The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043187	Escherichia coli O16:H48 strain PG20180170 chromosome, complete genome	4656750	408014	415240	4656750		uncultured_Caudovirales_phage(33.33%)	9	NA	NA
WP_001209680.1|408014_408401_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
WP_000820714.1|408400_408760_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_000903373.1|408767_409055_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|409180_409555_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138045.1|409651_410191_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|410218_412333_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_148871284.1|412403_413495_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.1e-13
WP_046835546.1|413664_414381_+	hypothetical protein	NA	A0A1I9LJQ6	Stx_converting_phage	100.0	5.4e-139
WP_069106888.1|414445_415240_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	99.2	1.1e-153
>prophage 2
NZ_CP043187	Escherichia coli O16:H48 strain PG20180170 chromosome, complete genome	4656750	1023431	1030570	4656750		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1023431_1024070_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|1024161_1025328_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|1025324_1026233_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001300386.1|1026428_1027196_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141337.1|1027246_1027903_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|1028008_1030570_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
NZ_CP043187	Escherichia coli O16:H48 strain PG20180170 chromosome, complete genome	4656750	1404354	1416825	4656750	integrase,tail,transposase	Enterobacteria_phage(43.75%)	17	1400664:1400680	1418835:1418851
1400664:1400680	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1404354_1404555_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|1404686_1404992_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|1404991_1405354_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|1405344_1405881_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|1406008_1406833_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|1406898_1407261_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000128175.1|1407618_1407987_+	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_001393497.1|1407983_1408478_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|1408477_1408753_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|1408802_1409321_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|1409347_1409788_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|1410086_1410368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|1410402_1411734_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_085947771.1|1412597_1413760_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000915541.1|1413908_1414271_-	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|1414423_1415581_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|1415892_1416825_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1418835:1418851	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP043187	Escherichia coli O16:H48 strain PG20180170 chromosome, complete genome	4656750	2236007	2255218	4656750	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|2236007_2236163_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2236329_2236737_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2236820_2237051_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2237347_2237497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2237933_2238266_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2238468_2238774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2238798_2239038_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2239037_2239325_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2239396_2239552_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2239768_2240020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2240086_2240365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2240366_2241416_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2241429_2242182_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2242459_2242549_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2242603_2242816_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2243116_2243332_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2244085_2244301_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2244305_2244617_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2244613_2245147_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2245143_2245641_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2246003_2246216_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2246226_2246415_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2246417_2246483_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2246561_2246717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2246888_2247062_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2247213_2247624_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2247681_2247915_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|2248303_2248873_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|2248823_2249786_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|2249785_2250361_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078178.1|2250458_2251049_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2251365_2251599_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2251667_2251781_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2252385_2253669_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|2253757_2255218_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
NZ_CP043187	Escherichia coli O16:H48 strain PG20180170 chromosome, complete genome	4656750	2415497	2479444	4656750	tRNA,integrase,transposase,tail,lysis	Escherichia_phage(39.39%)	63	2458392:2458410	2488767:2488785
WP_001254932.1|2415497_2416649_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_085947917.1|2416812_2418085_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_010723099.1|2420776_2420842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|2420945_2421536_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|2421517_2422468_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2422568_2423882_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2423908_2425114_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2425113_2425536_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|2425525_2426953_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|2426954_2427743_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2427742_2428510_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2428506_2429577_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2429584_2430082_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2430096_2430843_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2430851_2431139_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2431150_2432080_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|2432364_2434410_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|2434657_2436931_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2436988_2438488_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|2438723_2439629_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2439800_2440127_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2440134_2440320_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|2440316_2442956_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2443163_2444153_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2444263_2444686_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2444682_2444949_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|2445222_2448747_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|2449113_2450247_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|2450387_2450822_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|2451600_2451714_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2451782_2452016_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078178.1|2452332_2452923_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2453020_2453596_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|2453595_2456958_-|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_089418980.1|2457022_2457238_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
WP_000019448.1|2457280_2458261_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2458392:2458410	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_001755909.1|2459718_2459919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091628.1|2460026_2460386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|2460366_2460630_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|2460767_2462225_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2462421_2462607_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|2462694_2463255_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|2463277_2464024_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|2464030_2464888_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|2464900_2465323_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2465345_2465642_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2465765_2466242_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000233809.1|2466550_2466685_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|2466695_2466851_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2466847_2467336_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2467777_2467999_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2467998_2468169_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2468243_2468519_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|2468620_2471221_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|2471213_2472023_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2472079_2472274_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2472266_2472476_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2472554_2472770_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2472771_2474007_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2474058_2474994_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2475122_2476496_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2476973_2477957_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2478211_2479444_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2488767:2488785	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP043187	Escherichia coli O16:H48 strain PG20180170 chromosome, complete genome	4656750	2670748	2685129	4656750	portal,integrase,tail,plate	Escherichia_phage(26.32%)	25	2668124:2668137	2686155:2686168
2668124:2668137	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_000332303.1|2670748_2671480_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2671700_2672105_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|2672157_2672268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295666.1|2672804_2673128_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000943927.1|2673230_2673395_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|2673628_2674462_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000905001.1|2674568_2675123_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_024184299.1|2675194_2675689_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000548498.1|2675688_2676291_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|2676262_2676676_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000554703.1|2676677_2677307_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_000383574.1|2677310_2677895_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|2677885_2678677_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|2678603_2679077_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|2679076_2679259_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|2679270_2680638_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|2680627_2680807_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|2680982_2681540_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|2681583_2681784_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|2681874_2682549_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|2682723_2683032_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|2682969_2683311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|2683427_2683739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|2683775_2684021_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|2684001_2685129_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
2686155:2686168	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP043187	Escherichia coli O16:H48 strain PG20180170 chromosome, complete genome	4656750	3075731	3126076	4656750	portal,integrase,tail,terminase,holin,lysis,capsid,head,protease	Enterobacteria_phage(75.36%)	70	3102984:3102999	3127784:3127799
WP_001295303.1|3075731_3077021_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
WP_000767389.1|3077079_3077556_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_000889231.1|3078411_3079989_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000735931.1|3079985_3080876_+	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000162952.1|3081466_3082699_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_016063193.1|3082827_3083412_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_001407643.1|3083411_3085736_-	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_001246632.1|3085800_3086421_-	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_000515496.1|3086482_3089881_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_000090889.1|3089941_3090574_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000194780.1|3090510_3091254_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3091259_3091958_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3091957_3092287_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840207.1|3092283_3094845_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000459457.1|3094837_3095272_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3095253_3095676_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3095691_3096432_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|3096439_3096835_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|3096831_3097410_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|3097421_3097775_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158919.1|3097786_3098185_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000063280.1|3098226_3099252_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|3099307_3099640_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123343.1|3099649_3100969_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001359455.1|3100949_3102551_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|3102547_3102754_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|3102750_3104676_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
3102984:3102999	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453580.1|3104650_3105196_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001421937.1|3105584_3105779_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3105943_3106150_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_012775990.1|3106435_3106846_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_000738492.1|3107135_3107429_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012738274.1|3107519_3107702_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000229403.1|3107918_3108395_-	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_000783735.1|3108378_3108702_-|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_012767708.1|3109072_3109267_-	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
WP_001235459.1|3109378_3110002_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_001271136.1|3109998_3110664_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_000144614.1|3110641_3110848_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001108044.1|3110844_3111456_-	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000566997.1|3111448_3111619_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_000113775.1|3111615_3111798_-	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000984218.1|3111764_3111938_-	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000611491.1|3111934_3112807_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000736903.1|3112803_3113244_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145933.1|3113317_3113608_-	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000788910.1|3113604_3114306_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000185505.1|3114302_3115202_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000251069.1|3115234_3115528_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3115646_3115847_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000104863.1|3115947_3116661_+	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000788349.1|3116773_3117613_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_001245922.1|3117628_3118063_+	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_001564525.1|3118527_3118851_+	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_000281856.1|3118851_3119334_-	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213975.1|3119600_3119801_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000065374.1|3119983_3120352_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3120424_3120589_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3120557_3120701_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995451.1|3120775_3121072_+	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000100844.1|3121077_3121863_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186853.1|3121859_3122540_+	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000149542.1|3122536_3122719_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000548551.1|3122691_3122883_+	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000763367.1|3123274_3123496_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001289873.1|3123492_3124041_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000026224.1|3124232_3124514_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545733.1|3124602_3124770_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_002414258.1|3124809_3125028_+	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000533640.1|3125005_3126076_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
3127784:3127799	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 8
NZ_CP043187	Escherichia coli O16:H48 strain PG20180170 chromosome, complete genome	4656750	3324314	3370537	4656750	integrase,transposase,terminase,capsid,lysis,protease	Enterobacteria_phage(53.85%)	50	3347389:3347435	3368691:3368737
WP_001300563.1|3324314_3325427_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3325503_3325656_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001130654.1|3326108_3327227_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|3327292_3327541_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3327605_3327974_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|3328067_3328721_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3328828_3330076_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786319.1|3330156_3331533_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3331634_3334778_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3334789_3336013_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3336028_3336361_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3336518_3337892_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3338048_3338732_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|3338721_3340164_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|3340313_3342551_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|3342537_3345510_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|3345510_3346401_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|3346583_3347345_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3347389:3347435	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|3347858_3348812_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3349061_3349811_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|3350713_3351340_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071592174.1|3351284_3351422_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_001027248.1|3351394_3352138_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|3352112_3352658_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|3353046_3353241_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3353405_3353612_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|3353897_3354308_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3354598_3354892_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3354982_3355165_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3355381_3355879_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|3355878_3356094_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|3356666_3357734_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|3357738_3358755_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|3359152_3359536_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3359621_3359762_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3359758_3360121_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|3360117_3360408_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|3360400_3360571_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|3360570_3361026_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3361022_3361124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3361240_3362038_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3362047_3362599_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|3363063_3364590_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|3364647_3364797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3364844_3365177_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_085947771.1|3365487_3366650_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000145909.1|3366712_3366808_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|3367130_3367394_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|3367513_3368677_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_085947917.1|3369263_3370537_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
3368691:3368737	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP043187	Escherichia coli O16:H48 strain PG20180170 chromosome, complete genome	4656750	3543125	3597654	4656750	transposase	Shigella_phage(11.76%)	50	NA	NA
WP_085947771.1|3543125_3544287_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000556438.1|3544315_3545776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295337.1|3546299_3547274_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000004027.1|3547380_3548232_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_000114620.1|3548228_3549056_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_000939375.1|3549052_3549820_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
WP_001018417.1|3549832_3550795_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000362028.1|3551410_3551968_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_120795375.1|3551947_3552067_-	protein YkiC	NA	NA	NA	NA	NA
WP_000860444.1|3552091_3553288_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_085947917.1|3553447_3554721_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000012218.1|3554739_3555183_+	transferase	NA	NA	NA	NA	NA
WP_000596084.1|3555184_3555958_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_001141271.1|3556145_3556421_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842106.1|3556455_3557565_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
WP_000419081.1|3557658_3558492_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001096705.1|3558715_3559255_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000107627.1|3559356_3560568_-	3-(3-hydroxy-phenyl)propionate transporter	NA	NA	NA	NA	NA
WP_001013499.1|3561145_3562159_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|3562155_3563106_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_000160710.1|3563102_3563912_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000121907.1|3563921_3564788_-	2-hydroxy-6-oxonona-2,4-dienedioate hydrolase	NA	NA	NA	NA	NA
WP_000543457.1|3564805_3565750_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001007407.1|3565751_3567416_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_001310587.1|3567492_3568440_+	DNA-binding transcriptional activator MhpR	NA	NA	NA	NA	NA
WP_000805902.1|3568516_3569599_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177906.1|3569721_3572796_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000749863.1|3574715_3575771_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|3576058_3577162_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|3577173_3578427_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000854672.1|3578998_3579340_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|3579360_3579678_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|3579696_3579918_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|3579926_3580403_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|3580418_3580877_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|3580974_3581214_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|3581290_3581758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|3581780_3582224_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|3582223_3582451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|3582854_3583676_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|3583767_3584631_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|3584959_3585853_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|3586273_3587425_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|3589771_3590788_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|3590995_3592399_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|3592385_3593318_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|3593426_3594473_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|3595694_3596033_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|3596055_3596406_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|3596499_3597654_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
