414141	4656685	portal,terminase,capsid,lysis,integrase,holin,head,tail,protease	Enterobacteria_phage(75.36%)	70	3391048:3391063	3415849:3415864
WP_001295303.1|3363795_3365085_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
WP_000767389.1|3365143_3365620_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000889231.1|3366475_3368053_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000735931.1|3368049_3368940_+	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000162952.1|3369530_3370763_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_016063193.1|3370891_3371476_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_001407643.1|3371475_3373800_-	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_001246632.1|3373864_3374485_-	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_000515496.1|3374546_3377945_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_000090889.1|3378005_3378638_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000194780.1|3378574_3379318_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3379323_3380022_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3380021_3380351_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840207.1|3380347_3382909_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000459457.1|3382901_3383336_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3383317_3383740_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3383755_3384496_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|3384503_3384899_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|3384895_3385474_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|3385485_3385839_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158919.1|3385850_3386249_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000063280.1|3386290_3387316_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|3387371_3387704_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123343.1|3387713_3389033_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001359455.1|3389013_3390615_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|3390611_3390818_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|3390814_3392740_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
3391048:3391063	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453587.1|3392714_3393260_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001421937.1|3393648_3393843_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3394007_3394214_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_095501025.1|3394499_3394910_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	3.2e-72
WP_000738492.1|3395200_3395494_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012738274.1|3395584_3395767_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000229403.1|3395983_3396460_-	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_000783735.1|3396443_3396767_-|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_012767708.1|3397137_3397332_-	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
WP_001235459.1|3397443_3398067_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_001271136.1|3398063_3398729_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_000144614.1|3398706_3398913_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001108044.1|3398909_3399521_-	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000566997.1|3399513_3399684_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_000113775.1|3399680_3399863_-	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000984218.1|3399829_3400003_-	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000611491.1|3399999_3400872_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000736903.1|3400868_3401309_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145933.1|3401382_3401673_-	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000788910.1|3401669_3402371_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000185505.1|3402367_3403267_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000251069.1|3403299_3403593_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3403711_3403912_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000104863.1|3404012_3404726_+	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000788349.1|3404838_3405678_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_001245922.1|3405693_3406128_+	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_001564525.1|3406592_3406916_+	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_000281856.1|3406916_3407399_-	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213975.1|3407665_3407866_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000065374.1|3408048_3408417_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3408489_3408654_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3408622_3408766_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995451.1|3408840_3409137_+	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000100844.1|3409142_3409928_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186853.1|3409924_3410605_+	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000149542.1|3410601_3410784_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000548551.1|3410756_3410948_+	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000763367.1|3411339_3411561_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001289873.1|3411557_3412106_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000026224.1|3412297_3412579_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545733.1|3412667_3412835_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_002414258.1|3412874_3413093_+	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000533640.1|3413070_3414141_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
3415849:3415864	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 8
NZ_CP043195	Escherichia coli O16:H48 strain PG20180062 chromosome, complete genome	4656685	3612379	3658602	4656685	transposase,terminase,capsid,lysis,integrase,protease	Enterobacteria_phage(57.69%)	50	3635454:3635500	3656756:3656802
WP_001300563.1|3612379_3613492_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3613568_3613721_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001130654.1|3614173_3615292_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|3615357_3615606_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3615670_3616039_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|3616132_3616786_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3616893_3618141_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786319.1|3618221_3619598_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3619699_3622843_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3622854_3624078_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3624093_3624426_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3624583_3625957_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3626113_3626797_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|3626786_3628229_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|3628378_3630616_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|3630602_3633575_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|3633575_3634466_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|3634648_3635410_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3635454:3635500	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|3635923_3636877_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3637126_3637876_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|3638778_3639405_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071592174.1|3639349_3639487_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_001027248.1|3639459_3640203_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453587.1|3640177_3640723_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001421937.1|3641111_3641306_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3641470_3641677_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_095501025.1|3641962_3642373_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	3.2e-72
WP_000738491.1|3642663_3642957_+	serum resistance lipoprotein Bor	NA	C6ZCX3	Enterobacteria_phage	100.0	4.0e-48
WP_001228697.1|3643047_3643230_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3643446_3643944_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|3643943_3644159_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|3644731_3645799_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|3645803_3646820_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|3647217_3647601_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3647686_3647827_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3647823_3648186_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|3648182_3648473_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|3648465_3648636_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|3648635_3649091_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3649087_3649189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3649305_3650103_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3650112_3650664_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|3651128_3652655_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|3652712_3652862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3652909_3653242_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_085947771.1|3653552_3654715_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000145909.1|3654777_3654873_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|3655195_3655459_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|3655578_3656742_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_085947917.1|3657328_3658602_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
3656756:3656802	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP043195	Escherichia coli O16:H48 strain PG20180062 chromosome, complete genome	4656685	3831190	3885719	4656685	transposase	Shigella_phage(11.76%)	50	NA	NA
WP_085947771.1|3831190_3832352_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000556438.1|3832380_3833841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295337.1|3834364_3835339_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004027.1|3835445_3836297_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114620.1|3836293_3837121_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939375.1|3837117_3837885_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
WP_001018417.1|3837897_3838860_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000362028.1|3839475_3840033_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_120795375.1|3840012_3840132_-	protein YkiC	NA	NA	NA	NA	NA
WP_000860444.1|3840156_3841353_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_085947917.1|3841512_3842786_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000012218.1|3842804_3843248_+	transferase	NA	NA	NA	NA	NA
WP_000596084.1|3843249_3844023_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_001141271.1|3844210_3844486_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842106.1|3844520_3845630_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
WP_000419081.1|3845723_3846557_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001096705.1|3846780_3847320_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000107627.1|3847421_3848633_-	3-(3-hydroxy-phenyl)propionate transporter	NA	NA	NA	NA	NA
WP_001013499.1|3849210_3850224_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|3850220_3851171_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_000160710.1|3851167_3851977_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000121907.1|3851986_3852853_-	2-hydroxy-6-oxonona-2,4-dienedioate hydrolase	NA	NA	NA	NA	NA
WP_000543457.1|3852870_3853815_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001007407.1|3853816_3855481_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_001310587.1|3855557_3856505_+	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_000805902.1|3856581_3857664_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177906.1|3857786_3860861_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000749863.1|3862780_3863836_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|3864123_3865227_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|3865238_3866492_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000854672.1|3867063_3867405_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|3867425_3867743_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|3867761_3867983_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|3867991_3868468_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|3868483_3868942_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|3869039_3869279_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|3869355_3869823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|3869845_3870289_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|3870288_3870516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|3870919_3871741_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|3871832_3872696_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|3873024_3873918_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|3874338_3875490_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|3877836_3878853_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|3879060_3880464_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|3880450_3881383_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|3881491_3882538_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|3883759_3884098_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|3884120_3884471_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|3884564_3885719_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
