The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	251236	371740	5227472	integrase,capsid,transposase	Bluetongue_virus(19.05%)	108	278631:278646	310579:310594
WP_000420818.1|251236_252373_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001118036.1|252413_253184_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|253337_253811_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_040076785.1|253853_256298_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|256537_257116_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|257321_258089_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|258059_258800_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615983.1|258955_259234_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|259236_259497_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056849.1|259706_260456_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000006255.1|260631_261129_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_148050495.1|261352_263092_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|263051_263822_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|263892_264948_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|264999_265293_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|265295_265694_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_148050496.1|265703_266135_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_040077378.1|266204_267413_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_001295202.1|267799_268066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|267998_268535_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_040076790.1|268591_270049_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|270309_270768_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|270859_272104_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|272161_272563_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|272601_273657_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|273944_275048_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|275059_276313_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_136750547.1|277374_277614_+	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_136747624.1|277495_279112_-	hypothetical protein	NA	NA	NA	NA	NA
278631:278646	attL	CTCCAGGCTTTACATT	NA	NA	NA	NA
WP_000270168.1|279819_280047_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_136750548.1|280619_282053_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_137533938.1|283023_283227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040077378.1|283296_284505_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_001301257.1|285355_285898_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|285972_286560_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|286617_287286_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|287311_289837_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001360105.1|291438_292149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|292461_292791_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|293038_293653_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|294070_294760_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|294756_295713_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|295709_297908_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_033801636.1|297917_298874_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|298852_299263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801639.1|299547_300762_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_033801635.1|300797_301076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801634.1|301414_303280_-	cell envelope integrity protein TolA	NA	A0A1D7XFE4	Escherichia_phage	31.6	2.1e-62
WP_033801633.1|303272_303470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801632.1|303591_304623_-|capsid	phage capsid E family protein	capsid	NA	NA	NA	NA
WP_033801631.1|304639_304999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801630.1|304995_305211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801629.1|305880_306219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077774627.1|306211_306448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801627.1|306704_306989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|307184_308457_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_072290019.1|308574_308778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801554.1|308919_309849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801555.1|309838_310579_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001449594.1|310670_310835_-	hypothetical protein	NA	NA	NA	NA	NA
310579:310594	attR	AATGTAAAGCCTGGAG	NA	NA	NA	NA
WP_033801556.1|310987_312010_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	5.0e-199
WP_001317493.1|312006_312789_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001544489.1|314083_314431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|315926_317199_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000544015.1|317353_318910_+	L-lactate permease	NA	NA	NA	NA	NA
WP_001102091.1|318959_319679_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_001544484.1|319689_321105_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001544483.1|321109_321808_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001544480.1|323196_323409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040077633.1|331356_332316_-	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_001212982.1|332312_333434_-	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_033801594.1|333433_333706_-	hydrogenase 3 maturation protein HypC	NA	NA	NA	NA	NA
WP_001544468.1|334865_335072_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_072033197.1|335064_335247_+	rubredoxin	NA	NA	NA	NA	NA
WP_077877556.1|335250_336132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801593.1|336170_336461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136747666.1|336505_336691_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000377254.1|336743_337238_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000555344.1|337737_338697_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_001544462.1|338701_339280_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001544461.1|339685_339922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801596.1|340805_341330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001380818.1|342158_342386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801592.1|346898_347654_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.2	4.5e-43
WP_137533911.1|347669_347900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001682408.1|347876_348554_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|348553_348901_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|348920_350492_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_033801591.1|351588_352047_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	2.1e-11
WP_136747668.1|352184_352376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089585588.1|353726_353924_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	67.6	2.8e-05
WP_071594150.1|354242_354422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333333.1|354479_354737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107474.1|354913_355927_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998353.1|355938_357255_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|357282_358203_-	ribokinase	NA	NA	NA	NA	NA
WP_001315616.1|358505_359288_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033801589.1|359289_359388_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_077877569.1|360224_360623_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_040077378.1|360644_361853_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_040077373.1|361955_362183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|362217_362358_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|362357_362621_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|362984_363086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621009.1|368033_368885_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|369474_370068_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|370079_370316_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_040077378.1|370531_371740_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
>prophage 2
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	840248	855825	5227472	integrase,tail,terminase,lysis	Enterobacteria_phage(73.91%)	28	828306:828320	853850:853864
828306:828320	attL	AACTGGACTTCACTG	NA	NA	NA	NA
WP_000533650.1|840248_841319_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	3.3e-201
WP_001303849.1|841296_841515_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|841554_841722_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000762730.1|841804_842233_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_000548520.1|842486_842678_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	2.8e-26
WP_000149542.1|842650_842833_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_032269513.1|842829_843492_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.5	1.7e-126
WP_001403556.1|843660_843852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|844108_844669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|844665_845118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072142085.1|845210_845312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053008.1|845308_845764_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.4e-60
WP_000774484.1|845926_846217_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_001099700.1|846213_846576_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_001393963.1|846572_846713_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_054627682.1|846798_847182_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	1.3e-54
WP_000737275.1|847370_848453_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|849040_849256_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135294.1|849255_849753_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.9e-90
WP_001228695.1|849969_850152_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738492.1|850242_850536_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_136747579.1|850826_851237_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.6e-71
WP_136747581.1|851522_851729_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	98.5	2.2e-29
WP_001421937.1|851893_852088_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453576.1|852476_853022_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027252.1|852996_854058_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	1.7e-213
853850:853864	attR	AACTGGACTTCACTG	NA	NA	NA	NA
WP_100222106.1|854041_855244_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	71.4	2.4e-38
WP_000885613.1|855243_855825_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	4.7e-101
>prophage 3
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	1248870	1293503	5227472	integrase,tail,transposase,tRNA	Enterobacteria_phage(40.0%)	54	1246887:1246902	1300052:1300067
1246887:1246902	attL	CGGGCTTTCTCTTCTT	NA	NA	NA	NA
WP_001297484.1|1248870_1249977_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1250030_1250492_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1250501_1251155_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1251326_1252577_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_077774558.1|1252690_1253077_-|integrase	tyrosine-type recombinase/integrase	integrase	O21927	Phage_21	100.0	5.7e-63
WP_085949152.1|1253061_1254335_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_040077378.1|1254957_1256166_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_000088653.1|1256496_1256733_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|1256872_1257112_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763364.1|1257159_1257378_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000084449.1|1257531_1258596_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	65.1	2.0e-134
WP_045148846.1|1258592_1258772_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	84.4	6.0e-15
WP_072193391.1|1258710_1258959_+	replication protein O	NA	A0A1I9LJP3	Stx_converting_phage	98.7	1.8e-41
WP_000788890.1|1258955_1259657_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_021570487.1|1259653_1259956_+	phage exclusion protein Ren	NA	M1FPD5	Enterobacteria_phage	96.7	1.0e-43
WP_001070442.1|1260023_1260356_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001348591.1|1260404_1260554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021570486.1|1260611_1262138_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.5	1.0e-30
WP_029785662.1|1262249_1262549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990013.1|1262807_1263317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097297.1|1263413_1263515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|1266070_1267343_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_040078117.1|1268767_1269352_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.2e-104
WP_000379040.1|1269712_1271668_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	9.8e-26
WP_000207933.1|1271664_1272786_+	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_000539894.1|1273498_1273651_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
WP_001295666.1|1273753_1274077_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1274613_1274724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1274776_1275181_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1275401_1276133_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_001299269.1|1276337_1277549_-	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000554140.1|1277862_1278099_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_000858002.1|1278141_1278414_+	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000888772.1|1278442_1278709_+	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_001065752.1|1278821_1279070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001246498.1|1279401_1280925_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065861.1|1281056_1281275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001360143.1|1281674_1283195_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_071524883.1|1283207_1284296_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.9	8.3e-75
WP_001295611.1|1284378_1284708_-	YmgD family protein	NA	NA	NA	NA	NA
WP_000726974.1|1284717_1285062_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000122462.1|1285063_1285237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325005.1|1285337_1285523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131446.1|1285483_1285603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185665.1|1286352_1286619_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000101055.1|1286622_1287435_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001301105.1|1287458_1288154_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_001056840.1|1288673_1289042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695215.1|1289144_1289546_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_001295992.1|1289787_1290081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284280.1|1290152_1290812_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000807624.1|1290888_1291350_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_137536407.1|1291556_1292222_-	hemolysin E	NA	NA	NA	NA	NA
WP_040077378.1|1292294_1293503_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
1300052:1300067	attR	CGGGCTTTCTCTTCTT	NA	NA	NA	NA
>prophage 4
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	1376930	1453785	5227472	portal,head,transposase,lysis,holin,integrase,capsid,protease,tail,terminase	Escherichia_phage(38.18%)	83	1376752:1376779	1437944:1437971
1376752:1376779	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_136750506.1|1376930_1377413_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	61.9	2.2e-51
WP_000113186.1|1378039_1378288_-	excisionase	NA	NA	NA	NA	NA
WP_033801686.1|1378352_1380824_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	3.1e-53
WP_033801691.1|1380919_1381108_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1381104_1381293_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000390585.1|1381589_1381832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000559918.1|1381821_1382337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380318.1|1382450_1382603_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000367559.1|1382772_1383162_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|1383265_1383541_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693899.1|1383524_1383950_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032211818.1|1383972_1384926_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	50.8	3.1e-73
WP_136750507.1|1384932_1385673_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.7	8.9e-113
WP_000450863.1|1385702_1386473_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	1.8e-84
WP_001141100.1|1386488_1386881_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	61.2	3.8e-38
WP_000072553.1|1386986_1387199_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	4.4e-33
WP_000209146.1|1387231_1387450_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
WP_040077378.1|1387600_1388809_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_000207997.1|1389063_1389231_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000206828.1|1389227_1389572_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	98.2	1.1e-57
WP_000902695.1|1389806_1390019_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	95.7	1.4e-26
WP_024210728.1|1390532_1390811_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.7e-11
WP_001265189.1|1390812_1391862_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000904136.1|1391874_1392237_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|1392229_1392895_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_071777426.1|1392822_1393020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000342737.1|1393147_1393861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|1394034_1394232_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_001300563.1|1394927_1396040_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000271627.1|1397272_1397701_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_148050501.1|1398396_1399140_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040077378.1|1399108_1400317_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_024166055.1|1400549_1400828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071532096.1|1401441_1401666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148050502.1|1402324_1404289_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	79.1	1.7e-296
WP_000284510.1|1404658_1404874_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087715.1|1404878_1405412_+	lysozyme	NA	G9L6J6	Escherichia_phage	94.9	5.8e-98
WP_001499026.1|1405408_1405846_+|lysis	lysis protein	lysis	K7P869	Enterobacteria_phage	95.9	2.1e-69
WP_000654793.1|1406220_1406841_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	3.9e-53
WP_001682408.1|1407389_1408067_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1408066_1408414_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1408433_1410005_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001405844.1|1412345_1412852_+	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_001499025.1|1412823_1414752_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	3.7e-259
WP_000259002.1|1414735_1414942_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_148050503.1|1414938_1416531_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.0	2.4e-187
WP_001253979.1|1416520_1418026_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000256823.1|1418062_1418410_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|1418467_1419496_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|1419547_1419931_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|1419923_1420277_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_024213759.1|1420292_1420868_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	9.8e-51
WP_000683075.1|1420864_1421260_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_033801696.1|1421267_1422017_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.0	2.8e-130
WP_040077378.1|1422050_1423259_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_032185450.1|1423374_1423806_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	1.8e-41
WP_052012002.1|1423832_1424234_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	79.2	1.1e-40
WP_137532888.1|1424214_1426791_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000847279.1|1426787_1427117_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_148050504.1|1427116_1427815_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	8.9e-131
WP_047091364.1|1427825_1428569_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.4	3.5e-149
WP_148050541.1|1428514_1429147_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	2.1e-99
WP_148050505.1|1429833_1433442_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	81.0	0.0e+00
WP_001270059.1|1433510_1434134_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_064768653.1|1434284_1436135_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	7.3e-172
WP_071826844.1|1436286_1436595_-	hypothetical protein	NA	S5MQI1	Escherichia_phage	65.9	2.7e-07
WP_148050506.1|1437478_1437616_-	ash family protein	NA	NA	NA	NA	NA
WP_001079505.1|1438121_1438628_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1437944:1437971	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056490.1|1438673_1439174_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1439259_1439439_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1439819_1440626_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1440625_1441819_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001340286.1|1441830_1443189_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000763511.1|1443192_1444788_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194582.1|1444787_1446350_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1446441_1446486_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1446623_1447505_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1447501_1448122_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001326916.1|1448149_1450045_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|1450255_1451131_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1451170_1451761_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559286.1|1451757_1452516_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|1452735_1453785_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	1693785	1868197	5227472	portal,transposase,lysis,holin,integrase,capsid,protease,tail,terminase	Escherichia_phage(28.46%)	197	1845635:1845652	1871738:1871755
WP_094250091.1|1693785_1694993_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	3.9e-97
WP_040077378.1|1695518_1696727_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_097734296.1|1696736_1697492_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_120795387.1|1697694_1697817_+	protein YneP	NA	NA	NA	NA	NA
WP_001301030.1|1697782_1698940_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_001295684.1|1698991_1700674_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_000060492.1|1701075_1701837_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_000543384.1|1701911_1702109_-	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000726691.1|1702356_1704636_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_000520676.1|1704969_1705884_-	fimbrial protein	NA	NA	NA	NA	NA
WP_040077949.1|1706457_1706988_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_085947917.1|1708410_1709683_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001125439.1|1710338_1711661_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|1711660_1711927_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_072036514.1|1712149_1712521_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	52.1	1.1e-34
WP_136747632.1|1712521_1713550_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	47.5	1.4e-60
WP_000113108.1|1718100_1719693_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154342.1|1719771_1720725_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194860.1|1720973_1722509_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	4.4e-21
WP_000911184.1|1722502_1723531_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|1723530_1724523_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172465.1|1724534_1725557_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774165.1|1725583_1726459_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|1726482_1726773_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_033801443.1|1726829_1727588_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001313828.1|1727591_1728506_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_000854633.1|1728712_1730164_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000878968.1|1730390_1731338_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.6	7.3e-19
WP_001191027.1|1731449_1731809_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1731808_1732735_-	glutaminase B	NA	NA	NA	NA	NA
WP_033801444.1|1732798_1734187_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366501.1|1734287_1735169_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258599.1|1735246_1736362_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1736511_1737702_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1737726_1738392_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843414.1|1738603_1739038_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1739057_1739441_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803657.1|1739472_1739691_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087187.1|1739721_1740621_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054183.1|1740815_1742003_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1742129_1742225_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592814.1|1742443_1743334_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000671737.1|1743588_1743981_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024746.1|1744256_1744775_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_040077763.1|1744818_1746864_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1747000_1747747_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1747835_1748522_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|1748698_1748902_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|1748936_1750397_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|1750485_1751769_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1752372_1752486_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1752554_1752788_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086522.1|1753104_1753695_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_094250091.1|1753880_1755087_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	3.9e-97
WP_000885600.1|1755143_1755719_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	1.8e-105
WP_071524888.1|1755718_1756027_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000453589.1|1756277_1756823_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.2	9.5e-88
WP_001368374.1|1757211_1757445_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_033801485.1|1757502_1757913_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	78.7	5.5e-56
WP_001019606.1|1758064_1758238_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1758409_1758565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1758644_1758710_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1758712_1758901_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1758911_1759124_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1759486_1759984_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1759980_1760514_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1760510_1760822_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1760826_1761042_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1761782_1761998_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1762298_1762511_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1762565_1762655_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1762932_1763685_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1763698_1764748_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1764749_1765028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1765094_1765346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|1765605_1766718_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000813254.1|1766912_1767068_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1767139_1767427_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1767426_1767666_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_072033201.1|1767690_1767963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|1767959_1769232_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001301033.1|1769534_1769867_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|1770303_1771617_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|1771794_1771977_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000786209.1|1771951_1772131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148050510.1|1773483_1774697_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	2.1e-167
WP_001254876.1|1776516_1777668_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_001296941.1|1779750_1779987_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876958.1|1780021_1781302_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001360138.1|1781321_1781432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1781489_1782509_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1782520_1783735_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1783940_1784267_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1784401_1784743_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1784777_1785338_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1785340_1786051_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1786158_1786464_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072300573.1|1786662_1788120_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	6.7e-120
WP_000207512.1|1788804_1789794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040078134.1|1789878_1790367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040078131.1|1790477_1790681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|1791117_1792689_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1792708_1793056_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|1793055_1793733_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_040078129.1|1793884_1794400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033801270.1|1794830_1795199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|1795558_1797130_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1797149_1797497_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|1797496_1798174_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_071992369.1|1798135_1798237_+	copper resistance protein	NA	NA	NA	NA	NA
WP_033801271.1|1798399_1799731_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_077774536.1|1799962_1801072_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	47.1	1.8e-85
WP_001340362.1|1801132_1803556_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213043.1|1803566_1803680_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_032346983.1|1804095_1804383_+	antirepressor	NA	V5URG2	Shigella_phage	97.9	1.7e-48
WP_040078578.1|1804632_1805256_+	antirepressor	NA	A0A088CBR4	Shigella_phage	84.1	1.7e-96
WP_000763353.1|1806203_1806425_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001014734.1|1806421_1807129_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	64.0	1.5e-32
WP_122996098.1|1807302_1807566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032286200.1|1808215_1808452_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	75.4	1.8e-19
WP_000902690.1|1808496_1808709_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	70.0	1.7e-16
WP_136859217.1|1808828_1809179_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	97.2	8.3e-53
WP_000343717.1|1809189_1810398_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
WP_047091158.1|1810927_1819312_-	hypothetical protein	NA	A0A0P0ZCD0	Stx2-converting_phage	97.2	0.0e+00
WP_032276327.1|1819381_1820647_-	hypothetical protein	NA	A0A088CBK4	Shigella_phage	97.1	3.4e-221
WP_001561694.1|1820657_1820909_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	92.3	1.5e-11
WP_040077400.1|1820918_1821365_-	hypothetical protein	NA	V5UT82	Shigella_phage	99.3	6.8e-76
WP_000509491.1|1821367_1822024_-	hypothetical protein	NA	A0A088CD74	Shigella_phage	100.0	5.1e-104
WP_000035557.1|1822117_1822519_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000078907.1|1822575_1822716_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_071531851.1|1822797_1823016_+	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	97.2	9.2e-34
WP_040077398.1|1822946_1823681_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A088CE87	Shigella_phage	99.6	5.7e-136
WP_001373155.1|1823804_1824422_-	hypothetical protein	NA	A0A088CBQ8	Shigella_phage	99.5	1.5e-121
WP_000455635.1|1824427_1824706_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_040077394.1|1824720_1825989_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_040077392.1|1825985_1827611_-	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	98.0	0.0e+00
WP_148050511.1|1827689_1828361_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	96.9	3.9e-123
WP_148050512.1|1828402_1830676_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	91.0	2.4e-172
WP_001562654.1|1830672_1831323_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	99.5	1.7e-120
WP_000829202.1|1831322_1831886_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_001290743.1|1831869_1832331_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140444.1|1832381_1832771_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214467.1|1832825_1834040_-|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_000345015.1|1834063_1835071_-	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
WP_040078184.1|1835228_1837373_-|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	99.7	0.0e+00
WP_040078182.1|1837372_1839079_-|terminase	terminase	terminase	A0A0H4IT14	Shigella_phage	99.6	0.0e+00
WP_040078180.1|1839059_1839866_-	hypothetical protein	NA	A0A0P0ZG40	Escherichia_phage	98.9	2.2e-133
WP_033817459.1|1840265_1840646_-	phage family protein	NA	Q716B1	Shigella_phage	98.4	1.6e-65
WP_001109015.1|1840804_1841347_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_047091151.1|1841549_1841987_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	95.2	1.4e-68
WP_000455406.1|1841994_1842144_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_047091152.1|1842143_1842713_-	antirepressor	NA	A0A0N7KZV8	Escherichia_phage	97.9	6.4e-103
WP_040078639.1|1842986_1843520_-	lysozyme	NA	A0A2L1IV49	Escherichia_phage	93.2	1.3e-94
WP_000284510.1|1843524_1843740_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290208.1|1843817_1844063_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
WP_000142786.1|1844103_1844283_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	94.9	3.2e-24
WP_135565115.1|1844418_1846359_-	SASA family carbohydrate esterase	NA	A0A088CD51	Shigella_phage	99.8	0.0e+00
1845635:1845652	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
WP_135494878.1|1846484_1846721_-	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	79.4	2.5e-21
WP_000752026.1|1846862_1847132_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|1847141_1848089_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_024165517.1|1848361_1848607_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.1e-35
WP_040078382.1|1848595_1849030_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	98.6	1.5e-80
WP_000992060.1|1849022_1849217_-	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_033801430.1|1849216_1849579_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	98.3	3.5e-62
WP_000002243.1|1849575_1849866_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_033801431.1|1849865_1850588_-	DNA-binding protein	NA	Q4A1A3	Enterobacteria_phage	98.3	1.0e-129
WP_000835350.1|1850662_1851586_-	antirepressor protein	NA	A5VW58	Enterobacteria_phage	92.8	1.1e-163
WP_000335901.1|1852308_1853358_-	hypothetical protein	NA	Q8HA04	Enterobacteria_phage	100.0	1.7e-181
WP_033801433.1|1853539_1854067_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	98.3	3.1e-99
WP_000814577.1|1854063_1854510_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	99.3	2.1e-80
WP_001281772.1|1854466_1854703_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|1854713_1854929_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|1855060_1855339_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145931.1|1855409_1855700_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788839.1|1855696_1856398_-	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	100.0	4.5e-130
WP_032167977.1|1856394_1857333_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.7	4.8e-172
WP_000438542.1|1857365_1857662_-	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000437871.1|1857800_1858001_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_001274760.1|1858101_1858815_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_000885926.1|1858824_1859166_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_001207140.1|1859236_1859671_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
WP_001278657.1|1859667_1860288_+	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
WP_000198444.1|1860747_1861131_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|1861189_1861660_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001526867.1|1861810_1862179_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_001198861.1|1862251_1862416_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_040077676.1|1862384_1862549_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	94.4	1.3e-21
WP_072036511.1|1862482_1862635_+	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	98.0	4.7e-21
WP_040077673.1|1862603_1862900_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	96.9	1.5e-47
WP_000100822.1|1862905_1863691_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	100.0	6.3e-149
WP_148050513.1|1863687_1864368_+	YqaJ viral recombinase family protein	NA	V5UT69	Shigella_phage	99.1	3.0e-131
WP_000497814.1|1864415_1864667_+	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	98.8	4.9e-39
WP_124034985.1|1864626_1865073_+	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.1	4.2e-41
WP_000051896.1|1864928_1866092_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	100.0	2.2e-227
WP_000254426.1|1866129_1866684_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
WP_000526503.1|1866685_1867540_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1867582_1868197_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
1871738:1871755	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 6
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	2375607	2480538	5227472	portal,head,transposase,lysis,tRNA,holin,capsid,integrase,protease,tail,terminase	Escherichia_phage(38.37%)	120	2424301:2424320	2478045:2478064
WP_000476014.1|2375607_2376969_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_012777763.1|2377102_2377312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001318299.1|2377299_2377617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2378021_2378921_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2379002_2379782_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844220.1|2379881_2380922_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2380969_2382325_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823270.1|2382328_2382613_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2382643_2383096_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853882.1|2383105_2384368_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|2384396_2385251_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2385559_2386612_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|2386868_2388146_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000846217.1|2388142_2389147_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011997.1|2389143_2390109_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434032.1|2390082_2390829_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351783.1|2390880_2391699_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822274.1|2391763_2392564_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195564.1|2392560_2393349_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2393571_2393844_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001614687.1|2393964_2394789_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2395007_2395346_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405713.1|2395427_2396462_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_040078002.1|2396477_2398958_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677393.1|2398973_2399648_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830491.1|2399727_2400270_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|2400562_2400844_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2401106_2402216_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001300883.1|2402347_2404381_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
WP_001215617.1|2404521_2408316_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|2409708_2410981_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_077877570.1|2410978_2413294_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636918.1|2413354_2413672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001351787.1|2413978_2415067_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294375.1|2415077_2417357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292779.1|2417349_2418486_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
WP_040078412.1|2418482_2420486_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001373589.1|2420610_2421072_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001295430.1|2421112_2421583_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2421629_2422349_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2422345_2424031_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
2424301:2424320	attL	CCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261926.1|2424545_2424794_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	86.6	1.4e-33
WP_000547693.1|2425065_2425737_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	100.0	1.4e-125
WP_052920791.1|2425778_2427506_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.6	1.4e-230
WP_000078853.1|2427650_2427791_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_136841899.1|2427989_2431457_-	host specificity protein J	NA	S5MW25	Escherichia_phage	99.0	0.0e+00
WP_113440790.1|2431697_2432336_-|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	98.9	1.5e-95
WP_040078671.1|2432233_2432977_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.2	4.3e-147
WP_047083320.1|2432987_2433686_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	5.2e-131
WP_000847280.1|2433685_2434015_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_137528191.1|2434011_2436591_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.4	0.0e+00
WP_000533402.1|2436571_2436985_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|2437011_2437443_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235046.1|2437456_2438209_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.0e-132
WP_000683079.1|2438216_2438612_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_024213759.1|2438608_2439184_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	9.8e-51
WP_001204554.1|2439199_2439553_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2439545_2439929_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2439980_2441009_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2441066_2441414_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|2441450_2442956_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_040078097.1|2442945_2444538_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.5e-186
WP_000259002.1|2444534_2444741_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_136841905.1|2444724_2446653_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	9.7e-260
WP_040078692.1|2446624_2447131_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	3.7e-33
WP_001109015.1|2447841_2448384_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_032209690.1|2448586_2449024_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_032209664.1|2449026_2449176_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	81.6	2.1e-13
WP_032209662.1|2449175_2449742_-	antirepressor	NA	A0A0H4IQ87	Shigella_phage	97.9	1.7e-103
WP_032209661.1|2450015_2450549_-	lysozyme	NA	A0A088CC28	Shigella_phage	99.4	1.3e-102
WP_000284506.1|2450553_2450769_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_047084057.1|2450960_2451149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032209659.1|2451263_2453228_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	78.5	2.5e-295
WP_032209658.1|2453471_2453795_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	99.1	7.7e-61
WP_032209657.1|2454091_2454361_-	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	98.9	1.3e-42
WP_033801441.1|2454372_2455332_-	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	99.7	1.1e-174
WP_033801428.1|2455714_2455867_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	98.0	1.2e-19
WP_024165517.1|2455881_2456127_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.1e-35
WP_001204883.1|2456115_2456550_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	99.3	2.4e-81
WP_033801429.1|2456542_2456737_-	protein ninH	NA	A0A088CC23	Shigella_phage	98.4	2.7e-29
WP_033801430.1|2456736_2457099_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	98.3	3.5e-62
WP_000002243.1|2457095_2457386_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_148050520.1|2457385_2458108_-	DNA-binding protein	NA	Q4A1A3	Enterobacteria_phage	98.8	4.6e-130
WP_000835350.1|2458182_2459106_-	antirepressor protein	NA	A5VW58	Enterobacteria_phage	92.8	1.1e-163
WP_000335901.1|2459828_2460878_-	hypothetical protein	NA	Q8HA04	Enterobacteria_phage	100.0	1.7e-181
WP_033801433.1|2461059_2461587_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	98.3	3.1e-99
WP_000814577.1|2461583_2462030_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	99.3	2.1e-80
WP_001281772.1|2461986_2462223_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|2462233_2462449_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000130.1|2462580_2462859_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145908.1|2462929_2463220_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	100.0	5.7e-47
WP_040078431.1|2463216_2463918_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	98.7	1.6e-127
WP_033801434.1|2463914_2464853_-	replication protein	NA	H6WZI2	Escherichia_phage	99.7	8.2e-172
WP_000438541.1|2464885_2465182_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|2465320_2465548_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_033801435.1|2465626_2466334_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	4.3e-133
WP_000885202.1|2466394_2466736_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221211.1|2466803_2467265_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000198444.1|2468959_2469343_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|2469401_2469872_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_040077378.1|2469998_2471207_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_000776961.1|2471353_2471665_+	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
WP_001198860.1|2471737_2471902_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|2471870_2472035_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_071525080.1|2471968_2472121_+	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	96.0	1.8e-20
WP_033801436.1|2472089_2472386_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	99.0	2.3e-48
WP_000100847.1|2472391_2473177_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186866.1|2473173_2473854_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|2473850_2474033_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|2474005_2474197_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077774562.1|2474207_2474489_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	98.9	6.1e-46
WP_000763383.1|2474587_2474809_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_000457723.1|2476032_2476275_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_033801438.1|2476278_2476413_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.2	6.0e-20
WP_001193437.1|2476431_2476686_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_033801439.1|2476719_2478006_+|integrase	site-specific integrase	integrase	H6WZF6	Escherichia_phage	99.5	3.8e-252
WP_042101647.1|2478041_2478728_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
2478045:2478064	attR	CCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|2478787_2478895_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2478875_2479607_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|2479611_2480538_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	9.7e-24
>prophage 7
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	2995946	3047921	5227472	integrase,transposase,tRNA	Shigella_phage(20.0%)	43	2993178:2993191	3029648:3029661
2993178:2993191	attL	AAAAATGATATTTT	NA	NA	NA	NA
WP_000264777.1|2995946_2996714_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2996744_2997293_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2997311_2997560_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2997808_2999170_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2999336_3000128_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3000148_3001435_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3001489_3002083_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3002205_3003084_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_040076647.1|3003169_3004831_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3004979_3005321_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3005382_3005673_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|3005662_3006139_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3006270_3006753_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001384082.1|3007496_3008726_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.3	2.7e-207
WP_000146253.1|3009008_3010565_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.3	1.9e-19
WP_000936463.1|3010554_3011451_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_000282312.1|3013395_3014301_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|3015406_3016679_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_040077378.1|3017843_3019052_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_077249404.1|3019895_3020192_+	DUF4928 family protein	NA	NA	NA	NA	NA
WP_001374078.1|3020453_3020771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744627.1|3020773_3021214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074023.1|3021228_3022182_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001374085.1|3022383_3022791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000677823.1|3022787_3024047_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_000369203.1|3024235_3024508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001079017.1|3024557_3024944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860556.1|3024970_3025291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|3025718_3026991_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001385733.1|3027002_3027293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552435.1|3027642_3028140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366001.1|3028228_3028852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124190.1|3028947_3029181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287885.1|3029233_3029425_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001376511.1|3030099_3031752_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.4	2.2e-39
3029648:3029661	attR	AAAAATGATATTTT	NA	NA	NA	NA
WP_001243916.1|3031761_3032289_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_040077378.1|3033812_3035021_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_000500956.1|3042739_3042976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040078272.1|3043079_3043394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000603951.1|3043963_3044512_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	9.8e-16
WP_040078274.1|3044689_3046435_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_042109856.1|3046500_3046740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148050524.1|3046764_3047921_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
>prophage 8
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	3064731	3095652	5227472	transposase,protease	Shigella_phage(25.0%)	18	NA	NA
WP_148050510.1|3064731_3065945_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	2.1e-167
WP_136828280.1|3065996_3070076_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.4	9.1e-308
WP_085947917.1|3071331_3072605_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001367252.1|3073772_3073955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223349.1|3073893_3075984_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000593013.1|3076329_3078174_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.3	8.1e-14
WP_000416157.1|3079542_3080574_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000916811.1|3080844_3081288_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705928.1|3081303_3081591_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|3081603_3082860_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_148050526.1|3084435_3084882_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	87.4	1.8e-68
WP_001682408.1|3084858_3085536_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3085535_3085883_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3085902_3087474_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000483811.1|3091247_3091475_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_001238642.1|3091852_3092428_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001499293.1|3092857_3094135_-	hemagglutinin	NA	B0FIT1	Escherichia_phage	39.4	8.4e-10
WP_085947917.1|3094379_3095652_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 9
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	3179573	3192756	5227472		Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|3179573_3182135_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|3182240_3182897_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3182947_3183715_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847979.1|3183910_3184819_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	3.0e-118
WP_000590403.1|3184815_3186078_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3186074_3186713_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136925.1|3186717_3187494_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104459.1|3187582_3188947_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3189040_3190033_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|3190095_3191235_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3191374_3192001_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3191994_3192756_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 10
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	3415280	3494447	5227472	integrase,transposase,protease,tRNA	Enterobacteria_phage(25.0%)	74	3403833:3403848	3466159:3466174
3403833:3403848	attL	CCGGTTCATTGATGAC	NA	NA	NA	NA
WP_001300769.1|3415280_3415778_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3415872_3416580_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3416659_3417391_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3417403_3418354_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3418462_3419026_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3419025_3419442_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001326494.1|3419625_3420606_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3420623_3421328_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3421345_3421912_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000994920.1|3421908_3422199_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174777.1|3422206_3422800_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_000239943.1|3422792_3423929_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745210.1|3424083_3425091_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394131.1|3425207_3426254_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3426429_3427149_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3427332_3427659_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3427658_3428378_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|3428538_3429591_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_148050530.1|3429618_3429894_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3429958_3431038_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3431239_3432496_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001326492.1|3432533_3434669_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|3435066_3435774_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218876.1|3436152_3437415_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	2.2e-79
WP_040077889.1|3437866_3441382_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001026222.1|3441490_3442990_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001350744.1|3443164_3443911_-	porin family protein	NA	NA	NA	NA	NA
WP_000758687.1|3444270_3445281_-	P fimbria tip G-adhesin PapG-II	NA	NA	NA	NA	NA
WP_000620429.1|3445324_3445825_-	P fimbrial tip protein PapF	NA	NA	NA	NA	NA
WP_000723802.1|3445899_3446421_-	P fimbrial minor subunit PapE	NA	NA	NA	NA	NA
WP_000597712.1|3446447_3446984_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000261303.1|3446993_3447575_-	protein papJ	NA	NA	NA	NA	NA
WP_000265730.1|3447611_3448346_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_071587086.1|3448416_3448515_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001682408.1|3448476_3449154_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3449153_3449501_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3449520_3451092_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_040077378.1|3454167_3455376_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_000428546.1|3455889_3456483_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|3456595_3457801_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_001322387.1|3457879_3458506_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|3458483_3459170_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|3459177_3459564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|3459556_3459877_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|3460320_3461526_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000480968.1|3462839_3463676_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|3463675_3464479_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000027057.1|3464842_3465703_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|3465885_3466443_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
3466159:3466174	attR	GTCATCAATGAACCGG	NA	NA	NA	NA
WP_001143760.1|3466606_3469612_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_137533920.1|3469535_3470456_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.5	2.1e-47
WP_001254876.1|3470456_3471608_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000904897.1|3471948_3472572_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001138082.1|3472697_3475583_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_106421401.1|3475496_3475988_-	hypothetical protein	NA	A4KWT9	Enterobacteria_phage	100.0	1.1e-66
WP_040077378.1|3476117_3477326_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_000930062.1|3477915_3478230_-	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_001332000.1|3478216_3478399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001363620.1|3478424_3478616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512463.1|3478664_3478931_+	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_001445143.1|3479551_3479803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|3479696_3479999_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|3480085_3480901_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_077473457.1|3481800_3481983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001323510.1|3482157_3482355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032346664.1|3482531_3482645_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	74.3	1.2e-08
WP_001323513.1|3484237_3484429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040078298.1|3484764_3485313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958149.1|3485555_3485792_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_040078300.1|3485860_3486436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126822.1|3486681_3487248_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_025492107.1|3488226_3488418_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_000792543.1|3490978_3493027_-	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
WP_087530368.1|3493174_3494447_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	1.1e-171
>prophage 11
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	4835450	4909006	5227472	transposase,tRNA	Stx2-converting_phage(36.84%)	51	NA	NA
WP_001295074.1|4835450_4836968_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|4837204_4838662_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295383.1|4838720_4840868_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_001187173.1|4842646_4844185_-	DNA-binding transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000779483.1|4845066_4845393_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001143297.1|4845389_4845653_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000014510.1|4845724_4846591_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839256.1|4846675_4846873_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761662.1|4846884_4847373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040076706.1|4847369_4847747_-	toxin	NA	NA	NA	NA	NA
WP_040076708.1|4847793_4848168_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692358.1|4848330_4848552_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186727.1|4848614_4849091_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214386.1|4849106_4849592_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	9.9e-12
WP_033884686.1|4849681_4850500_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.4e-45
WP_001117568.1|4850590_4850824_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_040076714.1|4850894_4853741_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_040076716.1|4854112_4854985_-	GTPase family protein	NA	NA	NA	NA	NA
WP_024213478.1|4855492_4856251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032351765.1|4856423_4857368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040077378.1|4859654_4860863_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_000381395.1|4861149_4862721_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4862740_4863088_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|4863087_4863765_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_072036516.1|4863741_4863837_+	copper resistance protein	NA	NA	NA	NA	NA
WP_000263652.1|4864015_4865191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001327829.1|4866878_4867094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813431.1|4867566_4868169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371489.1|4868262_4868469_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_040078050.1|4868854_4869646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024213475.1|4870922_4871522_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_024175299.1|4871892_4872276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801398.1|4872272_4872698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553833.1|4872945_4873143_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_085949152.1|4873312_4874585_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_074435374.1|4874597_4875617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040077475.1|4877907_4878255_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.0	1.3e-42
WP_001499165.1|4878251_4878926_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.9	1.6e-12
WP_001371495.1|4879718_4879913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371504.1|4879925_4880126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000821922.1|4880403_4881672_+	TolC family protein	NA	NA	NA	NA	NA
WP_000835435.1|4881676_4883824_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	7.7e-24
WP_001368290.1|4883883_4885131_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000525231.1|4899649_4901518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700771.1|4901782_4902985_+	hypothetical protein	NA	Q9MCI8	Enterobacteria_phage	62.2	3.9e-41
WP_000935975.1|4903112_4903319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165713.1|4903381_4903858_+	LuxR family transcriptional regulator	NA	Q9LA52	Enterobacteria_phage	45.8	2.0e-28
WP_085949152.1|4904089_4905362_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000422741.1|4906589_4907015_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4907011_4907362_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_033801454.1|4907392_4909006_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	3.4e-181
>prophage 12
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	4916752	4973812	5227472	integrase,transposase,tRNA	Stx2-converting_phage(37.5%)	54	4931325:4931339	4966028:4966042
WP_000381395.1|4916752_4918324_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4918343_4918691_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|4918690_4919368_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000977393.1|4919545_4920337_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001498922.1|4920355_4922326_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_077628791.1|4922500_4922725_-|transposase	transposase	transposase	A0A1B0Z042	Pseudomonas_phage	55.2	5.0e-11
WP_000878009.1|4923436_4924456_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071525616.1|4924597_4924789_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001367505.1|4924770_4925028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100225730.1|4925109_4925310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077774610.1|4925246_4925459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094250091.1|4925614_4926821_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	3.9e-97
WP_033801582.1|4926988_4927246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000401037.1|4927314_4929012_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001228923.1|4929106_4930243_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.3	1.4e-117
4931325:4931339	attL	CACCGGAAGTCTTCC	NA	NA	NA	NA
WP_040078340.1|4932391_4933129_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040077378.1|4934191_4935400_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.5e-234
WP_024165538.1|4936528_4936909_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
WP_000612591.1|4936905_4937253_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998110.1|4937302_4938841_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	1.1e-293
WP_000147021.1|4939533_4940577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218780.1|4940832_4942098_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
WP_001188520.1|4942477_4943053_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068922.1|4943089_4944787_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|4944762_4945101_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|4945216_4946518_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|4946635_4948072_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|4948408_4948885_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|4948900_4950157_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|4950432_4950726_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4950769_4952416_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|4952553_4952907_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008040.1|4953109_4953979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940549.1|4954373_4955402_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|4955443_4956010_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|4956061_4956187_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|4956297_4956444_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|4956619_4956937_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|4956933_4957467_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001336292.1|4957555_4958689_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|4958751_4959111_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|4959121_4959517_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|4959527_4960262_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192973.1|4960254_4962063_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|4962387_4963365_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_040076818.1|4963583_4965086_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|4965137_4965452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|4965448_4965763_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236847.1|4965791_4969115_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
4966028:4966042	attR	GGAAGACTTCCGGTG	NA	NA	NA	NA
WP_000934920.1|4969136_4970105_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041964.1|4970201_4971254_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|4971348_4971894_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|4972636_4972690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|4972672_4973812_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP042350	Escherichia coli strain RM10410 chromosome, complete genome	5227472	5085526	5093398	5227472	transposase	Rhizobium_phage(14.29%)	8	NA	NA
WP_000594911.1|5085526_5086351_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|5086399_5086972_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000747102.1|5087072_5087423_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_001254876.1|5087342_5088494_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_148050510.1|5088557_5089770_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	2.1e-167
WP_000177060.1|5090858_5091116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|5091673_5092441_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|5092441_5093398_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
