The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041022	Klebsiella pneumoniae strain KP1677 chromosome, complete genome	5371084	665577	703310	5371084	plate,portal,capsid,tail,tRNA,holin,head,integrase,lysis,terminase	Escherichia_phage(28.95%)	45	665450:665464	672999:673013
665450:665464	attL	TATTATACAAGAGGT	NA	NA	NA	NA
WP_032440347.1|665577_666579_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	1.0e-191
WP_015959031.1|666578_667154_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.7	5.2e-60
WP_001630878.1|667283_667547_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_047669828.1|667577_668087_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.3	7.5e-87
WP_065876412.1|668094_668295_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	5.6e-30
WP_015959029.1|668258_668597_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_032433641.1|668664_668892_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.6e-31
WP_117980290.1|668891_669113_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	90.4	1.5e-31
WP_117980289.1|669114_671334_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.0	0.0e+00
WP_117980288.1|671448_671889_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	79.6	7.0e-57
WP_077259525.1|672025_672646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117980287.1|672657_673689_+	hypothetical protein	NA	NA	NA	NA	NA
672999:673013	attR	TATTATACAAGAGGT	NA	NA	NA	NA
WP_004195876.1|674129_675173_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	6.8e-167
WP_117980286.1|675172_676942_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	3.1e-305
WP_032435918.1|677107_677962_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	1.6e-126
WP_023343321.1|678035_679094_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	1.1e-164
WP_032435917.1|679097_679841_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	80.7	1.0e-100
WP_025710538.1|679937_680444_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_019725382.1|680443_680647_+|tail	tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_019725381.1|680651_680942_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
WP_032435915.1|680928_681426_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	86.4	4.3e-79
WP_032435914.1|681422_681854_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	64.7	2.6e-40
WP_023323002.1|681949_682417_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.8	8.2e-64
WP_032435912.1|682409_682859_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	5.5e-49
WP_117132908.1|682927_683569_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.0	4.1e-90
WP_040174448.1|683565_683913_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	78.3	2.8e-45
WP_023317715.1|683917_684826_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.9	2.0e-114
WP_032435909.1|684818_685421_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.1	1.3e-53
WP_117980283.1|685422_687741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135717633.1|687749_688520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040227704.1|688527_688737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040227705.1|688742_689816_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	50.6	8.3e-35
WP_064168934.1|689925_691107_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	6.0e-196
WP_014343412.1|691120_691636_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_004195711.1|691695_691971_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_015959005.1|691985_692123_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
WP_117980282.1|692115_694554_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	72.0	4.8e-288
WP_117023258.1|695048_696209_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.4	2.4e-173
WP_117980281.1|696249_696657_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	5.4e-27
WP_023343301.1|696750_696969_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_002917636.1|697326_697833_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004144518.1|697932_699768_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|699986_701732_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|701843_702059_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004900709.1|702296_703310_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
>prophage 2
NZ_CP041022	Klebsiella pneumoniae strain KP1677 chromosome, complete genome	5371084	1184928	1293239	5371084	portal,transposase,capsid,tail,tRNA,head,integrase,lysis,terminase,protease	Enterobacteria_phage(27.45%)	113	1200307:1200323	1286781:1286797
WP_004213850.1|1184928_1185852_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_002914261.1|1186235_1186904_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002914260.1|1186945_1187494_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004218900.1|1187597_1188215_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020803748.1|1188568_1189417_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020803766.1|1189472_1190093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020803765.1|1191102_1192035_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_004899997.1|1192040_1192769_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_012967389.1|1192769_1194290_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	2.2e-17
WP_020803761.1|1194320_1195124_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020803746.1|1195143_1196211_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_020803767.1|1196207_1197071_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_004145693.1|1197081_1198032_-	agmatinase	NA	NA	NA	NA	NA
WP_002914199.1|1198147_1199059_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000888203.1|1199457_1199937_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_004174783.1|1200006_1203159_-	multidrug efflux RND transporter permease subunit OqxB5	NA	NA	NA	NA	NA
1200307:1200323	attL	GATCAGAATGGCGTTTT	NA	NA	NA	NA
WP_020803752.1|1203182_1204358_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_085783913.1|1204691_1205054_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004212922.1|1205064_1205637_-	flavin oxidoreductase	NA	NA	NA	NA	NA
WP_020803747.1|1205848_1206733_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180956.1|1206857_1207658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422783.1|1208127_1209039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422782.1|1209043_1209370_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_046622185.1|1209415_1210039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046622135.1|1210045_1211221_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	91.5	7.1e-205
WP_046622137.1|1211175_1211388_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	76.1	1.2e-25
WP_046622139.1|1211506_1212025_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	91.9	9.7e-90
WP_031592550.1|1212065_1212506_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	83.6	1.5e-62
WP_020948182.1|1212502_1212721_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	94.4	3.3e-31
WP_046622147.1|1212692_1212947_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	88.1	3.0e-36
WP_023304721.1|1212939_1213305_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_004177202.1|1213305_1213530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313530.1|1213712_1214126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313529.1|1214289_1214964_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.1	1.9e-98
WP_071646927.1|1215104_1215338_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_023313528.1|1215339_1216101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409529.1|1216141_1216330_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_042632475.1|1216326_1217157_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	63.2	1.7e-72
WP_148865096.1|1217168_1218062_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.8	6.6e-86
WP_023313524.1|1219407_1219776_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.3	2.7e-38
WP_023313522.1|1219857_1220331_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	88.5	7.0e-79
WP_023313521.1|1220327_1221110_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.7	8.0e-112
WP_052749781.1|1221328_1221877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151282.1|1222045_1222294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313519.1|1222296_1222836_+	lysozyme	NA	H6WRZ4	Salmonella_phage	82.0	8.0e-87
WP_023313518.1|1222832_1223300_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	72.9	1.4e-55
WP_019705419.1|1223330_1223546_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	54.3	2.0e-12
WP_012967895.1|1223727_1223910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313517.1|1223995_1224289_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	70.1	2.2e-30
WP_023313516.1|1224637_1224868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705415.1|1224977_1225223_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	2.1e-34
WP_019705414.1|1225278_1225620_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	3.0e-47
WP_004177162.1|1225802_1226267_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_073511340.1|1226220_1227963_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.2	2.0e-139
WP_046622163.1|1227962_1229270_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.8	6.0e-213
WP_046622166.1|1229283_1230138_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	89.8	2.7e-137
WP_019705410.1|1230148_1231366_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	91.1	4.8e-204
WP_046622191.1|1231677_1232004_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	4.7e-42
WP_046622193.1|1232015_1232354_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	1.6e-40
WP_040088856.1|1232350_1232800_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	83.9	6.1e-64
WP_046622197.1|1232796_1233144_+	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	60.2	6.4e-29
WP_046622199.1|1233200_1233905_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.1	1.6e-79
WP_148830142.1|1233935_1234340_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.4	4.2e-32
WP_065802197.1|1234342_1234648_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	7.3e-29
WP_094936090.1|1234700_1235579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094936089.1|1235641_1238992_+|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	50.0	1.4e-226
WP_004177132.1|1239013_1239487_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_021441639.1|1239473_1239950_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	3.7e-51
WP_040181864.1|1239962_1240343_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	2.5e-58
WP_065802093.1|1240339_1243417_+	kinase	NA	A0A286S259	Klebsiella_phage	61.6	0.0e+00
WP_085851070.1|1243492_1246219_+	hypothetical protein	NA	A0A0S1S5D9	Klebsiella_phage	53.5	5.4e-240
WP_148865097.1|1246227_1247127_+	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	64.4	1.6e-92
WP_064278116.1|1247118_1247901_-	hypothetical protein	NA	A0A2H4YHE3	Raoultella_phage	30.9	4.6e-19
WP_094936088.1|1247890_1250083_-	hypothetical protein	NA	A0A2H4YH15	Raoultella_phage	40.5	5.9e-96
WP_073511357.1|1250174_1250753_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	93.4	2.2e-90
WP_004892499.1|1250803_1251226_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_023313495.1|1251633_1251882_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	69.1	1.4e-25
WP_002914164.1|1252658_1253141_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_029497287.1|1253251_1253728_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004145682.1|1253717_1254008_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1254073_1254415_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004174799.1|1254562_1256224_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1256310_1257189_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004174800.1|1257313_1257904_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004174801.1|1258023_1259310_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1259329_1260121_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1260284_1261649_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1261908_1262157_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1262175_1262724_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1262755_1263523_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1263562_1263910_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_004174802.1|1264029_1264488_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004174803.1|1264544_1265915_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_004145671.1|1265923_1266406_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002914116.1|1266419_1267643_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004174804.1|1267635_1268145_-	YfiR family protein	NA	NA	NA	NA	NA
WP_002914114.1|1268487_1269558_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004212948.1|1269567_1270689_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_004174805.1|1270751_1271624_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004150975.1|1271620_1272781_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100250063.1|1272881_1272929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914111.1|1273035_1273371_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032435923.1|1273641_1274379_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914110.1|1274510_1275491_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004212956.1|1275487_1276219_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_004150973.1|1276348_1278922_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_004144368.1|1284927_1286226_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
WP_020803929.1|1286229_1286553_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_004180947.1|1286594_1287950_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
1286781:1286797	attR	GATCAGAATGGCGTTTT	NA	NA	NA	NA
WP_004149373.1|1288070_1290722_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914092.1|1290756_1291455_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_002914091.1|1291524_1291950_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914089.1|1292153_1293239_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP041022	Klebsiella pneumoniae strain KP1677 chromosome, complete genome	5371084	1710346	1717251	5371084	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1710346_1711210_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1711220_1711994_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_032410857.1|1712234_1713128_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1713373_1714735_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1715053_1715776_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_020804258.1|1715772_1717251_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.9	1.9e-29
>prophage 4
NZ_CP041022	Klebsiella pneumoniae strain KP1677 chromosome, complete genome	5371084	2802563	2813451	5371084		Escherichia_phage(87.5%)	10	NA	NA
WP_020805006.1|2802563_2805671_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_032436142.1|2805725_2806991_+	MFS transporter	NA	NA	NA	NA	NA
WP_020805010.1|2807021_2808110_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
WP_004176262.1|2808196_2808457_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|2808754_2809615_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2809635_2810397_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023148136.1|2810387_2810621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032410308.1|2810658_2811561_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	3.8e-158
WP_004183946.1|2811572_2812838_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|2812830_2813451_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP041022	Klebsiella pneumoniae strain KP1677 chromosome, complete genome	5371084	3193734	3284976	5371084	portal,transposase,capsid,tail,tRNA,head,integrase,terminase	Klebsiella_phage(52.5%)	96	3186354:3186371	3293241:3293258
3186354:3186371	attL	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
WP_002901088.1|3193734_3194235_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3194351_3194798_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3194781_3195573_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|3195673_3196858_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_020804434.1|3196889_3197582_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|3197727_3198237_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3198223_3198580_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|3198569_3198809_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|3199108_3200122_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|3200179_3200281_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3200280_3200355_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3200472_3200598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150783.1|3201049_3201688_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3201777_3202692_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_019705576.1|3203353_3204397_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|3204699_3205908_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004213090.1|3205980_3207765_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3207771_3208662_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3208782_3210291_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3210601_3211288_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3211685_3211865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804935.1|3211904_3212537_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3213115_3213313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183659.1|3213428_3214439_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3214435_3215842_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3215897_3216785_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3216801_3217308_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3217334_3217829_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3217919_3218105_-	general stress protein	NA	NA	NA	NA	NA
WP_021462619.1|3218726_3219920_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3220032_3220260_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004224175.1|3220286_3220466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150797.1|3220708_3221032_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3221024_3221417_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3221413_3222127_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3222399_3222552_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_014228924.1|3222872_3223196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064151296.1|3223201_3223894_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_148830166.1|3224248_3225307_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	2.1e-14
WP_014907806.1|3225729_3227157_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	55.5	3.0e-101
WP_138920456.1|3227218_3238435_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	50.4	0.0e+00
WP_014228919.1|3238497_3239109_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_021462612.1|3239124_3239475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017880253.1|3239506_3240217_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	8.5e-137
WP_023289191.1|3240218_3240974_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_075917540.1|3240970_3241309_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	87.5	7.0e-57
WP_094936114.1|3241308_3244644_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.4	0.0e+00
WP_071603425.1|3244643_3244856_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
WP_014228914.1|3244876_3245242_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|3245299_3245761_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_094936113.1|3245792_3246146_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	82.0	7.9e-51
WP_017880258.1|3246142_3246532_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_094936112.1|3246512_3246851_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	1.2e-53
WP_032439854.1|3246847_3247165_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014228908.1|3247145_3247406_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	1.6e-21
WP_014228907.1|3247464_3248751_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_032439853.1|3248828_3249749_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	1.4e-147
WP_094936111.1|3249785_3251045_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.4e-222
WP_094936110.1|3251044_3251224_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	55.9	1.7e-09
WP_094936109.1|3251217_3252939_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.2	1.6e-189
WP_012542168.1|3252938_3253373_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_023289184.1|3253620_3254052_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
WP_023289183.1|3254048_3254372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3254323_3254686_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_023289182.1|3255012_3255237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3255275_3255713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085956072.1|3256539_3257659_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.5e-50
WP_109233370.1|3257721_3257871_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	67.4	1.7e-10
WP_109233369.1|3257870_3258791_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_004213850.1|3259077_3260001_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_004213850.1|3261308_3262232_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_114265703.1|3262502_3263864_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_094936102.1|3263869_3264451_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_094936101.1|3264653_3265094_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017898971.1|3265107_3265572_-	Replication protein 14	NA	A0A0U2JGJ0	Escherichia_phage	71.5	3.1e-63
WP_094936100.1|3265564_3266548_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.2	1.5e-43
WP_094936099.1|3266599_3267154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|3267156_3267372_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_094936098.1|3267473_3267863_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	1.1e-34
WP_072041890.1|3268705_3268900_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3268942_3269287_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_094936097.1|3269428_3271567_+	exonuclease	NA	S4TNL0	Salmonella_phage	41.9	4.7e-98
WP_012542206.1|3271619_3271865_+	excisionase	NA	NA	NA	NA	NA
WP_040203304.1|3271845_3272973_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	3.3e-119
WP_004150800.1|3273090_3274341_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3274581_3275232_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_094936096.1|3275248_3275707_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3275763_3276870_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004140557.1|3276924_3277566_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004176557.1|3277569_3278940_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.2e-107
WP_015958193.1|3278994_3279357_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032410214.1|3279440_3280247_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150807.1|3280530_3281202_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_004147969.1|3281201_3282668_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004176560.1|3282753_3283875_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004190938.1|3284484_3284976_-|transposase	transposase	transposase	NA	NA	NA	NA
3293241:3293258	attR	ACGCCAAACCCCACCGTC	NA	NA	NA	NA
>prophage 6
NZ_CP041022	Klebsiella pneumoniae strain KP1677 chromosome, complete genome	5371084	3534418	3543882	5371084	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3534418_3536140_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3536184_3536886_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3537239_3537458_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3537578_3539858_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3539888_3540206_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3540531_3540753_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3540829_3542770_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3542766_3543882_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
NZ_CP041022	Klebsiella pneumoniae strain KP1677 chromosome, complete genome	5371084	4020905	4074898	5371084	tRNA,head,coat,integrase,lysis,terminase,protease	Cronobacter_phage(21.28%)	72	4016650:4016695	4062145:4062190
4016650:4016695	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_148830176.1|4020905_4023383_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.4	1.0e-197
WP_148830177.1|4023369_4023765_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	56.3	3.3e-37
WP_004199076.1|4023761_4024232_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_016531189.1|4024231_4024651_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
WP_148865102.1|4024750_4028218_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	46.0	3.6e-156
WP_148830178.1|4028284_4028983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032443148.1|4029134_4029551_-	toxin YafO type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
WP_004178856.1|4029552_4030125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178855.1|4030440_4031124_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
WP_023301680.1|4031176_4031929_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.2	1.7e-42
WP_040229586.1|4031997_4032390_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	3.9e-35
WP_004151265.1|4032386_4032812_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_068987102.1|4032814_4033177_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	9.6e-20
WP_148830179.1|4033176_4033350_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004178849.1|4033349_4033730_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
WP_029884066.1|4033732_4033972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040027496.1|4034004_4035060_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
WP_016529582.1|4035056_4035518_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_023341853.1|4035517_4036873_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	52.6	2.8e-128
WP_050584144.1|4036895_4037240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148830180.1|4037240_4038251_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.7	2.2e-114
WP_094819352.1|4038183_4039653_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	62.5	1.5e-159
WP_042935444.1|4039663_4041226_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.9	2.0e-303
WP_148830181.1|4041222_4041873_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	88.4	3.1e-101
WP_004178838.1|4042243_4042573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148830182.1|4042678_4043143_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	1.8e-55
WP_117090884.1|4043139_4043643_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	77.8	3.2e-74
WP_004146347.1|4043645_4043960_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_148830183.1|4045040_4045730_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	1.2e-63
WP_023301665.1|4045726_4045867_-	YlcG family protein	NA	NA	NA	NA	NA
WP_032442356.1|4045863_4046502_-	bacteriophage Lambda NinG protein	NA	H6WRY9	Salmonella_phage	68.9	2.4e-74
WP_148830184.1|4046494_4046665_-	NinE family protein	NA	G8C7V4	Escherichia_phage	69.6	8.2e-14
WP_064151812.1|4046670_4047267_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.7e-56
WP_109026969.1|4047424_4047628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148830185.1|4048592_4048973_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.4	2.3e-64
WP_148830186.1|4049449_4049725_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	76.8	1.0e-29
WP_148830187.1|4049721_4050132_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	44.5	1.9e-16
WP_004218528.1|4050128_4050431_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023304896.1|4050430_4051207_-	hypothetical protein	NA	A0A193GYX1	Enterobacter_phage	65.4	2.3e-95
WP_065520981.1|4051203_4051932_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	72.6	4.2e-38
WP_001548453.1|4052065_4052287_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_016831912.1|4052326_4052554_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	3.3e-18
WP_040227061.1|4052622_4053345_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	5.5e-75
WP_004178801.1|4053367_4053487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434121.1|4053685_4054402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434120.1|4054392_4054938_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_008807814.1|4055449_4055656_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_148830188.1|4055736_4056708_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	2.3e-39
WP_032431540.1|4056715_4057000_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.5e-39
WP_008807812.1|4057016_4057763_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
WP_008807811.1|4057759_4058383_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.7	9.0e-58
WP_148830189.1|4058411_4058939_+	phage N-6-adenine-methyltransferase	NA	G8EYI1	Enterobacteria_phage	61.6	4.2e-56
WP_148830190.1|4058935_4059157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148830191.1|4059042_4059660_+	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	47.0	6.0e-38
WP_040173672.1|4059656_4059848_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	3.5e-13
WP_085858690.1|4059844_4060066_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.4	1.4e-13
WP_115656171.1|4060103_4060727_+	AP2/ERF family transcription factor	NA	A0A2I7R856	Vibrio_phage	48.6	1.1e-36
WP_004151317.1|4060754_4061090_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_021441323.1|4060966_4062130_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_004143017.1|4062560_4063427_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4062145:4062190	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4063428_4063641_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_020803895.1|4063686_4065072_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004151319.1|4065247_4065742_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004893764.1|4065745_4066468_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_020803889.1|4066575_4066914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004893772.1|4067010_4067520_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004143002.1|4067516_4068584_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004151323.1|4068695_4069772_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004142997.1|4069879_4071025_-	porin	NA	NA	NA	NA	NA
WP_004177220.1|4071206_4073621_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004151324.1|4073617_4074304_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
WP_002892267.1|4074271_4074898_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
