The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	1684	8092	5075343	tail	Mycoplasma_phage(33.33%)	7	NA	NA
WP_085452873.1|1684_2284_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	1.2e-107
WP_148879989.1|2348_3662_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	2.1e-72
WP_001023445.1|3663_3933_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_032187950.1|4046_4322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089518943.1|4384_5746_-	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	30.5	7.7e-54
WP_000799400.1|6108_6972_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|6955_8092_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
>prophage 2
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	119760	178380	5075343	terminase,tail,protease,portal,integrase,holin	Enterobacteria_phage(36.73%)	75	116560:116573	141026:141039
116560:116573	attL	AGCCGGTTACCAGT	NA	NA	NA	NA
WP_001735157.1|119760_120891_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	5.7e-103
WP_000113189.1|120868_121117_-	excisionase	NA	NA	NA	NA	NA
WP_148879990.1|121181_123653_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090192.1|123733_123937_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_148879991.1|123939_124122_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|124653_125028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|125039_125192_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_089550521.1|125467_125755_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_024207685.1|125754_125946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329851.1|125973_126375_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	53.0	1.3e-12
WP_024207686.1|126484_126757_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	50.0	1.1e-12
WP_089550520.1|126740_127262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059239307.1|127242_128208_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	2.2e-58
WP_000788766.1|128214_128961_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	9.0e-113
WP_148879992.1|128983_129736_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	5.5e-78
WP_059239302.1|129722_130424_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.8	4.1e-51
WP_069723346.1|130420_130711_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	81.2	3.4e-36
WP_059239299.1|130707_131391_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	81.5	2.0e-42
WP_075362635.1|131387_132158_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.0	3.1e-140
WP_000951717.1|132159_132369_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	100.0	2.5e-36
WP_089519010.1|132365_133196_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	49.5	1.4e-61
WP_001278450.1|133311_133416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128513.1|133605_133818_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	3.6e-27
WP_001302544.1|133859_134045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053883582.1|133985_134264_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	4.8e-11
WP_148879993.1|134265_135315_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.9e-108
WP_001217463.1|135327_135699_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	2.3e-37
WP_000532209.1|135688_136039_+	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.7	8.9e-55
WP_000024152.1|136052_136439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000025797.1|136439_136685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193722.1|136688_137567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071790947.1|137655_137775_+	antiterminator	NA	NA	NA	NA	NA
WP_000839572.1|138434_138650_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193273.1|138654_138969_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_001274714.1|139024_139558_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_122986183.1|139774_139960_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.4e-19
WP_000348565.1|140477_140954_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|140950_143074_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
141026:141039	attR	AGCCGGTTACCAGT	NA	NA	NA	NA
WP_000102415.1|143070_143283_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|143282_144785_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|144729_146754_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|146841_147168_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|147160_147442_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|147444_148068_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682716.1|148080_148479_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|148486_149239_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_089550592.1|149252_149675_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	99.3	2.5e-72
WP_000532075.1|149701_150010_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_148879994.1|150053_152699_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.0	0.0e+00
WP_000847336.1|152695_153025_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	1.2e-53
WP_001152612.1|153024_153723_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_148879995.1|153728_154472_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_148879996.1|154408_155011_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	3.1e-87
WP_148879997.1|155071_158551_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	89.3	0.0e+00
WP_148879998.1|158618_159218_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	96.5	1.8e-108
WP_148879999.1|159282_160596_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	1.5e-78
WP_148880000.1|160597_160867_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.4e-44
WP_032350836.1|161076_161724_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.8	2.2e-38
WP_148880001.1|161910_162111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113456793.1|162714_163221_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056490.1|163266_163767_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|163852_164032_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|164412_165219_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|165218_166412_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_032202613.1|166423_167782_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|167785_169381_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194582.1|169380_170943_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|171034_171079_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285663.1|171216_172098_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|172094_172715_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001301109.1|172742_174638_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|174850_175726_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|175765_176356_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559274.1|176352_177111_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	1.5e-06
WP_000422045.1|177330_178380_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 3
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	409813	519129	5075343	tail,terminase,protease,portal,lysis,transposase	Enterobacteria_phage(43.1%)	115	NA	NA
WP_112029415.1|409813_411026_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.3	1.6e-164
WP_000520676.1|411093_412008_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000825448.1|412066_412570_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876763.1|412582_413113_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001125439.1|415127_416450_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|416449_416716_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_148880006.1|416938_418339_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.0	9.0e-106
WP_000113162.1|422887_424480_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154351.1|424558_425512_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194849.1|425760_427296_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	7.5e-21
WP_000172466.1|428191_429214_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774189.1|429240_430116_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|430139_430430_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|430486_431245_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001313828.1|431248_432163_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_000854633.1|432369_433821_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558030.1|434047_435466_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191027.1|435604_435964_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|435963_436890_-	glutaminase B	NA	NA	NA	NA	NA
WP_001459751.1|436953_438342_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366507.1|438442_439318_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258584.1|439401_440517_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|440666_441857_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|441881_442547_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_025670664.1|442758_443193_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|443212_443596_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803532.1|443627_443846_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012628.1|443902_445342_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	6.3e-30
WP_001022786.1|445366_447040_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001459752.1|447095_447407_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_025670665.1|447434_448757_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722572.1|448871_449183_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_148880007.1|449381_450080_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_069722987.1|450124_451024_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054152.1|451218_452406_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|452532_452628_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592814.1|452846_453737_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000671735.1|453991_454384_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024745.1|454658_455177_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001459755.1|455221_457267_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|457403_458150_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|458238_458925_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|459101_459305_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527813.1|459340_460801_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	8.6e-43
WP_000347482.1|460889_462173_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|462777_462891_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|462959_463193_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|463509_464100_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885587.1|464197_464773_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
WP_148880008.1|464772_467796_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_001230317.1|467860_468460_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	1.5e-110
WP_148880009.1|468526_471925_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	88.1	0.0e+00
WP_023277304.1|471985_472633_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_020219026.1|472530_473274_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_020219025.1|473278_473977_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.4	6.8e-131
WP_000447253.1|473986_474316_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_148880010.1|474315_477381_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161009.1|477352_477682_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001297778.1|477690_478077_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_000211109.1|478137_478881_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|478892_479294_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_020219021.1|479290_479869_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|479880_480156_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|480148_480472_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136587.1|480558_482586_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_011478361.1|482530_484111_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_020219018.1|484038_484251_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	3.2e-31
WP_020219017.1|484247_486350_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_000373425.1|486349_486844_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000548593.1|487396_487603_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|487898_488072_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|488244_488400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|488547_488736_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|488746_488959_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071776.1|489322_489820_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001092971.1|489816_490350_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189918.1|490346_490658_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839587.1|490662_490878_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_000120340.1|491068_491782_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592549.1|492188_493148_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_148880011.1|493340_493865_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|494020_494398_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_001265276.1|494415_495465_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.0e-113
WP_023147795.1|495466_495745_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000980999.1|495811_496063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|496279_496435_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|496506_496794_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|496793_497033_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_071600497.1|497057_497363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075362600.1|498422_498674_+	protein FlxA	NA	NA	NA	NA	NA
WP_112029415.1|499122_500335_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.3	1.6e-164
WP_148880012.1|500301_500484_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.2e-06
WP_148880013.1|500423_501764_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001345551.1|502245_503274_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001265627.1|503270_503885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021513618.1|504093_504759_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_148880014.1|504961_505360_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.2	7.7e-63
WP_000054487.1|505400_506366_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705349.1|506346_506868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|506851_507079_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|507156_507564_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|507756_507909_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001320327.1|507920_508286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|508254_508542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|508957_509146_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|509142_509334_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_148880015.1|509427_510378_+	exonuclease	NA	NA	NA	NA	NA
WP_148880016.1|510380_511271_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.6	4.1e-165
WP_112029415.1|511591_512805_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.3	1.6e-164
WP_001296941.1|514612_514849_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_148880017.1|514883_516164_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001360138.1|516183_516294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836059.1|516351_517371_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|517382_518597_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001295395.1|518802_519129_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
>prophage 4
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	914067	964874	5075343	tail,terminase,capsid,portal,integrase,transposase,holin,head	Enterobacteria_phage(46.67%)	64	931351:931368	969179:969196
WP_075362625.1|914067_914337_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	96.6	2.7e-43
WP_148880028.1|914338_915652_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.7	2.0e-78
WP_089588473.1|915716_916316_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	6.5e-106
WP_148880029.1|916383_919857_-	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
WP_000649825.1|919990_920518_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	61.0	2.1e-60
WP_069723455.1|920548_920755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097479149.1|920708_921341_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	4.9e-104
WP_001357741.1|921286_922030_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	5.6e-147
WP_001299882.1|922035_922734_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847304.1|922733_923063_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_148880030.1|923059_925639_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.8	0.0e+00
WP_075362630.1|925619_926033_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	81.8	1.9e-40
WP_000479105.1|926059_926491_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001357739.1|926504_927257_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000683066.1|927264_927660_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975046.1|927656_928190_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_001204547.1|928205_928559_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201525.1|928551_928926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148880031.1|928977_930006_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	1.1e-113
WP_000256809.1|930063_930411_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253961.1|930447_931953_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
931351:931368	attL	GGCCTGCGCCAGATGACC	NA	NA	NA	NA
WP_000831765.1|931942_933535_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000259002.1|933531_933738_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_120490839.1|933721_935650_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	6.1e-262
WP_000235436.1|935621_936131_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_087205667.1|936454_937668_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.3	1.4e-163
WP_052916529.1|937838_938063_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.9	1.6e-20
WP_001303878.1|938144_938459_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|938986_939172_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|939399_939531_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|939543_939726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992175.1|939881_940415_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_024234348.1|940520_940793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774431.1|940758_941103_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000284518.1|941107_941323_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_075362568.1|941472_943326_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000024311.1|944104_945163_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	89.8	4.6e-187
WP_000917751.1|945313_945511_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000640035.1|945735_946290_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000140030.1|946298_946664_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.6	2.5e-36
WP_001265261.1|946664_947720_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.9e-88
WP_024173619.1|947721_948000_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000687436.1|948066_948327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|948484_949588_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001004956.1|949568_950219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|950384_950597_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001348170.1|950755_950992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000892866.1|951282_951978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148880032.1|951990_952644_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001151251.1|954109_954532_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_000054501.1|954572_955538_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_000705353.1|955518_956040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|956023_956254_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448563.1|956337_956745_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|956911_957067_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171930.1|957226_957445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299931.1|957448_957613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|958013_958202_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|958198_958390_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048392.1|958482_960954_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.7	2.9e-59
WP_000096345.1|961012_961216_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533621.1|961215_962241_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_001392298.1|962476_963274_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000059620.1|963611_964874_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	1.1e-73
969179:969196	attR	GGCCTGCGCCAGATGACC	NA	NA	NA	NA
>prophage 5
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	1108967	1118512	5075343		Bacillus_phage(28.57%)	8	NA	NA
WP_032172825.1|1108967_1110341_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.9	2.2e-32
WP_032224293.1|1110344_1111793_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.4	4.8e-54
WP_047662165.1|1111785_1112286_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_032173266.1|1112288_1113254_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	6.4e-87
WP_032173265.1|1113257_1114376_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.8	1.4e-133
WP_032173264.1|1114707_1115724_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	50.2	9.8e-86
WP_000183060.1|1116049_1116943_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115957.1|1117117_1118512_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 6
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	1156224	1232655	5075343	tail,plate,terminase,capsid,integrase,lysis,transposase,tRNA,holin,head	Escherichia_phage(32.0%)	76	1171053:1171079	1205222:1205248
WP_085947770.1|1156224_1157594_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000678988.1|1157894_1159142_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001197875.1|1159141_1162264_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000667585.1|1162264_1165342_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_000130837.1|1165342_1166758_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675150.1|1166754_1168158_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|1168154_1168877_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1169067_1169400_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1169546_1170908_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1171053:1171079	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000468308.1|1171181_1171400_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_087889721.1|1171481_1172645_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	5.4e-205
WP_000978875.1|1172644_1173124_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	3.3e-84
WP_087889722.1|1173138_1175586_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.2	0.0e+00
WP_000785970.1|1175578_1175698_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1175730_1176006_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|1176062_1176581_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286727.1|1176593_1177784_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_087889723.1|1178729_1179428_+	lysogenic protein	NA	Q858R8	Enterobacteria_phage	100.0	1.9e-128
WP_087889724.1|1179715_1180240_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.1	1.4e-88
WP_087889725.1|1180243_1182241_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	58.8	1.5e-146
WP_001285325.1|1182251_1182782_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121453.1|1182774_1183683_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_000127164.1|1183687_1184035_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001093716.1|1184031_1184667_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	2.0e-113
WP_087889726.1|1184750_1185536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001787.1|1185607_1186060_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_000917188.1|1186052_1186520_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_001440152.1|1186482_1186656_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_061360886.1|1186609_1187053_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	1.1e-65
WP_094315155.1|1187040_1187466_-	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	95.0	7.2e-59
WP_001144101.1|1187480_1187978_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|1187977_1188259_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|1188262_1188466_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|1188465_1188975_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_053921464.1|1189074_1189818_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	94.3	1.8e-121
WP_001248563.1|1189821_1190895_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.4	4.3e-201
WP_001085948.1|1190953_1191808_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156844.1|1191981_1193754_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_000993280.1|1194816_1195524_-	hypothetical protein	NA	A0A0F7LBP9	Escherichia_phage	100.0	2.5e-128
WP_001328453.1|1195520_1196747_-	RNA-directed DNA polymerase	NA	A0A0F7LDS3	Escherichia_phage	99.2	8.1e-220
WP_069903659.1|1197261_1198806_+	RNA-directed DNA polymerase	NA	Q2P9X0	Enterobacteria_phage	99.8	1.7e-291
WP_001317206.1|1198971_1199190_-	hypothetical protein	NA	Q2P9X1	Enterobacteria_phage	100.0	2.9e-35
WP_148880037.1|1199293_1201570_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.3	0.0e+00
WP_000027668.1|1201559_1201835_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
WP_001113264.1|1201831_1202056_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277961.1|1202055_1202358_-	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_000557703.1|1202357_1202582_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217679.1|1202645_1203146_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000043869.1|1203323_1203599_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|1203713_1204013_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_025210659.1|1204128_1205142_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	3.1e-193
WP_001323370.1|1205204_1205420_-	hypothetical protein	NA	NA	NA	NA	NA
1205222:1205248	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_001318299.1|1205407_1205725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807361.1|1206129_1207029_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|1207110_1207890_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_069723446.1|1207989_1209030_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_075362552.1|1210609_1211389_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_000289788.1|1211417_1212272_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000526135.1|1212497_1212956_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000129551.1|1213290_1214343_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|1214599_1215877_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|1215873_1216878_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011950.1|1216874_1217840_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1217813_1218560_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001373513.1|1218611_1219430_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.9e-24
WP_000822274.1|1219494_1220295_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195638.1|1220291_1221080_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|1221302_1221575_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134591.1|1221695_1222520_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|1222738_1223077_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_069723423.1|1224751_1227232_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677393.1|1227247_1227922_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|1228001_1228544_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|1228836_1229118_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|1229380_1230490_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001300883.1|1230621_1232655_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
>prophage 7
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	1244287	1253729	5075343		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|1244287_1245424_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001423058.1|1245420_1247421_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001373589.1|1247545_1248007_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001295430.1|1248047_1248518_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1248564_1249284_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1249280_1250966_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1251187_1251919_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1251978_1252086_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1252066_1252798_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|1252802_1253729_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 8
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	1734988	1820158	5075343	tail,plate,terminase,capsid,portal,integrase,holin,tRNA,head	Enterobacteria_phage(69.35%)	103	1746125:1746141	1823937:1823953
WP_001295367.1|1734988_1735525_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|1735549_1736185_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|1736393_1737242_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001196283.1|1737297_1737558_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_000128776.1|1737751_1737832_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986029.1|1738252_1738633_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001295365.1|1738632_1739364_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399389.1|1739375_1740104_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020749.1|1740115_1741021_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|1741017_1741698_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002541.1|1741969_1742944_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1742959_1744759_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589070.1|1744956_1745436_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812054.1|1745432_1746389_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
1746125:1746141	attL	CATTGCCGCGCTGTACC	NA	NA	NA	NA
WP_001168443.1|1746388_1747039_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|1747071_1747647_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|1747643_1747799_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_032216329.1|1748054_1749677_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001459997.1|1749661_1750399_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1750530_1751865_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001351830.1|1752073_1752955_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032216330.1|1753057_1753645_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1753700_1754084_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262723.1|1754388_1755078_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997403.1|1755125_1756163_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1756369_1756789_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001300438.1|1756857_1757556_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083005.1|1757587_1760248_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1760361_1761717_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|1761762_1762086_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|1762082_1763381_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|1769235_1771809_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040169.1|1771938_1772670_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079100.1|1772666_1773647_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1773781_1774519_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1774789_1775131_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000215756.1|1775281_1776088_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_001353016.1|1776032_1776230_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|1776422_1776719_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078916.1|1776854_1776995_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_071531535.1|1777000_1777189_+	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	61.9	5.3e-06
WP_047088188.1|1777185_1777446_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|1777488_1778598_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005367.1|1778755_1779940_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
WP_000290450.1|1779939_1780452_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|1780506_1780872_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|1780907_1781036_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_148880048.1|1781022_1783830_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	99.5	0.0e+00
WP_000979945.1|1783842_1784331_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_001165544.1|1784357_1784957_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
WP_148880049.1|1785027_1785456_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	55.6	5.8e-40
WP_097292480.1|1785466_1785898_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	59.6	2.3e-44
WP_148880050.1|1785908_1786385_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.6	4.6e-46
WP_089706663.1|1786391_1787003_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.5	1.0e-82
WP_148880051.1|1787002_1787461_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	53.1	1.5e-38
WP_096859101.1|1787471_1787966_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	58.5	3.8e-43
WP_148880052.1|1787976_1789587_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.1	1.1e-139
WP_000071724.1|1789583_1790192_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_148880053.1|1790184_1791081_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	3.0e-155
WP_000213447.1|1791084_1791435_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_107200155.1|1791431_1792013_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.6e-101
WP_023151575.1|1792009_1792645_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_000920594.1|1792637_1793105_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_072005442.1|1793091_1793271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107200154.1|1793242_1793638_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	91.9	2.0e-58
WP_032152536.1|1793634_1794180_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	87.7	2.2e-92
WP_000104344.1|1794234_1794558_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	92.5	4.8e-47
WP_000864897.1|1794560_1794761_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_148880054.1|1794760_1795255_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.0e-88
WP_111990542.1|1795358_1796159_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.7	8.4e-125
WP_001055107.1|1796204_1797257_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_148880055.1|1797280_1798117_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.9e-148
WP_148880056.1|1798270_1800022_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087812.1|1800021_1801068_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001519213.1|1801552_1801960_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	90.0	3.4e-21
WP_054192285.1|1801956_1802289_-	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	95.5	1.2e-53
WP_000211255.1|1802352_1802664_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	1.9e-48
WP_096860751.1|1802668_1803628_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.4e-179
WP_148880057.1|1803704_1806530_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.7	0.0e+00
WP_000564227.1|1806526_1806916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013452.1|1806988_1807219_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	89.5	3.6e-28
WP_023140813.1|1807586_1808417_-	SPFH/Band 7/PHB domain protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.6	3.3e-132
WP_001036813.1|1808413_1808617_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_000991530.1|1808628_1808928_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	1.5e-39
WP_000153674.1|1808924_1809170_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985161.1|1809166_1809370_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000021656.1|1809456_1809570_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|1809566_1809809_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159462.1|1809820_1810099_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000813365.1|1810109_1810451_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_001001394.1|1810469_1810796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001242988.1|1810891_1811194_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_000974887.1|1811260_1812250_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_010723158.1|1812417_1812465_+	phe operon leader peptide	NA	NA	NA	NA	NA
WP_000200120.1|1812563_1813724_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225229.1|1813766_1814888_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168037.1|1814898_1815969_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|1816178_1816544_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|1816693_1817212_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|1817201_1818428_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589847.1|1818443_1818926_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1819001_1819349_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1819390_1820158_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
1823937:1823953	attR	CATTGCCGCGCTGTACC	NA	NA	NA	NA
>prophage 9
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	1957048	1970231	5075343		Escherichia_phage(40.0%)	12	NA	NA
WP_032202565.1|1957048_1959610_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.9e-30
WP_001141339.1|1959715_1960372_+	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_001295181.1|1960422_1961190_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847985.1|1961385_1962294_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590404.1|1962290_1963553_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
WP_001278994.1|1963549_1964188_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|1964192_1964969_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_103743912.1|1965057_1966422_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|1966515_1967508_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|1967570_1968710_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1968849_1969476_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1969469_1970231_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 10
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	3518054	3525568	5075343	transposase	Escherichia_phage(33.33%)	11	NA	NA
WP_000692311.1|3518054_3518276_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001186726.1|3518338_3518815_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849571.1|3518830_3519316_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	1.5e-12
WP_001234620.1|3519370_3520189_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_071525596.1|3520209_3520344_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_001119729.1|3520288_3520522_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_122987528.1|3520600_3520987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139358370.1|3520895_3521030_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.6e-07
WP_085947970.1|3520995_3522209_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001573242.1|3522973_3523612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057722698.1|3523948_3525568_+	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	21.9	1.1e-06
>prophage 11
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	4086326	4101696	5075343	integrase	Enterobacteria_phage(81.82%)	15	4083440:4083452	4088049:4088061
4083440:4083452	attL	TAATTTATTAAAT	NA	NA	NA	NA
WP_021546001.1|4086326_4087496_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.4	9.7e-146
WP_021546002.1|4087497_4089201_+	AAA family ATPase	NA	NA	NA	NA	NA
4088049:4088061	attR	TAATTTATTAAAT	NA	NA	NA	NA
WP_024236189.1|4089197_4090820_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	23.8	3.1e-09
WP_021546004.1|4091023_4091596_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	99.5	1.8e-97
WP_000984202.1|4091610_4091856_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
WP_069913666.1|4091852_4092587_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	97.1	7.4e-128
WP_001149160.1|4093139_4093406_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_021570267.1|4093402_4093993_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.5e-67
WP_001244665.1|4093985_4094273_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459291.1|4094265_4094721_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4094856_4095177_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_069913665.1|4095191_4097525_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_001111347.1|4098142_4098553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121346.1|4098531_4099488_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_069723451.1|4099497_4101696_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	3.3e-38
>prophage 12
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	4591701	4649356	5075343	terminase,tail,protease,capsid,portal,integrase,lysis,transposase,holin,head	Enterobacteria_phage(46.97%)	74	4583202:4583216	4656210:4656224
4583202:4583216	attL	CTGGAAGATGGCCTG	NA	NA	NA	NA
WP_000533643.1|4591701_4592772_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_085947970.1|4592876_4594089_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_148880093.1|4594092_4594281_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.0	6.3e-23
WP_000545728.1|4594320_4594488_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_071525073.1|4594420_4594606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120063.1|4594730_4595333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|4595543_4595765_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_077887845.1|4595863_4596145_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000548531.1|4596155_4596347_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682318.1|4596319_4596502_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186804.1|4596498_4597179_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000100847.1|4597175_4597961_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|4597966_4598263_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001496530.1|4598231_4598384_-	hypothetical protein	NA	Q08J51	Stx2-converting_phage	98.0	4.7e-21
WP_000372924.1|4598338_4598482_-	host cell division inhibitory peptide Kil	NA	A0A0N7C011	Escherichia_phage	100.0	1.2e-18
WP_001198860.1|4598450_4598615_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_061090272.1|4598687_4599056_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	1.7e-64
WP_032194733.1|4599464_4599737_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
WP_000087627.1|4600170_4600704_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_001302016.1|4601055_4601751_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|4601826_4602042_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001300609.1|4602161_4602944_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000255944.1|4602940_4603963_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_024203136.1|4604142_4604439_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	4.4e-47
WP_148880094.1|4604471_4604738_+	replication protein	NA	K7P7F0	Enterobacteria_phage	100.0	1.3e-37
WP_112029397.1|4604740_4605954_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
WP_096855331.1|4606991_4607075_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	9.4e-08
WP_000145931.1|4607948_4608239_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736898.1|4608312_4608753_+	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_000153263.1|4608749_4609277_+	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	8.0e-100
WP_001254222.1|4609273_4609456_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566868.1|4609452_4609623_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001108038.1|4609615_4610227_+	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_001028841.1|4610223_4610889_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_000750155.1|4611100_4612060_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|4612398_4612521_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|4612535_4613225_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|4613409_4614153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|4614238_4614397_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023266.1|4614695_4616546_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411802.1|4616993_4617200_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_087205667.1|4617722_4618936_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.3	1.4e-163
WP_000092324.1|4619006_4619444_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.4e-70
WP_000881338.1|4619593_4620211_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	1.2e-91
WP_001307652.1|4620398_4620593_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001569616.1|4620987_4621497_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	32.2	3.6e-12
WP_075362660.1|4621468_4623397_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.7e-259
WP_000259002.1|4623380_4623587_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_069723232.1|4623583_4625176_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	9.3e-184
WP_044695875.1|4625165_4626671_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_000256723.1|4626707_4627055_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522623.1|4627112_4628141_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201513.1|4628192_4628576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204560.1|4628568_4628922_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000975031.1|4628936_4629470_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_000683065.1|4629466_4629862_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143022.1|4629869_4630622_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.1e-126
WP_000479115.1|4630635_4631067_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533411.1|4631093_4631507_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_075362656.1|4631487_4634067_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.4	0.0e+00
WP_000847393.1|4634063_4634393_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.7e-53
WP_001152529.1|4634392_4635091_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	2.9e-129
WP_001300229.1|4635095_4635839_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	5.7e-144
WP_000090913.1|4635775_4636378_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.6e-88
WP_000515383.1|4636438_4639834_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.9	0.0e+00
WP_001230425.1|4639901_4640501_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.3e-109
WP_000279086.1|4640565_4641879_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	98.6	4.1e-76
WP_001023455.1|4641880_4642150_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_141116231.1|4642326_4643307_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.2	5.5e-86
WP_096150060.1|4643653_4643785_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950984.1|4643948_4644830_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	1.0e-147
WP_032164481.1|4645046_4645877_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.9	1.7e-149
WP_001131649.1|4647204_4647780_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	76.4	1.8e-76
WP_001102750.1|4648117_4649356_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	82.3	3.6e-207
4656210:4656224	attR	CTGGAAGATGGCCTG	NA	NA	NA	NA
>prophage 13
NZ_CP043217	Escherichia coli O80:H26 strain EC-107 chromosome, complete genome	5075343	5062174	5075074	5075343		Enterobacteria_phage(23.08%)	23	NA	NA
WP_148880101.1|5062174_5064646_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	6.5e-59
WP_001090200.1|5064738_5064930_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|5064926_5065115_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_123002624.1|5065552_5065678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171933.1|5065681_5065900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379593.1|5066059_5066215_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001303511.1|5066507_5066786_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|5066787_5066979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169685.1|5066999_5067371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172735.1|5067468_5067771_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.1e-05
WP_000693841.1|5067767_5068193_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_148880102.1|5068264_5069335_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000788766.1|5069341_5070088_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	9.0e-113
WP_089519137.1|5070110_5070863_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.0	5.7e-83
WP_148880103.1|5070849_5071620_+	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	98.8	3.6e-141
WP_000951717.1|5071621_5071831_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	100.0	2.5e-36
WP_089519010.1|5071827_5072658_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	49.5	1.4e-61
WP_001278450.1|5072773_5072878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128513.1|5073067_5073280_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	3.6e-27
WP_001219082.1|5073524_5073884_+	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.9	7.1e-23
WP_000284536.1|5073886_5074363_+	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	33.3	1.7e-16
WP_001419074.1|5074573_5074804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032207160.1|5074795_5075074_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
>prophage 1
NZ_CP043218	Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence	102028	0	94808	102028	portal,transposase,integrase,terminase,tail,holin,head,lysis	Escherichia_phage(58.33%)	91	28477:28536	82745:84054
WP_001076427.1|0_861_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_001285362.1|1418_2615_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_042032541.1|2631_3633_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	4.8e-178
WP_059338140.1|3858_5565_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	6.3e-311
WP_148880105.1|5625_7215_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.3	7.1e-301
WP_148880106.1|7224_8040_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.1	4.4e-113
WP_000035301.1|8075_8657_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000509939.1|8668_9178_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_023156625.1|9294_9450_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	1.2e-14
WP_069723463.1|9631_9877_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	1.5e-13
WP_023154394.1|9927_10773_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	99.3	3.8e-152
WP_001187871.1|10802_11603_-	protein kilA	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_069723457.1|11766_12801_-	antirepressor	NA	A0A077SLI1	Escherichia_phage	95.6	2.2e-181
WP_000245709.1|12797_13019_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	98.6	3.6e-38
WP_000039791.1|13638_14151_+	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_001033469.1|14154_14694_+	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	100.0	1.8e-46
WP_069723458.1|14774_15341_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	98.4	4.3e-99
WP_001300609.1|15534_16317_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000255944.1|16313_17336_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_032163793.1|18351_18969_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.3	7.2e-84
WP_032163794.1|18932_19478_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000887652.1|20501_20831_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_033553843.1|20827_21271_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	99.3	1.1e-81
WP_033553842.1|21257_21860_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	98.5	3.9e-98
WP_033553841.1|21861_23781_+	phage protein DarA	NA	A0A1B0V7H1	Salmonella_phage	98.0	0.0e+00
WP_033553840.1|23777_24143_+	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	95.8	1.1e-44
WP_063119506.1|24155_27143_+	hypothetical protein	NA	Q1MVM9	Enterobacteria_phage	99.3	0.0e+00
WP_001165940.1|27132_27438_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	100.0	1.2e-52
28477:28536	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_112029415.1|28518_29732_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.3	1.6e-164
WP_063099965.1|30836_31325_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	98.8	4.2e-87
WP_042032566.1|31494_32052_+	lysozyme	NA	Q71TF3	Escherichia_phage	98.9	1.4e-105
WP_001369289.1|32187_32364_+	hypothetical protein	NA	Q71TR5	Escherichia_phage	96.6	7.9e-28
WP_000132937.1|32343_33363_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_069723461.1|33355_35065_-|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	99.3	0.0e+00
WP_069723462.1|35141_41909_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.6	0.0e+00
WP_000224043.1|41942_42383_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|42379_42628_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_024245513.1|42686_43196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059338150.1|43195_44236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024245511.1|44326_44968_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	96.7	1.5e-111
WP_148880107.1|45157_45679_-	recombinase	NA	Q71TG3	Escherichia_phage	96.4	2.8e-89
WP_001323889.1|46178_47756_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001161490.1|48065_48626_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_148880108.1|48629_51596_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.9	0.0e+00
WP_000904906.1|53436_54051_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_085959879.1|54115_55244_+|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_001082319.1|55351_56155_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|56154_56991_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001143760.1|57086_60092_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|60255_60813_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|60995_61856_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_148880109.1|62309_62621_-	lysogeny establishment protein	NA	Q5XLQ4	Enterobacteria_phage	92.2	3.1e-43
WP_046660036.1|62671_63703_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.4	6.4e-194
WP_000542332.1|63710_63932_-	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_001312283.1|64342_64456_+	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
WP_012817944.1|64474_64570_+	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_000874156.1|64535_64745_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611666.1|64855_65707_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	2.8e-158
WP_016231383.1|65739_66855_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	99.5	1.6e-206
WP_000124150.1|67432_68917_-|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_148880110.1|68916_70110_-|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	96.0	1.8e-200
WP_001326849.1|70195_70648_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_148880111.1|70736_71780_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.1	4.3e-206
WP_001339207.1|71807_71987_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
WP_137471994.1|71991_72372_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	9.7e-63
WP_001190712.1|72371_72593_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_148880117.1|72775_74332_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	7.6e-106
WP_148880112.1|74328_75549_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_029701843.1|75670_78787_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
WP_148880113.1|79051_79558_-	3'-phosphatase	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
WP_148880114.1|79630_80893_-	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.0	1.9e-232
WP_000267620.1|80894_81113_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_112029415.1|81548_82761_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.3	1.6e-164
WP_148880115.1|83205_83883_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	99.6	2.9e-134
WP_000484110.1|83879_84506_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
82745:84054	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCATTCCGGATCTTGCCAGAATGAACTCCAGATATGCGCTTTAACACTATTTGGTATCCACAGGGCACCGCTGCCACGATATTGTGGATGGTAAAAATCCCTAAGCATGGTGAAGCTGGTTGGTGGATGCTCTAGGATTGGGCGTATATCACCGGCAATAACCGTGTCCAAATCCAGATAGAACAGATCATCGGTTATATCCGGTCGGAACAACTCGATTTTCGCCCACCAGCCACGGCACTTTTGCCACTGGTTGATCAATGGGACAACTTTGACGCCAGGTACATGTAAACGCTTCAGGTCTGTCAGGCAAATAATTTCATAGCCTTTTGGCAGTTGATTAACCAGCCACTGCACATCGGAAGCGTTATAGTCACCACCAGAGCGAAAAACTAAAGCAATCTTCATGCTGCACCATCACCTTTCACTTTCATCAATGTCAGGTTTCCGCAAAATACGGCACCAGTGTCGATATACTGCTGATTCCAGAATGTCTTCGGGCTTTTCACCGGAGTGTGACCAAAGATAAAACGATCTGCGCCCGAAATTTCGCCACCAATATCATCCATCGAATCACTGATACGCTCGCGCGCCCAGACAACGTTGAAAAGCGGTACCTCCTTACCGAATTGGTATTCATTATCCGGATAGTCGGCATGGGCTATAACGATAGTTTCTTGCCCGGTGTTCAACTCAATGATATAGGGCAGACGCTTTACCAGCTCCACCAGCGCCCAGGCTAATATTTCCTGATCAGTGTCCAGCATGAAGAACCATTGCCCGCCATTCATTAGCCAGTTATTCACGTTGCCATCTGGACTTAACGCATCAATCATCAGCCGCTCATGGTTCCCCATCACTGCCCTGAACCAGGGCATCTGCAATAGTTCCAGACATTCGACATTTTCAGTACCGCGATCGATAAGGTCGCCGACCGATATCAGTAAATCCTGCTCCGGGTCAAAATCCACACGATGGAGTTCGGACATCAGTCTGGTGTAGCAACCATGCAGATCACCAACAACCCAGACATTCCTGTATTTGGTACCGTCGATACGGTGATAAATTGTGGGTGCCATCATGTATTCTTCAGCCATTCTTTAAGAGTCATCTGCGGAATACCTCCCATTTTCCCGCATGAAACAACGTCAATCTGTTCACGCGCAGACTGGAATAACAAAGGCAGGTGACTTAGATTTTTTGGCGTGCCGCCGGAGTGAACGCGTAGTTCTTGCGTAGCGTCAACGCCCACC	NA	NA	NA	NA
WP_012817939.1|84403_85066_-	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000096174.1|85007_85163_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000943615.1|85229_85808_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	92.7	3.4e-99
WP_000840930.1|85810_86056_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_000235786.1|86202_86580_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141908.1|86589_87807_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000896806.1|87810_88539_+	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_046659850.1|88525_89311_+	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	2.7e-144
WP_000212027.1|89312_90329_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.1	6.6e-191
WP_000535205.1|90321_90954_+	hypothetical protein	NA	A0A1B0V872	Salmonella_phage	100.0	6.9e-90
WP_001198652.1|91000_91999_-	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.4	2.1e-194
WP_001276603.1|91998_93363_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_001410793.1|93353_93569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234831.1|93835_94000_-	DUF3927 family protein	NA	Q71T96	Escherichia_phage	100.0	7.6e-17
WP_000900640.1|93999_94425_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_001068935.1|94616_94808_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
>prophage 2
NZ_CP043218	Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence	102028	98244	101710	102028		Escherichia_phage(83.33%)	6	NA	NA
WP_148880116.1|98244_99150_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	98.7	1.1e-157
WP_001177860.1|99142_99427_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_001311689.1|99701_99881_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
WP_001569402.1|99889_100678_+	hypothetical protein	NA	Q71TL4	Escherichia_phage	100.0	1.0e-119
WP_000007765.1|100717_101140_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
WP_059338141.1|101317_101710_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	98.5	2.6e-71
>prophage 1
NZ_CP043219	Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence	94175	7064	41465	94175	transposase,integrase	Escherichia_phage(50.0%)	47	NA	NA
WP_000844627.1|7064_7307_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001333190.1|7795_7984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000028208.1|7940_8273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429836.1|8309_8744_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|8815_9166_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|9179_9455_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|9490_9913_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|9964_11659_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|11676_12039_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|12035_12272_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|12268_12976_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|13014_14319_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|14365_15070_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|15259_16075_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067834.1|16225_16930_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000219391.1|17051_17957_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|17953_19192_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|19191_19776_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|19721_20078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|20268_21033_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024143553.1|21061_21244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130000.1|21259_21565_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|21575_22781_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|22936_23140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|23158_23338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|23267_24107_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|24100_24448_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|24611_25403_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|25408_25699_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|25810_26308_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845048.1|26452_27466_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|27668_28019_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_148880118.1|28038_28272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|28262_28967_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000105382.1|29134_30571_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001082319.1|30970_31774_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|31773_32610_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000957857.1|33308_33497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493287.1|33754_34084_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780220.1|34064_34346_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	37.0	6.5e-08
WP_021532651.1|34668_35613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024228791.1|35679_36030_-	protein stbB	NA	NA	NA	NA	NA
WP_000959870.1|36032_36995_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_023278197.1|37463_38480_+|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_001414321.1|38755_38941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077770043.1|39210_40113_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_023278197.1|40448_41465_+|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
