The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041023	Klebsiella pneumoniae strain KP1692 chromosome, complete genome	5370920	665567	703299	5370920	integrase,plate,lysis,tRNA,capsid,tail,terminase,head,portal,holin	Escherichia_phage(30.77%)	47	665440:665454	672989:673003
665440:665454	attL	TATTATACAAGAGGT	NA	NA	NA	NA
WP_032440347.1|665567_666569_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	1.0e-191
WP_015959031.1|666568_667144_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.7	5.2e-60
WP_001630878.1|667273_667537_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_047669828.1|667567_668077_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.3	7.5e-87
WP_065876412.1|668084_668285_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	5.6e-30
WP_015959029.1|668248_668587_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_032433641.1|668654_668882_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.6e-31
WP_117980290.1|668881_669103_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	90.4	1.5e-31
WP_117980289.1|669104_671324_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.0	0.0e+00
WP_117980288.1|671438_671879_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	79.6	7.0e-57
WP_077259525.1|672015_672636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117980287.1|672647_673679_+	hypothetical protein	NA	NA	NA	NA	NA
672989:673003	attR	TATTATACAAGAGGT	NA	NA	NA	NA
WP_004195876.1|674118_675162_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	6.8e-167
WP_117980286.1|675161_676931_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	3.1e-305
WP_032435918.1|677096_677951_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	1.6e-126
WP_023343321.1|678024_679083_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	1.1e-164
WP_032435917.1|679086_679830_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	80.7	1.0e-100
WP_025710538.1|679926_680433_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_019725382.1|680432_680636_+|tail	tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_019725381.1|680640_680931_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
WP_032435915.1|680917_681415_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	86.4	4.3e-79
WP_032435914.1|681411_681843_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	64.7	2.6e-40
WP_023323002.1|681938_682406_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.8	8.2e-64
WP_032435912.1|682398_682848_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	5.5e-49
WP_117132908.1|682916_683558_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.0	4.1e-90
WP_040174448.1|683554_683902_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	78.3	2.8e-45
WP_023317715.1|683906_684815_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.9	2.0e-114
WP_032435909.1|684807_685410_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.1	1.3e-53
WP_148830136.1|685411_686431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148830137.1|686448_687729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135717633.1|687737_688508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040227704.1|688515_688725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040227705.1|688730_689804_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	50.6	8.3e-35
WP_064168934.1|689913_691095_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	6.0e-196
WP_014343412.1|691108_691624_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_004195711.1|691683_691959_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_015959005.1|691973_692111_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
WP_117980282.1|692103_694542_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	72.0	4.8e-288
WP_023343304.1|694558_695038_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	80.9	1.3e-69
WP_117023258.1|695037_696198_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.4	2.4e-173
WP_117980281.1|696238_696646_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	5.4e-27
WP_023343301.1|696739_696958_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_002917636.1|697315_697822_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004144518.1|697921_699757_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|699975_701721_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|701832_702048_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004900709.1|702285_703299_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
>prophage 2
NZ_CP041023	Klebsiella pneumoniae strain KP1692 chromosome, complete genome	5370920	1184907	1293216	5370920	integrase,lysis,protease,tRNA,capsid,tail,transposase,terminase,head,portal	Enterobacteria_phage(28.3%)	115	1200285:1200301	1286758:1286774
WP_004213850.1|1184907_1185831_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_002914261.1|1186214_1186883_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002914260.1|1186924_1187473_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_082261848.1|1187542_1188193_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020803748.1|1188546_1189395_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020803766.1|1189450_1190071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020803765.1|1191080_1192013_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_004899997.1|1192018_1192747_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_012967389.1|1192747_1194268_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	2.2e-17
WP_020803761.1|1194298_1195102_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020803746.1|1195121_1196189_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_020803767.1|1196185_1197049_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_004145693.1|1197059_1198010_-	agmatinase	NA	NA	NA	NA	NA
WP_002914199.1|1198125_1199037_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000888203.1|1199435_1199915_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_004174783.1|1199984_1203137_-	multidrug efflux RND transporter permease subunit OqxB5	NA	NA	NA	NA	NA
1200285:1200301	attL	GATCAGAATGGCGTTTT	NA	NA	NA	NA
WP_020803752.1|1203160_1204336_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_085783913.1|1204669_1205032_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004212922.1|1205042_1205615_-	flavin oxidoreductase	NA	NA	NA	NA	NA
WP_020803747.1|1205826_1206711_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180956.1|1206835_1207636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422783.1|1208105_1209017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422782.1|1209021_1209348_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_046622185.1|1209393_1210017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046622135.1|1210023_1211199_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	91.5	7.1e-205
WP_046622137.1|1211153_1211366_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	76.1	1.2e-25
WP_046622139.1|1211484_1212003_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	91.9	9.7e-90
WP_031592550.1|1212043_1212484_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	83.6	1.5e-62
WP_020948182.1|1212480_1212699_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	94.4	3.3e-31
WP_046622147.1|1212670_1212925_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	88.1	3.0e-36
WP_023304721.1|1212917_1213283_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_004177202.1|1213283_1213508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313530.1|1213690_1214104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313529.1|1214267_1214942_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.1	1.9e-98
WP_071646927.1|1215082_1215316_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_023313528.1|1215317_1216079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409529.1|1216119_1216308_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_042632475.1|1216304_1217135_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	63.2	1.7e-72
WP_073511338.1|1217146_1218025_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.9	1.1e-85
WP_073511339.1|1218021_1219401_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	64.3	1.2e-158
WP_023313524.1|1219387_1219756_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.3	2.7e-38
WP_023313522.1|1219837_1220311_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	88.5	7.0e-79
WP_023313521.1|1220307_1221090_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.7	8.0e-112
WP_052749781.1|1221308_1221857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151282.1|1222025_1222274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313519.1|1222276_1222816_+	lysozyme	NA	H6WRZ4	Salmonella_phage	82.0	8.0e-87
WP_023313518.1|1222812_1223280_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	72.9	1.4e-55
WP_019705419.1|1223310_1223526_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	54.3	2.0e-12
WP_012967895.1|1223707_1223890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313517.1|1223975_1224269_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	70.1	2.2e-30
WP_023313516.1|1224617_1224848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705415.1|1224957_1225203_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	2.1e-34
WP_019705414.1|1225258_1225600_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	3.0e-47
WP_004177162.1|1225782_1226247_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_073511340.1|1226200_1227943_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.2	2.0e-139
WP_046622163.1|1227942_1229250_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.8	6.0e-213
WP_046622166.1|1229263_1230118_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	89.8	2.7e-137
WP_019705410.1|1230128_1231346_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	91.1	4.8e-204
WP_046622191.1|1231657_1231984_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	4.7e-42
WP_046622193.1|1231994_1232333_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	1.6e-40
WP_040088856.1|1232329_1232779_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	83.9	6.1e-64
WP_046622197.1|1232775_1233123_+	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	60.2	6.4e-29
WP_046622199.1|1233179_1233884_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.1	1.6e-79
WP_148830142.1|1233914_1234319_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.4	4.2e-32
WP_065802197.1|1234321_1234627_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	7.3e-29
WP_094936090.1|1234680_1235559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094936089.1|1235621_1238972_+|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	50.0	1.4e-226
WP_004177132.1|1238993_1239467_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_021441639.1|1239453_1239930_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	3.7e-51
WP_040181864.1|1239942_1240323_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	2.5e-58
WP_065802093.1|1240319_1243397_+	kinase	NA	A0A286S259	Klebsiella_phage	61.6	0.0e+00
WP_094936088.1|1243472_1245665_+	hypothetical protein	NA	A0A2H4YH15	Raoultella_phage	40.5	5.9e-96
WP_064278116.1|1245654_1246437_+	hypothetical protein	NA	A0A2H4YHE3	Raoultella_phage	30.9	4.6e-19
WP_148830143.1|1246668_1247328_-	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	64.0	2.7e-68
WP_148830144.1|1247336_1248251_-	hypothetical protein	NA	A0A0S1S5D9	Klebsiella_phage	62.6	7.6e-106
WP_148830145.1|1248376_1250062_-	hypothetical protein	NA	A0A0S1S5D9	Klebsiella_phage	47.5	1.1e-102
WP_073511357.1|1250153_1250732_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	93.4	2.2e-90
WP_004892499.1|1250782_1251205_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_023313495.1|1251612_1251861_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	69.1	1.4e-25
WP_002914164.1|1252637_1253120_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_029497287.1|1253230_1253707_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004145682.1|1253696_1253987_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1254052_1254394_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004174799.1|1254541_1256203_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1256289_1257168_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004174800.1|1257292_1257883_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004174801.1|1258002_1259289_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1259308_1260100_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1260263_1261628_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1261887_1262136_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1262154_1262703_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1262734_1263502_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1263541_1263889_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_004174802.1|1264008_1264467_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004174803.1|1264523_1265894_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_004145671.1|1265902_1266385_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002914116.1|1266398_1267622_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004174804.1|1267614_1268124_-	YfiR family protein	NA	NA	NA	NA	NA
WP_002914114.1|1268466_1269537_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004212948.1|1269546_1270668_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_004174805.1|1270730_1271603_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004150975.1|1271599_1272760_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100250063.1|1272860_1272908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914111.1|1273014_1273350_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032435923.1|1273620_1274358_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914110.1|1274489_1275470_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004212956.1|1275466_1276198_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_004150973.1|1276327_1278901_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_004144368.1|1284904_1286203_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
WP_020803929.1|1286206_1286530_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_004180947.1|1286571_1287927_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
1286758:1286774	attR	GATCAGAATGGCGTTTT	NA	NA	NA	NA
WP_004149373.1|1288047_1290699_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914092.1|1290733_1291432_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_002914091.1|1291501_1291927_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914089.1|1292130_1293216_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041023	Klebsiella pneumoniae strain KP1692 chromosome, complete genome	5370920	1710322	1717227	5370920	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1710322_1711186_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1711196_1711970_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_032410857.1|1712210_1713104_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1713349_1714711_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1715029_1715752_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_020804258.1|1715748_1717227_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.9	1.9e-29
>prophage 4
NZ_CP041023	Klebsiella pneumoniae strain KP1692 chromosome, complete genome	5370920	2802477	2813364	5370920		Escherichia_phage(85.71%)	9	NA	NA
WP_020805006.1|2802477_2805585_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_032436142.1|2805639_2806905_+	MFS transporter	NA	NA	NA	NA	NA
WP_020805010.1|2806935_2808024_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
WP_004176262.1|2808110_2808371_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|2808668_2809529_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2809549_2810311_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|2810301_2810535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032410308.1|2810572_2811475_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	3.8e-158
WP_002210516.1|2812743_2813364_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP041023	Klebsiella pneumoniae strain KP1692 chromosome, complete genome	5370920	3193628	3284868	5370920	integrase,tRNA,capsid,tail,transposase,terminase,head	Klebsiella_phage(50.0%)	93	3186248:3186265	3293131:3293148
3186248:3186265	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
WP_002901088.1|3193628_3194129_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3194245_3194692_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3194675_3195467_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|3195568_3196753_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_020804434.1|3196784_3197477_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|3197622_3198132_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3198118_3198475_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|3198464_3198704_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|3199004_3200018_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|3200075_3200177_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3200176_3200251_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3200368_3200494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3200552_3200816_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3200946_3201585_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3201674_3202589_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_019705576.1|3203250_3204294_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|3204595_3205804_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004213090.1|3205877_3207662_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3207668_3208559_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3208679_3210188_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3210498_3211185_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3211582_3211762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804935.1|3211801_3212434_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3213012_3213210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183659.1|3213325_3214336_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3214332_3215739_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3215794_3216682_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3216698_3217205_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3217231_3217726_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3217816_3218002_-	general stress protein	NA	NA	NA	NA	NA
WP_004140530.1|3219928_3220156_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004224175.1|3220182_3220362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150797.1|3220604_3220928_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3220920_3221313_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3221309_3222023_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3222295_3222448_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_014228924.1|3222768_3223092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151296.1|3223097_3223790_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_148830166.1|3224144_3225203_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	2.1e-14
WP_014907806.1|3225625_3227053_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	55.5	3.0e-101
WP_138920456.1|3227114_3238331_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	50.4	0.0e+00
WP_014228919.1|3238393_3239005_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_021462612.1|3239020_3239371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017880253.1|3239402_3240113_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	8.5e-137
WP_023289191.1|3240114_3240870_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_075917540.1|3240866_3241205_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	87.5	7.0e-57
WP_094936114.1|3241204_3244540_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.4	0.0e+00
WP_071603425.1|3244539_3244752_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
WP_014228914.1|3244772_3245138_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|3245195_3245657_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_094936113.1|3245688_3246042_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	82.0	7.9e-51
WP_017880258.1|3246038_3246428_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_094936112.1|3246408_3246747_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	1.2e-53
WP_032439854.1|3246743_3247061_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014228908.1|3247041_3247302_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	1.6e-21
WP_014228907.1|3247360_3248647_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_094936110.1|3250937_3251117_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	55.9	1.7e-09
WP_094936109.1|3251110_3252832_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.2	1.6e-189
WP_012542168.1|3252831_3253266_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_023289184.1|3253513_3253945_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
WP_023289183.1|3253941_3254265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3254216_3254579_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_023289182.1|3254905_3255130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3255168_3255606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085956072.1|3256432_3257552_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.5e-50
WP_109233370.1|3257614_3257764_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	67.4	1.7e-10
WP_109233369.1|3257763_3258684_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_004213850.1|3258970_3259894_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_004213850.1|3261201_3262125_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_114265703.1|3262395_3263757_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_094936102.1|3263762_3264344_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_094936101.1|3264546_3264987_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017898971.1|3265000_3265465_-	Replication protein 14	NA	A0A0U2JGJ0	Escherichia_phage	71.5	3.1e-63
WP_094936100.1|3265457_3266441_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.2	1.5e-43
WP_094936099.1|3266492_3267047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|3267049_3267265_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_094936098.1|3267366_3267756_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	1.1e-34
WP_072041890.1|3268598_3268793_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3268835_3269180_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_094936097.1|3269321_3271460_+	exonuclease	NA	S4TNL0	Salmonella_phage	41.9	4.7e-98
WP_012542206.1|3271512_3271758_+	excisionase	NA	NA	NA	NA	NA
WP_040203304.1|3271738_3272866_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	3.3e-119
WP_004150800.1|3272983_3274234_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3274474_3275125_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_094936096.1|3275141_3275600_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3275656_3276763_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004140557.1|3276817_3277459_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004176557.1|3277462_3278833_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
WP_015958193.1|3278887_3279250_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032410214.1|3279333_3280140_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150807.1|3280423_3281095_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_004176560.1|3282645_3283767_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004190938.1|3284376_3284868_-|transposase	transposase	transposase	NA	NA	NA	NA
3293131:3293148	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 6
NZ_CP041023	Klebsiella pneumoniae strain KP1692 chromosome, complete genome	5370920	4030316	4074772	5370920	coat,integrase,lysis,protease,tRNA,terminase,head	Salmonella_phage(21.43%)	63	4031406:4031420	4062988:4063002
WP_004178855.1|4030316_4031000_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
WP_023301680.1|4031052_4031805_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.2	1.7e-42
4031406:4031420	attL	CACCACCACCGTCAC	NA	NA	NA	NA
WP_040229586.1|4031873_4032266_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	3.9e-35
WP_004151265.1|4032262_4032688_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_068987102.1|4032690_4033053_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	9.6e-20
WP_148830179.1|4033052_4033226_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004178849.1|4033225_4033606_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
WP_029884066.1|4033608_4033848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040027496.1|4033880_4034936_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
WP_016529582.1|4034932_4035394_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_023341853.1|4035393_4036749_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	52.6	2.8e-128
WP_050584144.1|4036771_4037116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148830180.1|4037116_4038127_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.7	2.2e-114
WP_094819352.1|4038059_4039529_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	62.5	1.5e-159
WP_042935444.1|4039539_4041102_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.9	2.0e-303
WP_148830181.1|4041098_4041749_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	88.4	3.1e-101
WP_004178838.1|4042119_4042449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148830182.1|4042554_4043019_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	1.8e-55
WP_117090884.1|4043015_4043519_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	77.8	3.2e-74
WP_004146347.1|4043521_4043836_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_148830183.1|4044916_4045606_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	1.2e-63
WP_023301665.1|4045602_4045743_-	YlcG family protein	NA	NA	NA	NA	NA
WP_032442356.1|4045739_4046378_-	bacteriophage Lambda NinG protein	NA	H6WRY9	Salmonella_phage	68.9	2.4e-74
WP_148830184.1|4046370_4046541_-	NinE family protein	NA	G8C7V4	Escherichia_phage	69.6	8.2e-14
WP_064151812.1|4046546_4047143_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.7e-56
WP_109026969.1|4047300_4047504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148830185.1|4048468_4048849_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.4	2.3e-64
WP_148830186.1|4049325_4049601_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	76.8	1.0e-29
WP_148830187.1|4049597_4050008_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	44.5	1.9e-16
WP_004218528.1|4050004_4050307_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023304896.1|4050306_4051083_-	hypothetical protein	NA	A0A193GYX1	Enterobacter_phage	65.4	2.3e-95
WP_065520981.1|4051079_4051808_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	72.6	4.2e-38
WP_001548453.1|4051941_4052163_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_016831912.1|4052202_4052430_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	3.3e-18
WP_040227061.1|4052498_4053221_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	5.5e-75
WP_004178801.1|4053243_4053363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434121.1|4053561_4054278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434120.1|4054268_4054814_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_008807814.1|4055325_4055532_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_148830188.1|4055612_4056584_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	2.3e-39
WP_032431540.1|4056591_4056876_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.5e-39
WP_008807812.1|4056892_4057639_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
WP_008807811.1|4057635_4058259_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.7	9.0e-58
WP_148830189.1|4058287_4058815_+	phage N-6-adenine-methyltransferase	NA	G8EYI1	Enterobacteria_phage	61.6	4.2e-56
WP_148830190.1|4058811_4059033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148830191.1|4058918_4059536_+	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	47.0	6.0e-38
WP_040173672.1|4059532_4059724_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	3.5e-13
WP_085858690.1|4059720_4059942_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.4	1.4e-13
WP_115656171.1|4059979_4060603_+	AP2/ERF family transcription factor	NA	A0A2I7R856	Vibrio_phage	48.6	1.1e-36
WP_004151317.1|4060630_4060966_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_021441323.1|4060842_4062006_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_004143017.1|4062436_4063303_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4062988:4063002	attR	CACCACCACCGTCAC	NA	NA	NA	NA
WP_004143016.1|4063304_4063517_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_020803895.1|4063562_4064948_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004151319.1|4065123_4065618_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004893764.1|4065621_4066344_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_020803889.1|4066451_4066790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004893772.1|4066886_4067396_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004143002.1|4067392_4068460_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004151323.1|4068570_4069647_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004142997.1|4069754_4070900_-	porin	NA	NA	NA	NA	NA
WP_004151324.1|4073491_4074178_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
WP_002892267.1|4074145_4074772_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 1
NZ_CP041024	Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence	202516	20211	67893	202516	integrase,transposase,protease	Enterobacteria_phage(13.33%)	33	51960:51974	65045:65059
WP_011154590.1|20211_20418_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.2	2.7e-11
WP_004213628.1|20873_22106_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.0	6.3e-63
WP_004213626.1|22090_22735_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	5.6e-55
WP_074160420.1|22841_23069_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004213623.1|23084_24200_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_023302798.1|24342_27987_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	3.2e-46
WP_004902400.1|28091_29321_+	esterase family protein	NA	NA	NA	NA	NA
WP_004213617.1|29780_31955_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	30.6	2.8e-05
WP_148830201.1|32387_33281_-	EamA family transporter	NA	NA	NA	NA	NA
WP_023302796.1|35454_36108_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004213850.1|37301_38225_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_004214667.1|39520_40303_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
WP_004211839.1|45908_46919_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_073558148.1|46948_47230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071591903.1|47444_47693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004117790.1|48813_49785_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004902307.1|51033_51216_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004215130.1|51412_51853_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004189161.1|51849_52200_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
51960:51974	attL	TCCCTTCTCCGGCCA	NA	NA	NA	NA
WP_004902302.1|52230_53823_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004213807.1|54091_55060_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004186937.1|56774_57182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026549.1|57224_58184_+	DNA replication protein	NA	NA	NA	NA	NA
WP_004026550.1|58180_58939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024198104.1|58935_59259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026552.1|59408_59726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085353366.1|59791_60928_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_024198105.1|61105_61360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026558.1|61446_62508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026560.1|62828_63728_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	49.0	6.9e-67
WP_004026561.1|64563_65220_+	hypothetical protein	NA	NA	NA	NA	NA
65045:65059	attR	TGGCCGGAGAAGGGA	NA	NA	NA	NA
WP_077263727.1|65225_65564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026564.1|66957_67893_+|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
>prophage 2
NZ_CP041024	Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence	202516	82981	143045	202516	transposase,integrase,protease	Caulobacter_phage(16.67%)	56	110075:110102	144582:144609
WP_004026596.1|82981_84061_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
WP_004026598.1|84062_84836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026599.1|84828_85971_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
WP_004026600.1|85982_87041_-	ATP-grasp domain protein	NA	NA	NA	NA	NA
WP_004026602.1|87352_87937_+	tellurium resistance family protein	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
WP_004026603.1|87933_89085_+	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004026604.1|89107_89563_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_004026607.1|89586_90627_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026609.1|90665_91244_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026611.1|91330_91906_+	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_024198108.1|91990_93232_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_004026615.1|93567_94215_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004144375.1|95946_96807_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_077250518.1|97648_100606_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004210220.1|100619_101147_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004210218.1|101259_102273_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004225018.1|102478_103474_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004215186.1|103809_104757_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004215188.1|104872_105334_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004225020.1|105352_105535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004215173.1|105618_106521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004215174.1|106522_108748_+	exclusion suppressor FxsA	NA	NA	NA	NA	NA
WP_004225022.1|108796_109696_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004213078.1|109685_109976_-	hypothetical protein	NA	NA	NA	NA	NA
110075:110102	attL	AGATCCGGAACTACCTTTTTTCGGATCT	NA	NA	NA	NA
WP_004213077.1|110327_110534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213076.1|110523_110817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213075.1|110832_111966_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_004213073.1|112573_112804_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004213072.1|112800_113244_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_071591913.1|115023_115206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213938.1|115537_115813_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004213936.1|115740_115944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213934.1|116034_116955_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004213932.1|117556_117832_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004902152.1|117915_118344_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_004213927.1|118381_118942_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213925.1|118983_119244_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
WP_004213924.1|119910_122112_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_004213923.1|122193_123471_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_004213922.1|123474_125208_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_004213921.1|125207_126155_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004213920.1|126155_127880_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_004213919.1|128012_129236_+	MFS transporter	NA	NA	NA	NA	NA
WP_071591911.1|129585_129792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213918.1|129933_130128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145290.1|130988_131498_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
WP_073558141.1|132359_132599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902159.1|132599_132986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213424.1|134760_135468_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032412871.1|136130_137129_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004213250.1|137134_138091_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004213252.1|138112_138940_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
WP_004213850.1|139684_140608_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_077250517.1|140722_140881_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_004213558.1|141191_142121_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_004213560.1|142265_143045_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
144582:144609	attR	AGATCCGGAACTACCTTTTTTCGGATCT	NA	NA	NA	NA
