The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040927	Escherichia coli strain YY76-1 chromosome, complete genome	4595444	998764	1011947	4595444		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|998764_999526_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|999519_1000146_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1000285_1001425_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1001487_1002480_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1002573_1003938_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1004026_1004803_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1004807_1005446_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1005442_1006705_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1006701_1007610_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1007805_1008573_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1008623_1009280_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_113402217.1|1009385_1011947_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP040927	Escherichia coli strain YY76-1 chromosome, complete genome	4595444	1607957	1617398	4595444		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|1607957_1608884_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1608888_1609620_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1609600_1609708_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1609767_1610499_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1610720_1612406_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1612402_1613122_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_063108270.1|1613168_1613639_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.5e-81
WP_001295429.1|1613678_1614140_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|1614264_1616265_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001292769.1|1616261_1617398_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 3
NZ_CP040927	Escherichia coli strain YY76-1 chromosome, complete genome	4595444	1744594	1787810	4595444	integrase,coat,holin,terminase,transposase,protease,portal,lysis	Enterobacteria_phage(46.03%)	65	1740747:1740759	1746979:1746991
1740747:1740759	attL	CCTTTACCGGCTT	NA	NA	NA	NA
WP_025404398.1|1744594_1745773_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.7	1.5e-231
WP_000132739.1|1745753_1745945_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_024171809.1|1746022_1746367_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	1.5e-59
WP_000545737.1|1746395_1746563_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_038348890.1|1746643_1746835_-	hypothetical protein	NA	G8C7S2	Escherichia_phage	65.6	3.1e-17
WP_000002117.1|1746946_1747228_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	96.7	1.1e-47
1746979:1746991	attR	CCTTTACCGGCTT	NA	NA	NA	NA
WP_148245889.1|1747220_1747925_-	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	87.9	4.4e-77
WP_094336379.1|1747926_1748226_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	98.0	3.6e-57
WP_148245890.1|1748222_1748780_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	63.8	1.0e-60
WP_001214456.1|1748776_1748941_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_148245891.1|1748951_1749245_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.1e-50
WP_000951323.1|1749268_1749652_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_024236197.1|1749651_1750257_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	4.6e-107
WP_025404389.1|1750513_1750666_-	host cell division inhibitory peptide Kil	NA	K7PKW3	Enterobacterial_phage	98.0	1.2e-19
WP_000638547.1|1750650_1750782_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_106699107.1|1750805_1751774_-	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	91.3	6.5e-55
WP_148245955.1|1751949_1752201_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	98.8	2.8e-42
WP_000422741.1|1752612_1753038_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1753034_1753385_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|1753415_1755029_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_148245892.1|1755055_1755295_-	hypothetical protein	NA	K7PKE4	Enterobacteria_phage	100.0	1.7e-25
WP_000233126.1|1755662_1756031_-	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	100.0	1.3e-56
WP_000428318.1|1756049_1756766_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000620665.1|1756872_1757067_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_001177655.1|1757175_1757454_+	transcriptional regulator	NA	A4KWU5	Enterobacteria_phage	95.7	4.0e-42
WP_000166207.1|1757488_1757635_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000067065.1|1757627_1758488_+	replication protein	NA	K7PL20	Enterobacteria_phage	100.0	3.0e-160
WP_001331794.1|1758595_1760476_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	100.0	0.0e+00
WP_148245893.1|1760565_1760781_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	57.7	8.0e-14
WP_000814617.1|1760979_1761390_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_148245894.1|1761386_1761569_+	NinE family protein	NA	K7PH75	Enterobacterial_phage	96.7	1.4e-27
WP_148245895.1|1761547_1761736_+	protein ninF	NA	A0A0K2FJ27	Escherichia_phage	93.3	2.3e-25
WP_148245896.1|1761728_1762451_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	98.8	4.6e-130
WP_148245897.1|1762450_1762741_+	DUF1364 family protein	NA	K7PK25	Enterobacteria_phage	97.9	1.9e-50
WP_001008199.1|1762737_1763100_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_016063210.1|1763096_1763291_+	NinH protein	NA	K7PMJ0	Enterobacteria_phage	100.0	6.0e-29
WP_000512797.1|1763281_1763800_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.8	4.5e-95
WP_015966862.1|1764300_1764624_+|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	100.0	2.2e-52
WP_000229396.1|1764607_1765084_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_000092296.1|1765080_1765518_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_016063189.1|1765554_1765830_+	hypothetical protein	NA	K7P6G5	Enterobacteria_phage	100.0	2.7e-46
WP_000807788.1|1766124_1766367_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000729920.1|1766446_1766935_+	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_000417850.1|1766912_1768412_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	1.2e-305
WP_062810285.1|1768412_1770578_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.8	0.0e+00
WP_000373006.1|1770591_1771503_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_001196948.1|1771502_1772798_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	2.7e-242
WP_114078601.1|1772850_1773441_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	62.2	3.8e-58
WP_021514122.1|1773418_1773919_+	hypothetical protein	NA	G8EYJ2	Enterobacteria_phage	100.0	1.7e-91
WP_058914976.1|1773919_1775338_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.4	2.1e-275
WP_089602608.1|1775337_1776291_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	4.1e-94
WP_000614042.1|1776290_1776746_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.2e-87
WP_016246148.1|1776748_1777441_+	hypothetical protein	NA	A0A2H4FUQ9	Salmonella_phage	99.6	1.5e-117
WP_137517787.1|1777451_1778831_+	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	98.6	8.0e-224
WP_148245956.1|1778830_1780669_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.3	9.0e-247
WP_000726435.1|1780686_1780875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029403246.1|1780992_1781412_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	96.4	5.6e-72
WP_000090241.1|1781428_1781680_-	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	1.3e-39
WP_000677939.1|1781770_1781932_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_023277599.1|1782000_1782879_+	antirepressor protein ant	NA	I6R977	Salmonella_phage	78.9	1.1e-96
WP_148245898.1|1782979_1785043_+	hypothetical protein	NA	Q9AYY6	Salmonella_phage	37.6	9.0e-62
WP_148245899.1|1785114_1785450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148245900.1|1785556_1785922_-	GtrA family protein	NA	U5P0S6	Shigella_phage	89.9	2.9e-48
WP_072274331.1|1786168_1786300_+	umuD domain protein	NA	O64339	Escherichia_phage	66.7	3.6e-09
WP_148245901.1|1786643_1787810_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	1.6e-225
>prophage 4
NZ_CP040927	Escherichia coli strain YY76-1 chromosome, complete genome	4595444	1906942	1916079	4595444	transposase	Enterobacteria_phage(42.86%)	9	NA	NA
WP_023318679.1|1906942_1908265_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	1.4e-12
WP_148245905.1|1908254_1909088_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072664163.1|1909117_1909948_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_072657387.1|1910039_1910594_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.0	1.9e-51
WP_072657386.1|1910608_1911499_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	4.8e-28
WP_072657385.1|1911530_1912400_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	5.2e-112
WP_072657384.1|1912414_1913479_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.3e-104
WP_001118621.1|1914014_1914938_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
WP_072657383.1|1915161_1916079_+|transposase	IS5-like element ISEc35 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	3.3e-101
>prophage 5
NZ_CP040927	Escherichia coli strain YY76-1 chromosome, complete genome	4595444	2232026	2335853	4595444	integrase,terminase,transposase,protease,portal,tail,lysis	Enterobacteria_phage(41.3%)	99	2288528:2288543	2338089:2338104
WP_001260865.1|2232026_2232848_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2232947_2233031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2233123_2233459_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2233855_2235109_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2235215_2236109_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2236243_2237464_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2237588_2238284_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2238236_2239529_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2239688_2240303_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2240345_2241200_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2241201_2241819_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072643462.1|2241829_2244253_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
WP_001300836.1|2246938_2247244_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2247351_2248062_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2248064_2248625_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2248659_2249001_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2249135_2249462_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2249667_2250882_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2250893_2251913_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2251970_2252081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087121889.1|2253358_2254520_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001019207.1|2254923_2255097_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|2255269_2255425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|2255572_2255761_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2255771_2255984_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071774.1|2256347_2256845_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_029364068.1|2256841_2257375_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	2.6e-98
WP_001013163.1|2257502_2257799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000165360.1|2257823_2258042_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.8	1.6e-17
WP_000839587.1|2258046_2258262_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_063501604.1|2258452_2259166_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063501605.1|2259572_2260532_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|2260724_2261249_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_077880228.1|2262097_2264035_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.5e-58
WP_001296941.1|2264122_2264359_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_113402261.1|2264378_2264501_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	86.2	1.7e-08
WP_087121889.1|2264514_2265677_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_072667107.1|2265761_2265926_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	98.1	1.2e-22
WP_023281932.1|2265934_2268034_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	97.1	0.0e+00
WP_001072975.1|2268030_2268243_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985944.1|2268242_2269751_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	100.0	1.6e-289
WP_077628251.1|2269695_2271723_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	100.0	0.0e+00
WP_001097051.1|2271809_2272133_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001283153.1|2272125_2272401_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_063501731.1|2272412_2272991_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	3.0e-100
WP_001079419.1|2272987_2273389_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211096.1|2273399_2274143_+|tail	tail protein	tail	K7PGT7	Enterobacteria_phage	99.2	2.0e-133
WP_063501734.1|2274203_2274590_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	1.1e-61
WP_063501730.1|2274598_2274877_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	5.1e-45
WP_063501729.1|2274899_2277965_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.3	0.0e+00
WP_000447253.1|2277964_2278294_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_072666924.1|2278303_2279002_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.3e-133
WP_001399694.1|2279648_2280296_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_072666923.1|2280355_2283769_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.5	0.0e+00
WP_148245908.1|2283839_2284439_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	3.1e-108
WP_148245909.1|2284503_2287809_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	69.0	5.0e-280
WP_072144121.1|2287863_2287983_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
WP_000086527.1|2288080_2288671_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
2288528:2288543	attL	ACTGGTTGCTGCTGAG	NA	NA	NA	NA
WP_000836768.1|2288987_2289221_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2289289_2289403_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2290006_2291290_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_063091469.1|2291378_2292839_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.1e-41
WP_000214712.1|2292873_2293077_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|2293253_2293940_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000636571.1|2294028_2294775_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000210373.1|2294911_2296957_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024558.1|2297000_2297519_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671737.1|2297796_2298189_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592802.1|2298443_2299334_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
WP_000901367.1|2299552_2299648_-	protein MgtS	NA	NA	NA	NA	NA
WP_000087211.1|2301155_2302055_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803653.1|2302085_2302304_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2302335_2302719_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|2302739_2303174_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000273128.1|2303393_2303714_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
WP_000268704.1|2303703_2303988_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000885033.1|2304108_2304774_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_148245910.1|2304798_2305989_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_096106280.1|2306138_2306462_-	putative protein YneK	NA	NA	NA	NA	NA
WP_094888127.1|2306359_2307253_-	putative protein YneK	NA	NA	NA	NA	NA
WP_063501722.1|2307330_2308212_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000156615.1|2308312_2309701_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|2309764_2310691_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191027.1|2310690_2311050_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000854633.1|2312833_2314285_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_001351738.1|2314491_2315406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286597.1|2315409_2316168_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|2316224_2316515_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774183.1|2316538_2317414_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_063501672.1|2317440_2318463_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222732.1|2318474_2319467_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911166.1|2319466_2320495_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194916.1|2320488_2322024_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	9.4e-16
WP_000154352.1|2322272_2323226_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113145.1|2323304_2324897_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_148245911.1|2325427_2330848_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.0	1.5e-140
WP_001301023.1|2331070_2331337_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_113402168.1|2331336_2332659_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001741675.1|2334287_2335853_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2338089:2338104	attR	ACTGGTTGCTGCTGAG	NA	NA	NA	NA
>prophage 6
NZ_CP040927	Escherichia coli strain YY76-1 chromosome, complete genome	4595444	2706706	2716206	4595444	holin,lysis	Enterobacteria_phage(37.5%)	9	NA	NA
WP_112023872.1|2706706_2707030_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000539894.1|2707132_2707285_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
WP_063091313.1|2708958_2709177_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	81.4	3.6e-14
WP_001291105.1|2709169_2709961_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2710098_2711556_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2711752_2711938_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_032217964.1|2712154_2712631_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.7e-85
WP_000544528.1|2712617_2712923_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_000444487.1|2714955_2716206_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 7
NZ_CP040927	Escherichia coli strain YY76-1 chromosome, complete genome	4595444	3557596	3614335	4595444	holin,tail,transposase	Shigella_phage(31.03%)	56	NA	NA
WP_000131044.1|3557596_3559630_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3559758_3560346_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3560359_3561832_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3561845_3563516_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3563728_3564397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3564639_3565335_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3565327_3566755_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3566765_3567485_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3568011_3568866_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|3569091_3570417_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3570525_3570762_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3570773_3571367_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_113402161.1|3572966_3577082_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3578196_3578298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3578661_3578925_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3578924_3579065_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3579099_3579327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063501778.1|3580150_3580693_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3580767_3581355_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3581412_3582081_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_113402160.1|3582106_3584632_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3584621_3586265_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3586233_3586944_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3587256_3587586_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070699.1|3588863_3589553_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|3589549_3590506_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_063501779.1|3590502_3592701_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.5	9.6e-38
WP_000121346.1|3592710_3593667_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3593645_3594056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052318513.1|3594575_3595850_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_000355479.1|3596449_3597223_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	3.2e-36
WP_064226633.1|3597280_3597835_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.0	9.7e-88
WP_074468292.1|3597864_3598398_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.9	2.6e-58
WP_087651155.1|3598397_3599000_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.5	4.7e-96
WP_087651154.1|3598971_3599415_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	72.1	6.4e-58
WP_001067855.1|3599571_3600276_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_100209684.1|3600966_3601356_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.1e-67
WP_001547992.1|3601352_3601679_-	LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	7.8e-53
WP_000066917.1|3601675_3602329_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001332382.1|3602328_3602823_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104954.1|3602819_3603761_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|3603750_3603930_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001560799.1|3604105_3604657_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.9	5.8e-101
WP_000649477.1|3604700_3604901_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3604991_3605666_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549626.1|3605900_3606107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3606078_3606513_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_087601721.1|3606431_3606725_-	hypothetical protein	NA	U5P0J5	Shigella_phage	97.9	1.2e-49
WP_077626407.1|3606780_3607002_+	hypothetical protein	NA	S5FNS4	Shigella_phage	95.9	2.4e-37
WP_032192508.1|3607057_3607594_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	6.3e-100
WP_001242717.1|3607584_3607947_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206810.1|3607946_3608252_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_077873866.1|3608167_3608602_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_063091315.1|3610623_3611877_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
WP_001285288.1|3611888_3612992_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3613279_3614335_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 1
NZ_CP040928	Escherichia coli strain YY76-1 plasmid pYY76-1-1, complete sequence	163111	0	114886	163111	integrase,transposase,tail	Salmonella_phage(56.45%)	106	40546:40605	58222:59080
WP_001711119.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	93.8	3.3e-177
WP_063122723.1|1665_1878_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	9.9e-33
WP_072662960.1|1877_2213_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	83.6	1.7e-47
WP_077580900.1|2209_2389_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	81.4	2.1e-15
WP_023135696.1|2428_2704_-	hypothetical protein	NA	J9Q738	Salmonella_phage	91.2	1.1e-44
WP_148245959.1|3584_6602_-	DEAD/DEAH box helicase family protein	NA	A0A220A398	Liberibacter_phage	25.4	1.6e-22
WP_063085660.1|6616_7780_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_113388158.1|7789_9070_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_113388149.1|9087_11517_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.4	6.1e-25
WP_113388150.1|11944_12145_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	53.0	3.0e-07
WP_148245960.1|12235_14575_-	recombinase RecA	NA	J9Q736	Salmonella_phage	87.8	6.0e-30
WP_000920226.1|14577_14844_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_023135728.1|14843_15788_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	2.0e-181
WP_123902826.1|15848_16865_-	regulator	NA	J9Q7Z3	Salmonella_phage	99.0	2.0e-163
WP_053292493.1|16984_17416_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	5.8e-72
WP_049885240.1|17525_18086_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	85.0	1.1e-78
WP_089075257.1|18114_21621_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	92.8	0.0e+00
WP_024144831.1|21595_21799_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	97.0	1.0e-31
WP_097558678.1|21801_23037_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	98.3	6.9e-235
WP_148245961.1|23132_25457_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	86.4	0.0e+00
WP_024172742.1|25569_25782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003980690.1|26038_26428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096313690.1|26422_27526_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.9	1.9e-26
WP_001067855.1|27777_28482_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|30392_30950_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|31132_31993_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|32142_32544_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|32590_33295_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|34050_34902_+	replication protein	NA	NA	NA	NA	NA
WP_063816876.1|35209_36025_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	29.0	3.5e-09
WP_001082319.1|36085_36889_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|36888_37725_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|37785_38490_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_148245962.1|38501_39506_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.7	4.1e-68
WP_001083725.1|39650_40148_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|40259_40550_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
40546:40605	attL	GTTAGACATCATGAGGGAAGCGGTGACCATCGAAATTTCGAACCAACTATCAGAGGTGCT	NA	NA	NA	NA
WP_001206356.1|40555_41347_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|41510_41858_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|41851_42691_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|42620_42800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376616.1|42818_43022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|43177_44383_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|44393_44699_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|44714_44897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|44925_45690_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|45880_46237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|46182_46767_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|46766_48005_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|48001_48907_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|49028_49733_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032187680.1|49904_50420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023135645.1|51492_51798_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	92.1	2.3e-46
WP_089075250.1|51794_51947_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	82.0	1.0e-15
WP_003980695.1|51946_52153_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	94.0	1.7e-29
WP_000480968.1|52259_53096_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|53095_53899_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001067855.1|56726_57431_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_065799591.1|57321_58086_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	36.9	1.3e-26
WP_001206356.1|58231_59023_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_065799592.1|59154_59967_+	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
58222:59080	attR	GTTAGACATCATGAGGGAAGCGGTGACCATCGAAATTTCGAACCAACTATCAGAGGTGCTAAGCGTCATTGAGCGCCATCTGGAATCAACGTTGCTGGCCGTGCATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCATACAGCGATATTGATTTGTTGGTTACTGTGGCCGTAAAGCTTGATGAAACGACGCGGCGAGCATTGCTCAATGATCTTATGGAGGCTTCGGCTTTCCCTGGCGAGAGCGAGACGCTCCGCGCTATAGAAGTCACCCTTGTCGTGCATGACGACATCATCCCGTGGCGTTATCCGGCTAAGCGCGAGCTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCGGGTATCTTCGAGCCAGCCATGATCGACATTGATCTAGCTATCCTGCTTACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCGGCAGCGGAGGAATTCTTTGACCCGGTTCCTGAACAGGATCTATTCGAGGCGCTGAGGGAAACCTTGAAGCTATGGAACTCGCAGCCCGACTGGGCCGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAATAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATAAAACGCCTACCTGCCCAGTATCAGCCCGTCTTACTTGAAGCTAAGCAAGCTTATCTGGGACAAAAAGAAGATCACTTGGCCTCACGCGCAGATCACTTGGAAGAATTTATTCGCTTTGTGAAAGGCGAGATCATCAAGTCAGTTGGTAAATGATGTCTAACAATTCGTTCAAGCCGACCGCGCTACGCGCGGCGGCTTAACTCCGGCGTT	NA	NA	NA	NA
WP_001067858.1|59978_60683_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_088224569.1|60783_61554_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058657119.1|61770_62985_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|63012_63318_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|63429_64923_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067858.1|65090_65795_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067855.1|68604_69309_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067858.1|70019_70724_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000084745.1|71058_71451_+	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_063102497.1|71770_72157_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_001067855.1|72324_73029_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|73179_73995_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_148245963.1|74912_75605_-	sodium:glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|76048_76369_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|76361_76748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447544.1|76755_77442_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|77419_78046_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|78124_79330_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_001352368.1|81435_82644_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_063078607.1|85727_87050_-	hypothetical protein	NA	J9Q7G5	Salmonella_phage	97.5	7.1e-254
WP_032187677.1|87640_88453_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	85.6	5.5e-124
WP_148245964.1|90241_90790_+	fimbrial protein YehD	NA	NA	NA	NA	NA
WP_148245968.1|90845_91526_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_148245965.1|91543_94030_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_063078605.1|94040_95051_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001603498.1|95235_95457_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	94.5	8.1e-30
WP_053291281.1|95456_95834_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	92.0	9.3e-58
WP_096945091.1|95967_97179_-	DNA primase	NA	J9Q720	Salmonella_phage	94.6	3.7e-209
WP_023135655.1|97239_98580_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	98.9	2.5e-246
WP_032187666.1|98640_99366_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	96.3	1.3e-137
WP_001711193.1|99648_100416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023135657.1|100468_100828_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_023135658.1|100827_101493_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	98.2	2.0e-116
WP_001711191.1|101812_102082_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_077580870.1|102089_102611_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071788617.1|102643_102829_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	75.0	2.9e-20
WP_023135660.1|102779_103031_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	65.1	1.0e-20
WP_148245966.1|103033_103726_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.6	2.7e-119
WP_077580871.1|103739_104063_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	79.4	2.4e-38
WP_077580872.1|104196_104778_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	86.4	2.8e-93
WP_077580873.1|107656_108217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077248950.1|108896_110417_-	DUF1983 domain-containing protein	NA	J9Q756	Salmonella_phage	99.5	2.5e-101
WP_033546628.1|110481_112041_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	98.8	1.2e-292
WP_001711179.1|112043_112322_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	92.4	2.1e-38
WP_024172705.1|112381_112804_+	hypothetical protein	NA	J9Q806	Salmonella_phage	92.9	4.2e-67
WP_000019445.1|113905_114886_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 2
NZ_CP040928	Escherichia coli strain YY76-1 plasmid pYY76-1-1, complete sequence	163111	148534	162369	163111	transposase	Salmonella_phage(53.85%)	13	NA	NA
WP_000725192.1|148534_149500_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	100.0	3.3e-168
WP_000817632.1|149496_150702_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_021546926.1|151101_151962_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	99.7	1.4e-157
WP_001281116.1|152343_152736_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_000019445.1|153016_153997_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_112901307.1|154050_155289_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	97.1	2.2e-188
WP_112901306.1|155271_156195_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	97.9	6.7e-158
WP_025670519.1|156460_157030_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	80.4	7.9e-85
WP_106509445.1|157360_158107_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	91.9	2.4e-126
WP_032187695.1|158096_160013_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	86.7	2.0e-297
WP_053292506.1|160009_160288_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	68.3	1.5e-20
WP_112901305.1|160242_161328_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	97.5	1.6e-203
WP_023135693.1|161724_162369_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.6	1.4e-122
>prophage 1
NZ_CP040929	Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence	57104	22552	57101	57104	transposase,integrase	Escherichia_phage(40.0%)	35	26110:26169	52711:53368
WP_025755768.1|22552_24877_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	27.9	7.8e-38
WP_001282381.1|24888_25338_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000059893.1|25400_25805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|25999_26704_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
26110:26169	attL	TGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCA	NA	NA	NA	NA
WP_071538079.1|26694_26877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002904004.1|26840_27701_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|27721_28483_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001323889.1|28810_30388_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_074423009.1|30513_30696_-	resolvase	NA	NA	NA	NA	NA
WP_001389365.1|30724_31489_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|31679_32036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|31981_32566_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_148245969.1|32565_33093_-	MFS transporter	NA	NA	NA	NA	NA
WP_124354296.1|33707_36740_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_148245970.1|36743_37304_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	83.1	9.9e-48
WP_103859199.1|37731_39291_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	24.4	1.5e-16
WP_000844627.1|40018_40261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_072109431.1|40292_40955_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|41033_42233_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|42499_42805_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058657119.1|42832_44047_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_021598067.1|44263_45148_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|45178_46672_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_094309310.1|47010_48168_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_094323890.1|48157_49078_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001067858.1|49348_50053_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_065799592.1|50064_50877_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_001206356.1|51008_51800_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_065799591.1|51945_52710_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	36.9	1.3e-26
WP_001067855.1|52600_53305_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024245155.1|53995_54634_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	27.1	1.9e-07
52711:53368	attR	TGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_000864791.1|54919_55540_+	ParA family protein	NA	A2I303	Vibrio_virus	33.8	1.1e-18
WP_000051064.1|55591_55822_+	partitioning protein	NA	NA	NA	NA	NA
WP_015060510.1|55837_56131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148245971.1|56177_57101_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	99.7	1.4e-176
