The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	197230	271623	5270611	transposase,tRNA,protease,plate	Stx2-converting_phage(25.0%)	60	NA	NA
WP_001295561.1|197230_198583_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198612_201045_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|201166_201652_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201655_202681_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202785_203241_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|203244_204033_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|204032_205181_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569423.1|205177_205774_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_047084654.1|205810_209293_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.3e-209
WP_000055746.1|209305_210265_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021017.1|210363_212505_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212561_212951_+	VOC family protein	NA	NA	NA	NA	NA
WP_047084653.1|213015_214314_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214362_214623_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214609_214810_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|214975_215521_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_001741201.1|215517_215940_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239183.1|215953_216664_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001301405.1|216863_217688_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|217740_219459_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|219569_220277_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220273_220678_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|220795_221611_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|221650_222304_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|222296_223328_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|223515_224088_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000648583.1|230742_231657_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|231897_232698_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211686.1|232775_233546_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|233593_234952_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052721.1|235023_235779_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|235812_236535_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|236531_236999_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001300756.1|237063_237795_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
WP_001086142.1|238331_239117_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236652.1|239253_239733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029593843.1|239742_240459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|240699_241182_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|241205_242558_-	membrane protein	NA	NA	NA	NA	NA
WP_047084839.1|246111_247524_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088859.1|247528_248272_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_148050563.1|248268_251040_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	6.8e-81
WP_000343298.1|251048_251810_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_047084841.1|251814_253146_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_047084842.1|253148_253673_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|253669_254950_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|254974_256057_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_047084843.1|256020_257871_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|257874_258288_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|258294_259770_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|259820_260045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|260079_260580_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|261276_261795_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103319.1|262004_264146_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_047084844.1|264221_268271_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_001350058.1|268230_268668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137486495.1|268905_269031_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001339397.1|269007_269685_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|269684_270032_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|270051_271623_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 2
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	1373029	1440376	5270611	capsid,transposase,holin,plate,portal,head,terminase,integrase,tail,protease	Escherichia_phage(38.18%)	86	1372866:1372893	1424533:1424560
1372866:1372893	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_042970836.1|1373029_1374160_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.7	8.8e-104
WP_000113182.1|1374137_1374386_-	excisionase	NA	NA	NA	NA	NA
WP_042970837.1|1374450_1376922_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_001098749.1|1377002_1377206_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449182.1|1377208_1377391_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_123059909.1|1377960_1378449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087134.1|1378575_1378785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087133.1|1378785_1379424_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	39.8	1.3e-06
WP_047087132.1|1379565_1379721_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	3.4e-06
WP_047087131.1|1379995_1380283_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000108763.1|1380282_1380474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087139.1|1380502_1380901_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047087130.1|1381007_1381280_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	46.3	1.5e-12
WP_042966237.1|1381263_1381689_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_137578463.1|1381760_1382795_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	87.7	1.3e-98
WP_024178542.1|1382826_1383249_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	99.3	5.3e-78
WP_040072802.1|1384069_1384492_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	7.4e-64
WP_072277868.1|1384492_1384906_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	4.6e-58
WP_040072799.1|1385733_1385946_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	4.9e-32
WP_042973577.1|1385978_1386197_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	97.2	1.2e-30
WP_148050578.1|1386198_1386564_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	3.3e-68
WP_000220601.1|1387116_1387416_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|1387421_1387679_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_042966805.1|1387814_1388087_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.6e-11
WP_042970853.1|1388088_1389138_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	1.3e-109
WP_042966802.1|1389150_1389510_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	2.7e-38
WP_042966801.1|1389518_1390061_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.8	4.1e-67
WP_000917767.1|1390375_1390573_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_105268780.1|1390697_1391411_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042966800.1|1392080_1392494_+	subtilase	NA	A0A0U2KD34	Escherichia_phage	46.1	1.7e-25
WP_042966798.1|1392542_1393577_+	S8/S53 family peptidase	NA	NA	NA	NA	NA
WP_072034662.1|1393597_1394008_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	45.2	7.1e-27
WP_042966797.1|1394343_1394736_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	81.5	6.3e-49
WP_042966796.1|1394725_1395001_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	93.4	1.7e-40
WP_042966794.1|1395003_1395381_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	95.2	4.8e-62
WP_000271099.1|1395451_1395733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042966175.1|1396131_1396473_+	hypothetical protein	NA	Q8SBD8	Shigella_phage	57.7	1.3e-21
WP_042966177.1|1396611_1396908_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.0	4.3e-50
WP_148050579.1|1397234_1397537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064756635.1|1397907_1398144_+	hypothetical protein	NA	A0A0U2I1S5	Escherichia_phage	81.0	2.8e-20
WP_032083611.1|1398191_1398740_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	98.6	2.6e-69
WP_047085271.1|1398711_1400628_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	3.9e-253
WP_000263126.1|1400631_1400841_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_137486528.1|1400885_1402409_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.6	1.3e-182
WP_148050580.1|1402398_1404015_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.9	4.8e-103
WP_148050581.1|1404053_1404389_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.3	1.6e-21
WP_047085268.1|1404458_1405487_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	59.0	3.7e-109
WP_047085267.1|1405537_1405903_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_042966186.1|1405905_1406307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085266.1|1406287_1407010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042966191.1|1407021_1407573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085265.1|1407556_1408180_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.0	4.1e-10
WP_040091455.1|1408213_1408570_+|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	46.8	2.8e-19
WP_047085264.1|1408544_1409459_+|plate	baseplate assembly protein	plate	A0A193GYM8	Enterobacter_phage	44.2	1.4e-62
WP_040091453.1|1409451_1410042_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.2	6.2e-24
WP_148050582.1|1410038_1411364_+|tail	phage tail protein	tail	A0A0C4UQV0	Shigella_phage	63.0	6.4e-61
WP_040091481.1|1411390_1411918_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	47.4	1.1e-40
WP_040091452.1|1411972_1413448_+|tail	tail protein	tail	R9TMQ0	Vibrio_phage	38.5	1.3e-75
WP_000988219.1|1413444_1413963_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001291421.1|1414022_1414325_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_047085580.1|1414442_1416095_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.9	2.7e-48
WP_042966833.1|1416097_1416586_+|tail	phage tail protein	tail	R9TMP6	Vibrio_phage	42.6	5.6e-23
WP_042966832.1|1416560_1416779_+|tail	tail protein	tail	R9TR63	Vibrio_phage	54.5	4.1e-10
WP_040091448.1|1416769_1417858_+	phage late control protein	NA	R9TNM7	Vibrio_phage	29.2	1.1e-31
WP_000381395.1|1419419_1420991_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1421010_1421358_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1421357_1422035_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_148050583.1|1422097_1422862_+	hypothetical protein	NA	A0A0U2SH60	Escherichia_phage	40.0	6.8e-15
WP_148050584.1|1422876_1423464_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	57.8	8.2e-53
WP_042970649.1|1423500_1424064_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	63.7	1.5e-48
WP_001079505.1|1424710_1425217_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1424533:1424560	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056490.1|1425262_1425763_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1425848_1426028_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1426408_1427215_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1427214_1428408_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001344826.1|1428419_1429778_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1429781_1431377_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194563.1|1431376_1432939_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1433030_1433075_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_047085252.1|1433212_1434094_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1434090_1434711_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_047085250.1|1434738_1436634_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|1436846_1437722_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278907.1|1437761_1438352_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|1438348_1439107_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|1439326_1440376_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 3
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	1516308	1592189	5270611	transposase,tRNA,holin,plate,terminase,integrase,tail	Escherichia_phage(81.16%)	92	1539082:1539107	1590256:1590281
WP_000953275.1|1516308_1516497_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.7	4.1e-14
WP_001091700.1|1516549_1517350_+	hypothetical protein	NA	A0A0R6PJV6	Moraxella_phage	40.7	1.6e-22
WP_047085452.1|1517764_1517962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190587.1|1518019_1518199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075842256.1|1518337_1518613_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_047085454.1|1518616_1518982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004027526.1|1518988_1519279_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047085455.1|1519275_1521414_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.5	2.0e-157
WP_047085456.1|1521819_1522170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075842257.1|1522162_1522693_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	34.0	4.7e-07
WP_000581049.1|1522689_1522977_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_072057957.1|1522939_1523155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047084831.1|1523391_1523970_+	hypothetical protein	NA	A0A0U2QW61	Escherichia_phage	62.8	2.1e-32
WP_047084832.1|1524034_1524706_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	54.7	1.4e-64
WP_148050543.1|1526666_1528166_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_096913045.1|1528162_1528918_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_047084834.1|1529880_1530405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047084836.1|1530717_1531002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001243000.1|1531104_1531395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021558663.1|1531509_1531812_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046832.1|1533161_1533725_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628065.1|1533745_1534978_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1535232_1536216_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1536693_1538067_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157382.1|1538195_1539131_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
1539082:1539107	attL	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
WP_072034645.1|1539182_1540418_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.3	3.2e-240
WP_000079604.1|1540419_1540635_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001356607.1|1540734_1540923_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042966159.1|1540915_1541110_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	2.0e-32
WP_042966158.1|1541173_1542262_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	98.6	1.0e-202
WP_042966157.1|1542276_1545423_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	95.0	0.0e+00
WP_001358843.1|1545524_1545800_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	97.8	4.2e-44
WP_000258918.1|1545874_1546051_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	70.7	6.3e-17
WP_000560228.1|1546044_1546266_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_000935601.1|1546312_1547161_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	58.8	1.7e-54
WP_001559054.1|1547561_1547795_+	hypothetical protein	NA	A0A0U2S658	Escherichia_phage	96.1	2.9e-33
WP_000144718.1|1547756_1548062_-	hypothetical protein	NA	A0A0U2S618	Escherichia_phage	95.0	1.6e-44
WP_001253183.1|1548297_1548762_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	70.2	1.2e-54
WP_000171142.1|1548866_1549142_+	transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	65.9	1.9e-23
WP_000702028.1|1549125_1549548_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000695003.1|1549567_1549981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042970652.1|1550490_1551405_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	88.0	3.6e-95
WP_024262273.1|1551436_1551859_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.1	3.4e-77
WP_000450653.1|1551893_1552640_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	1.4e-110
WP_122368318.1|1552636_1552801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001815900.1|1553499_1554258_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1554521_1554734_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_071986327.1|1554708_1554906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940302.1|1555217_1555817_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	7.0e-108
WP_000228027.1|1555816_1556107_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_000640112.1|1556103_1556646_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	2.1e-74
WP_001355271.1|1557033_1557759_+	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	65.5	1.7e-79
WP_042966602.1|1557826_1558252_+	subtilase	NA	NA	NA	NA	NA
WP_001294583.1|1558309_1558702_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	89.2	5.7e-50
WP_001355273.1|1558691_1558970_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	81.5	4.0e-34
WP_000836752.1|1558971_1559517_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	91.7	1.6e-95
WP_001355274.1|1559605_1560385_+	enterotoxin	NA	A0A0U2QV53	Escherichia_phage	99.6	1.1e-150
WP_000095643.1|1560374_1560746_+	enterotoxin	NA	A0A0U2SHA2	Escherichia_phage	100.0	4.5e-65
WP_042966600.1|1560830_1561202_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	89.9	5.0e-56
WP_000271099.1|1561272_1561554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208684.1|1561988_1562195_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	64.4	2.7e-11
WP_042966466.1|1562732_1562942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085276.1|1562945_1564037_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	91.8	1.8e-146
WP_047085277.1|1564026_1565355_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.0	1.8e-260
WP_148050588.1|1565373_1566810_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.4	7.4e-265
WP_077790477.1|1566868_1567588_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.5	1.8e-134
WP_042966458.1|1567568_1568891_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.9	4.2e-190
WP_148050589.1|1568883_1569501_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	99.0	2.9e-117
WP_148050590.1|1569515_1570544_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	98.8	6.2e-189
WP_000780862.1|1570602_1571073_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	4.2e-84
WP_000175376.1|1571072_1571513_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_083577736.1|1571509_1571950_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	81.5	1.4e-65
WP_096124020.1|1571936_1572881_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.0	3.1e-171
WP_096124021.1|1572880_1574218_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.0	5.7e-243
WP_000613368.1|1574241_1574673_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	100.0	3.3e-75
WP_061317094.1|1574669_1575287_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	99.0	8.5e-109
WP_148050591.1|1575350_1577324_+	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	97.4	0.0e+00
WP_148050592.1|1577327_1577996_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	99.1	2.9e-123
WP_000209262.1|1577992_1578259_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	100.0	9.8e-46
WP_148050593.1|1578258_1579266_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	89.6	2.0e-176
WP_148050594.1|1579265_1579979_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	97.0	2.3e-126
WP_001183006.1|1580094_1580292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063102640.1|1580295_1580643_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.8e-61
WP_096124025.1|1580618_1581176_-	phage antirepressor Ant	NA	A0A0U2QL80	Escherichia_phage	98.9	7.0e-102
WP_148050595.1|1583285_1584512_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	99.3	5.8e-226
WP_075842704.1|1584495_1585122_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.5	5.8e-121
WP_148050596.1|1585118_1586570_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	62.4	2.1e-150
WP_047085464.1|1586596_1587127_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.8	5.1e-46
WP_148050597.1|1588196_1589429_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	64.3	6.7e-81
WP_047085573.1|1589443_1590022_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	57.2	5.2e-52
WP_001295593.1|1590480_1590915_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
1590256:1590281	attR	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
WP_000837924.1|1591055_1592189_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 4
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	1791777	1853138	5270611	transposase,portal,lysis,terminase,integrase,tail,protease	Enterobacteria_phage(38.0%)	71	1823769:1823785	1857833:1857849
WP_000527753.1|1791777_1793238_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
WP_000347482.1|1793326_1794610_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1795990_1796104_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1796172_1796406_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1796722_1797313_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_072144121.1|1797410_1797530_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
WP_072057962.1|1797584_1800890_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	68.9	1.8e-282
WP_047085523.1|1800954_1801554_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	1.8e-108
WP_000090928.1|1805078_1805687_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.0	1.4e-103
WP_047085485.1|1805623_1806367_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	8.9e-145
WP_148050601.1|1806377_1807076_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	6.2e-132
WP_000447253.1|1807085_1807415_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_047085506.1|1807414_1810480_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_047085504.1|1810451_1810781_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	8.4e-55
WP_001341514.1|1810789_1811176_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|1811236_1811980_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|1811990_1812392_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677102.1|1812388_1812967_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|1812978_1813254_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097045.1|1813246_1813570_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001360054.1|1813656_1815684_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_077790501.1|1815628_1817209_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	2.8e-289
WP_032193109.1|1817136_1817349_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	97.1	3.5e-30
WP_047085501.1|1817345_1819448_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.6	0.0e+00
WP_000373425.1|1819447_1819942_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000548593.1|1820494_1820701_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_148050715.1|1820996_1821179_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_113705759.1|1821207_1822480_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	3.8e-172
WP_001443523.1|1822678_1822834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|1822981_1823170_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1823180_1823393_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071776.1|1823756_1824254_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
1823769:1823785	attL	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001101173.1|1824250_1824784_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001306174.1|1824897_1825158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077790500.1|1825105_1825657_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.0	2.5e-35
WP_000839590.1|1825661_1825877_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1826631_1826847_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_001047133.1|1827522_1828275_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_001445896.1|1828288_1829338_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	1.7e-112
WP_001309521.1|1829339_1829618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980999.1|1829684_1829936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|1830152_1830365_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_148050602.1|1830750_1831963_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	1.1e-165
WP_137486443.1|1831929_1832241_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	8.9e-06
WP_000381395.1|1833347_1834919_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1834938_1835286_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1835285_1835963_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_137486466.1|1835939_1836047_+	copper resistance protein	NA	NA	NA	NA	NA
WP_047085558.1|1836003_1836507_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_047085557.1|1836737_1837163_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_047085556.1|1837203_1838169_-	phage O protein family	NA	U5P0A0	Shigella_phage	60.9	1.2e-53
WP_047085555.1|1838149_1838671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|1838654_1838882_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1838959_1839367_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|1839559_1839712_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_023281935.1|1839723_1840089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328010.1|1840057_1840345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047084992.1|1840770_1840959_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|1840955_1841147_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_047084991.1|1841240_1843712_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001296941.1|1843799_1844036_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_047084990.1|1844070_1845351_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	4.3e-155
WP_001360138.1|1845370_1845481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836064.1|1845538_1846558_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001295394.1|1846569_1847784_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1847989_1848316_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_044864500.1|1848450_1848792_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1848826_1849387_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1849389_1850100_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1850207_1850513_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_047084989.1|1850711_1853138_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	3.5e-214
1857833:1857849	attR	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 5
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	1985356	2089103	5270611	capsid,transposase,tRNA,holin,plate,portal,head,terminase,integrase,tail	Enterobacteria_phage(41.11%)	129	1981349:1981365	2032674:2032690
1981349:1981365	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
WP_000029466.1|1985356_1986106_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_004016206.1|1986105_1986657_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|1986719_1987700_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_000997174.1|1987908_1988238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137538789.1|1988345_1988708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137538794.1|1988710_1989649_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.1	4.3e-80
WP_137538790.1|1989737_1990049_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	54.8	3.4e-21
WP_000163908.1|1990140_1990419_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_137538791.1|1990433_1990772_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	83.6	9.2e-49
WP_054579828.1|1990782_1991061_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	73.9	4.9e-32
WP_000357029.1|1991072_1991315_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	80.0	2.0e-29
WP_137538792.1|1991311_1991425_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985159.1|1991511_1991715_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_054579826.1|1991711_1991957_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	92.6	1.2e-37
WP_033552261.1|1992098_1992464_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	68.6	1.3e-37
WP_148050604.1|1992469_1995292_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.6	0.0e+00
WP_148050605.1|1995368_1996328_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.9e-178
WP_148050606.1|1996332_1996644_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	93.2	2.1e-47
WP_000248600.1|1997021_1998104_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
WP_148050607.1|1998100_2000305_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_148050608.1|2000809_2001856_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	98.6	1.2e-203
WP_148050609.1|2001855_2003607_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	92.1	1.3e-308
WP_148050610.1|2003761_2004598_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	96.4	1.0e-144
WP_001055112.1|2004621_2005674_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_148050611.1|2005719_2006517_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	87.6	1.3e-122
WP_032165835.1|2006618_2007113_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	93.9	7.6e-84
WP_032165834.1|2007112_2007313_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	95.5	2.5e-30
WP_029392832.1|2007315_2007639_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	91.6	1.8e-46
WP_000836744.1|2007693_2008239_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	87.7	1.1e-91
WP_148050612.1|2008235_2008793_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	89.6	5.0e-60
WP_148050613.1|2008779_2009247_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_148050614.1|2009239_2009875_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	96.7	1.9e-111
WP_148050615.1|2009871_2010453_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	92.2	3.9e-95
WP_148050616.1|2010449_2010800_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	97.4	3.9e-58
WP_148050617.1|2010803_2011700_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	96.3	2.4e-152
WP_000071744.1|2011692_2012301_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	5.8e-86
WP_148050618.1|2012297_2013797_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	97.2	1.5e-271
WP_148050619.1|2013796_2014399_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	96.5	2.8e-104
WP_001008242.1|2014370_2014814_-|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	97.3	1.6e-80
WP_148050620.1|2014834_2015245_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	87.1	1.0e-57
WP_148050621.1|2015274_2015874_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	82.2	6.8e-87
WP_148050622.1|2015902_2016391_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	95.7	1.1e-82
WP_148050623.1|2016402_2019204_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	87.3	0.0e+00
WP_122989310.1|2019190_2019346_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.3e-22
WP_148050624.1|2019354_2019723_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	91.8	8.2e-51
WP_000290459.1|2019777_2020290_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	94.1	6.2e-89
WP_032165975.1|2020289_2021474_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	95.2	2.1e-217
WP_148050625.1|2021631_2022732_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	1.8e-202
WP_148050626.1|2022854_2023640_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000488101.1|2023835_2024096_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2024286_2024427_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_072650212.1|2024732_2025032_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|2025036_2027424_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2027438_2028422_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2028705_2028750_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2028872_2029229_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2029281_2029479_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2029575_2030118_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2030121_2032050_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001142445.1|2034644_2034752_+	hypothetical protein	NA	NA	NA	NA	NA
2032674:2032690	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
WP_000771391.1|2034804_2035563_-	YdiY family protein	NA	NA	NA	NA	NA
WP_000251727.1|2035849_2036779_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000146159.1|2036879_2037170_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000267656.1|2037275_2038136_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000222172.1|2038176_2038713_-	membrane protein	NA	NA	NA	NA	NA
WP_000106833.1|2038859_2039528_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_001295408.1|2039690_2040281_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001010706.1|2040413_2041805_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_001469620.1|2041829_2042612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001241561.1|2042899_2043163_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_000077873.1|2043345_2045607_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
WP_148050627.1|2046039_2046618_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	56.1	3.8e-50
WP_148050628.1|2046632_2047865_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	63.5	4.8e-79
WP_042966142.1|2048959_2049484_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	70.1	7.3e-69
WP_042966141.1|2049498_2050302_-|tail	phage tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	83.6	1.6e-30
WP_042966140.1|2050301_2050874_-	DUF2313 domain-containing protein	NA	A0A2H4J9D6	uncultured_Caudovirales_phage	32.6	1.7e-18
WP_075842596.1|2050878_2051958_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.6	7.0e-74
WP_000372931.1|2051957_2052308_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	4.8e-32
WP_050937688.1|2052361_2053018_-|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	47.6	1.6e-41
WP_148050629.1|2053014_2054226_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.8	1.8e-70
WP_148050630.1|2054209_2055559_-	multidrug DMT transporter permease	NA	F6MIL2	Haemophilus_phage	27.6	1.3e-37
WP_000381395.1|2057706_2059278_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2059297_2059645_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2059644_2060322_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_141220723.1|2060650_2061034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000023097.1|2061030_2061405_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	58.5	1.1e-31
WP_148050631.1|2061417_2062839_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	44.3	7.7e-97
WP_148050716.1|2062831_2063065_-	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	58.3	3.2e-08
WP_071988111.1|2063054_2063693_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_096913030.1|2063689_2064121_-	DUF1320 family protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	28.1	4.1e-09
WP_001402713.1|2064124_2064466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141220721.1|2064469_2065378_-|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	59.3	1.8e-99
WP_042966128.1|2065388_2065784_-	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	37.8	2.9e-17
WP_047088860.1|2065784_2066900_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	37.5	1.7e-51
WP_050937630.1|2067109_2067661_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	30.1	3.1e-09
WP_042966127.1|2067657_2068824_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	Q6QIB9	Burkholderia_phage	46.1	1.5e-61
WP_042966126.1|2068810_2070406_-	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	45.9	2.7e-122
WP_042966125.1|2070409_2072050_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.5	3.9e-193
WP_042966124.1|2072051_2072792_-	DNA methylase	NA	Q775B4	Bordetella_phage	53.2	1.9e-67
WP_148050717.1|2072849_2073038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040091524.1|2073281_2074865_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.2	3.4e-77
WP_000957246.1|2074907_2075288_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001137792.1|2075274_2075604_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001298859.1|2075813_2077355_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2077369_2078116_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000312574.1|2078204_2078705_-	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.2	4.9e-38
WP_077788438.1|2078843_2079020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966122.1|2079127_2079505_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	90.3	5.8e-60
WP_000445984.1|2079507_2079786_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	2.6e-17
WP_001372993.1|2079775_2080168_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_042971158.1|2080351_2080630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087262.1|2080655_2081123_-	mor transcription activator family protein	NA	A0A2D1GNW5	Pseudomonas_phage	39.6	6.8e-18
WP_042970930.1|2081217_2081697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087260.1|2081693_2082092_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.6	2.7e-39
WP_042966117.1|2082063_2082378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071940939.1|2082409_2082592_-	hypothetical protein	NA	Q286W7	Escherichia_phage	94.4	2.3e-22
WP_042970913.1|2082596_2082905_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	73.5	1.8e-06
WP_042970909.1|2082901_2083192_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	61.7	7.4e-23
WP_042966114.1|2083181_2083412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087259.1|2083408_2083636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148050632.1|2083625_2084354_-	DUF2786 domain-containing protein	NA	A0A0S4L2R2	Pseudomonas_phage	33.2	3.0e-20
WP_047087256.1|2084432_2084978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052773470.1|2085043_2085430_-	hypothetical protein	NA	U5PRY6	Bacillus_phage	48.7	1.4e-21
WP_047087255.1|2085510_2085702_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	53.3	3.1e-09
WP_012904653.1|2085682_2085916_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047087252.1|2085917_2086562_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	66.8	6.9e-77
WP_024183778.1|2087596_2087821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087250.1|2087862_2088195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087248.1|2088209_2089103_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	53.6	2.0e-82
>prophage 6
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	2312327	2374319	5270611	capsid,transposase,holin,portal,head,terminase,integrase,tail	Enterobacteria_phage(33.33%)	76	2337878:2337893	2376514:2376529
WP_148050635.1|2312327_2313540_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.0	2.8e-164
WP_047085553.1|2315834_2316686_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_047085554.1|2316793_2318152_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001339045.1|2318151_2318823_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920132.1|2318955_2319369_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740111.1|2319477_2320482_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240090.1|2320482_2321118_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007767.1|2321374_2322025_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_065225649.1|2323183_2323762_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	56.7	4.4e-51
WP_148050628.1|2323776_2325009_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	63.5	4.8e-79
WP_148050636.1|2325056_2325866_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	55.7	2.2e-24
WP_000017388.1|2325956_2326748_-	hypothetical protein	NA	A0A1P8DUT0	Escherichia_phage	75.0	3.1e-119
WP_047089024.1|2326744_2327116_-	hypothetical protein	NA	A0A1P8DUS1	Escherichia_phage	66.4	1.8e-45
WP_077790497.1|2327125_2330374_-|tail	phage tail protein	tail	A0A0P0ZEQ8	Stx2-converting_phage	80.2	0.0e+00
WP_042966578.1|2330617_2331262_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	77.4	6.8e-93
WP_047085481.1|2331159_2331903_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	93.1	2.4e-142
WP_024212310.1|2331913_2332612_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	5.8e-130
WP_000847269.1|2332611_2332941_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	6.8e-57
WP_148050637.1|2332937_2335517_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.0	0.0e+00
WP_047085479.1|2335497_2335911_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.8	8.6e-41
WP_000479079.1|2335937_2336369_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	2.4e-41
WP_000235024.1|2336382_2337135_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	3.2e-126
WP_000683087.1|2337142_2337538_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	2.0e-58
WP_000975024.1|2337534_2338068_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
2337878:2337893	attL	GCCCGTTTCAGTCTGG	NA	NA	NA	NA
WP_021499114.1|2338082_2338436_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.1e-41
WP_001355131.1|2338428_2338812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522660.1|2338863_2339892_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.3e-113
WP_000256809.1|2339949_2340297_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_137486574.1|2340333_2341656_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	2.2e-85
WP_001339397.1|2341727_2342405_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2342404_2342752_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2342771_2344343_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001360691.1|2344535_2346128_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2346124_2346331_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001360690.1|2346314_2348243_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.9e-262
WP_000235436.1|2348214_2348724_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000095729.1|2349117_2349330_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_047085548.1|2350204_2350405_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	75.6	9.0e-12
WP_000735650.1|2350365_2350590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123000865.1|2350675_2350861_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.5e-16
WP_052834940.1|2351221_2351404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077790507.1|2351419_2351599_+	hypothetical protein	NA	Q8VNN9	Enterobacteria_phage	97.7	1.7e-14
WP_042966549.1|2351559_2352093_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	5.1e-102
WP_000282141.1|2352221_2352536_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_001015166.1|2352545_2353187_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000284517.1|2353190_2353406_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000216624.1|2353966_2354131_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
WP_001299895.1|2354127_2354559_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
WP_040091372.1|2355026_2356085_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	95.2	2.3e-199
WP_000917767.1|2356235_2356433_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_024166254.1|2356607_2357321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042971035.1|2357566_2358388_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.9	4.5e-81
WP_040091368.1|2358384_2358759_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	3.4e-36
WP_047662617.1|2358771_2359761_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	93.6	7.6e-184
WP_001223333.1|2359770_2360286_-	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_047085128.1|2360301_2361117_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	98.9	4.2e-148
WP_000767110.1|2361268_2361664_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210186.1|2361660_2361987_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	4.5e-53
WP_072097190.1|2361986_2362481_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	95.7	3.4e-84
WP_000061516.1|2362477_2363296_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.4e-122
WP_000620689.1|2363292_2363517_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	3.7e-38
WP_001087304.1|2363513_2364665_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	95.8	5.9e-204
WP_040091608.1|2364661_2365213_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	98.9	1.3e-100
WP_000649477.1|2365256_2365457_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859465.1|2365547_2366222_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	99.6	3.5e-132
WP_021559686.1|2366417_2366627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071587686.1|2367256_2367457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040091619.1|2367471_2367834_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	5.6e-60
WP_000081287.1|2367899_2368724_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_001401560.1|2368851_2369388_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_040091320.1|2369378_2370257_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.8	3.1e-165
WP_040091321.1|2370253_2370601_+	hypothetical protein	NA	U5P0J0	Shigella_phage	70.4	2.1e-24
WP_024195021.1|2370597_2370792_+	hypothetical protein	NA	A5LH59	Enterobacteria_phage	95.3	2.2e-31
WP_040091656.1|2371136_2371322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085127.1|2371332_2372928_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_040091220.1|2373080_2374319_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	97.3	1.6e-231
2376514:2376529	attR	GCCCGTTTCAGTCTGG	NA	NA	NA	NA
>prophage 7
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	2665789	2705721	5270611	transposase,plate,head,integrase,tail,protease	Vibrio_phage(48.72%)	53	2663437:2663451	2706681:2706695
2663437:2663451	attL	AAATTATTCAAGATA	NA	NA	NA	NA
WP_040091524.1|2665789_2667373_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.2	3.4e-77
WP_000957246.1|2667415_2667796_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001137792.1|2667782_2668112_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_047085416.1|2669564_2669750_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	69.4	5.4e-19
WP_065226824.1|2669872_2670448_-	DUF4376 domain-containing protein	NA	Q8W610	Enterobacteria_phage	54.4	2.3e-47
WP_148050642.1|2670462_2672712_-|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	64.2	2.4e-84
WP_047084882.1|2672698_2673229_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	69.3	2.8e-68
WP_047084881.1|2673243_2674239_-	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	44.4	9.1e-44
WP_047084880.1|2674242_2674827_-	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	48.7	5.5e-49
WP_047084879.1|2674811_2675888_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	51.8	1.0e-93
WP_000206926.1|2675877_2676330_-	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	41.4	3.7e-21
WP_047084878.1|2676326_2676863_-|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	41.1	1.6e-26
WP_047084877.1|2676853_2677924_-|tail	phage tail protein	tail	A0A2I7S9G1	Vibrio_phage	46.9	2.2e-88
WP_047084876.1|2677923_2679198_-	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	38.5	2.6e-75
WP_047084875.1|2679197_2681063_-|tail	tail protein	tail	A0A2P9JZK0	Alteromonadaceae_phage	31.9	4.6e-57
WP_047084874.1|2681149_2681545_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	46.6	5.6e-13
WP_032239558.1|2681546_2681903_-|tail	Mu phage tail tube protein GpM	tail	NA	NA	NA	NA
WP_047084873.1|2681912_2683388_-|tail	tail sheath protein	tail	M1Q565	Vibrio_phage	55.9	4.2e-154
WP_024195697.1|2683387_2683573_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047084872.1|2683553_2684165_-	hypothetical protein	NA	M1PJ94	Vibrio_phage	44.9	4.3e-36
WP_000513058.1|2684161_2684704_-	phage morphogeneis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	1.6e-58
WP_000540584.1|2684703_2685141_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.0	1.4e-33
WP_001290368.1|2685140_2685452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047084871.1|2685530_2686436_-|head	phage head protein	head	M4MB71	Vibrio_phage	57.8	2.6e-98
WP_047084870.1|2686443_2687400_-|protease	Mu phage protease GpI	protease	M1Q578	Vibrio_phage	46.2	3.9e-76
WP_047084869.1|2687613_2688378_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	60.9	2.5e-94
WP_148050643.1|2688370_2689930_-	DUF935 family protein	NA	A0A2I7S9K0	Vibrio_phage	56.7	1.1e-152
WP_077790453.1|2689926_2691453_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	68.1	2.7e-196
WP_047084866.1|2691458_2692040_-	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	55.0	1.1e-49
WP_047084865.1|2692177_2692477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047084883.1|2692479_2692767_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.6	3.5e-25
WP_047084864.1|2692772_2693078_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	38.3	1.4e-11
WP_047084863.1|2693062_2693290_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_047084862.1|2693286_2693895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047084861.1|2693882_2694293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047084860.1|2694267_2694519_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	68.9	1.8e-25
WP_047084859.1|2694520_2695117_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	41.7	7.8e-35
WP_047084858.1|2695218_2695716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047084857.1|2695712_2696123_-	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	60.3	4.9e-36
WP_047084856.1|2696648_2697038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047084855.1|2697030_2697213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047084854.1|2697205_2697748_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	83.1	2.3e-81
WP_000381395.1|2697936_2699508_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2699527_2699875_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2699874_2700552_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_071781643.1|2700513_2700612_+	copper resistance protein	NA	NA	NA	NA	NA
WP_047085331.1|2700601_2701078_-	host-nuclease inhibitor protein Gam	NA	A0A0C4UQY5	Shigella_phage	96.2	1.2e-78
WP_047085332.1|2701099_2701387_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	88.9	1.8e-37
WP_047085333.1|2701842_2702112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077627739.1|2702144_2702369_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	85.1	3.4e-31
WP_047085335.1|2702384_2703338_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	41.0	4.4e-56
WP_047085336.1|2703413_2705498_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	46.6	8.5e-161
WP_077134798.1|2705478_2705721_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	55.6	3.2e-11
2706681:2706695	attR	TATCTTGAATAATTT	NA	NA	NA	NA
>prophage 8
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	2730169	2773910	5270611	capsid,tRNA,plate,holin,portal,head,terminase,integrase,tail,protease	Shigella_phage(55.93%)	65	2724443:2724457	2754318:2754332
2724443:2724457	attL	CTGGCGCGTAAGCTG	NA	NA	NA	NA
WP_000918363.1|2730169_2731585_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235508.1|2731667_2732651_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|2732816_2733059_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_148050644.1|2733192_2734230_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332271.1|2734318_2735416_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_001217553.1|2735477_2735726_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_001437322.1|2735722_2735845_-	hypothetical protein	NA	Q9JFR8	Wheat_rosette_stunt_virus	76.5	6.9e-07
WP_023993836.1|2735869_2736433_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	2.6e-80
WP_077757610.1|2736509_2736962_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	94.0	1.1e-78
WP_148050645.1|2736961_2737552_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	62.8	1.6e-56
WP_001045291.1|2737523_2737967_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.4	3.3e-22
WP_148050646.1|2737971_2738652_-	hypothetical protein	NA	U5P0I1	Shigella_phage	61.7	5.0e-62
WP_136766484.1|2738655_2739240_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	3.5e-112
WP_047087384.1|2739230_2740289_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.0	6.8e-199
WP_000424737.1|2740275_2740701_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_001259084.1|2740700_2741249_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_047085210.1|2741248_2742328_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	4.5e-206
WP_148050647.1|2742324_2743698_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.6	6.3e-245
WP_096973497.1|2743754_2744243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148050648.1|2744307_2746209_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.4	0.0e+00
WP_000571713.1|2746293_2746617_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_148050649.1|2746613_2746970_-|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	2.0e-62
WP_148050650.1|2746969_2748466_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.4	5.5e-271
WP_000497757.1|2748449_2748620_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_040075042.1|2748628_2749189_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.4	2.0e-104
WP_001522202.1|2749185_2749710_-	hypothetical protein	NA	U5P416	Shigella_phage	100.0	8.6e-94
WP_148050651.1|2749681_2750092_-|head	phage head closure protein	head	U5P0R0	Shigella_phage	95.6	1.1e-69
WP_000924830.1|2750088_2750412_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	2.2e-52
WP_000766098.1|2750490_2751720_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.8	1.5e-226
WP_000999805.1|2751730_2752333_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923135.1|2752325_2753552_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.8	3.4e-242
WP_122997149.1|2753699_2755196_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.6	4.1e-290
2754318:2754332	attR	CAGCTTACGCGCCAG	NA	NA	NA	NA
WP_000929181.1|2755429_2755924_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_148050652.1|2756049_2756400_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	1.0e-63
WP_148050653.1|2756692_2756968_-	peptidase	NA	U5P461	Shigella_phage	82.4	9.8e-33
WP_032257816.1|2756852_2757245_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	90.8	1.0e-54
WP_001197751.1|2757228_2757705_-	glycoside hydrolase family protein	NA	U5P0A9	Shigella_phage	100.0	3.4e-89
WP_001120492.1|2757708_2758035_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	100.0	1.4e-57
WP_148050654.1|2758396_2759482_+	hypothetical protein	NA	U5P4L0	Shigella_phage	99.4	1.1e-188
WP_049592588.1|2759500_2760013_+	hypothetical protein	NA	U5P455	Shigella_phage	99.0	2.4e-48
WP_001204823.1|2760033_2760396_-	antitermination protein Q	NA	U5P0A5	Shigella_phage	100.0	3.2e-63
WP_148050655.1|2760413_2761403_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	99.4	7.3e-195
WP_001223333.1|2761412_2761928_-	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_047085128.1|2761943_2762759_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	98.9	4.2e-148
WP_000767110.1|2762921_2763317_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210186.1|2763313_2763640_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	4.5e-53
WP_148050656.1|2763639_2764134_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.1e-85
WP_000104953.1|2764130_2765072_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	5.6e-144
WP_001250269.1|2765061_2765241_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001534905.1|2765416_2765974_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	92.4	3.5e-93
WP_000187186.1|2765996_2766245_-	chaperone TorD	NA	NA	NA	NA	NA
WP_000853322.1|2766382_2767069_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	41.6	1.8e-38
WP_000549623.1|2767465_2767672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|2767643_2768078_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_072039466.1|2767996_2768200_-	hypothetical protein	NA	U5P0J5	Shigella_phage	94.0	3.4e-30
WP_000135680.1|2768549_2768912_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081295.1|2768977_2769802_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.3	1.0e-149
WP_148050657.1|2769930_2770467_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.9	1.1e-99
WP_148050658.1|2770457_2770808_+	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	95.7	7.3e-57
WP_148050659.1|2770804_2771290_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.8	1.8e-66
WP_148050660.1|2771286_2772003_+	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	55.4	7.5e-32
WP_148050719.1|2772046_2772568_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	69.5	6.8e-51
WP_001061348.1|2772567_2773140_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	1.2e-109
WP_001093909.1|2773176_2773449_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_148050661.1|2773475_2773910_-	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	50.3	3.3e-35
>prophage 9
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	3973403	4024013	5270611	transposase,protease	Stx2-converting_phage(33.33%)	52	NA	NA
WP_148050679.1|3973403_3977960_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_001331203.1|3978107_3978917_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001324279.1|3978982_3979393_+	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_024166543.1|3979410_3980370_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498824.1|3980399_3982460_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249331.1|3982459_3983953_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173453.1|3983952_3985176_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000287130.1|3985192_3985648_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_047084647.1|3985651_3986215_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820125.1|3986211_3986583_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001255041.1|3986579_3987185_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_148050680.1|3987181_3988159_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_047084649.1|3988155_3989334_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001411126.1|3989335_3989872_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_148050681.1|3990592_3990703_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001339397.1|3990664_3991342_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3991341_3991689_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3991708_3993280_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000839281.1|3993525_3993723_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000777541.1|3993734_3994223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854753.1|3994219_3994594_-	toxin	NA	NA	NA	NA	NA
WP_001278232.1|3994683_3995052_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692316.1|3995214_3995436_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
WP_001186726.1|3995498_3995975_-	RadC family protein	NA	NA	NA	NA	NA
WP_047084650.1|3995990_3996476_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_137486531.1|3996530_3996743_-	DUF932 domain-containing protein	NA	NA	NA	NA	NA
WP_097561733.1|3996833_3998046_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	5.1e-166
WP_071525596.1|3998682_3998817_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_001119729.1|3998761_3998995_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000581504.1|3999073_3999529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001577200.1|3999604_4002121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085450.1|4002241_4005364_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_040091524.1|4006630_4008214_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.2	3.4e-77
WP_000957246.1|4008256_4008637_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001137792.1|4008623_4008953_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_148050682.1|4008901_4009126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085448.1|4010617_4012102_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001326350.1|4012201_4012387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001347489.1|4012317_4012518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000804452.1|4012423_4013026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323667.1|4013112_4013391_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336482.1|4014196_4014382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000236763.1|4014564_4014762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085447.1|4014965_4015535_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271027.1|4015794_4016196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097561733.1|4016401_4017615_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	5.1e-166
WP_001315617.1|4018833_4018932_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001315616.1|4018933_4019716_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4020018_4020939_+	ribokinase	NA	NA	NA	NA	NA
WP_000998349.1|4020966_4022283_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107474.1|4022294_4023308_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000436071.1|4023728_4024013_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	1.9e-23
>prophage 10
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	4027995	4100422	5270611	transposase,tRNA,integrase,protease	Stx2-converting_phage(40.0%)	59	4059223:4059238	4093331:4093346
WP_000381395.1|4027995_4029567_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4029586_4029934_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4029933_4030611_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000198472.1|4031092_4032322_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_000091658.1|4032318_4033050_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_000020242.1|4033049_4033514_-	3-hydroxy-fatty acyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_001350102.1|4033510_4034680_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_000597701.1|4034681_4035266_-	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_000180163.1|4035262_4037581_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_000670565.1|4037549_4038155_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000930891.1|4038151_4038574_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000115638.1|4038577_4040254_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_001304725.1|4040244_4040598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001077065.1|4040584_4041943_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_001350104.1|4041939_4042521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132059.1|4042525_4042777_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_001148680.1|4042788_4043046_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_001350105.1|4043020_4043842_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_001350106.1|4043838_4044561_-	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_046122761.1|4044601_4045660_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000833174.1|4045724_4046114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323873.1|4046333_4046540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024222607.1|4046629_4048402_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
WP_047085063.1|4048414_4058284_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.9	9.7e-29
WP_000355946.1|4058297_4058618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148050683.1|4059018_4059231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137792.1|4059179_4059509_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
4059223:4059238	attL	TTGCCGCATGGCGCGC	NA	NA	NA	NA
WP_001016257.1|4059703_4060450_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_097561733.1|4060582_4061795_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	5.1e-166
WP_077787409.1|4061853_4062984_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_047084943.1|4063191_4067379_+	RTX family exoprotein	NA	NA	NA	NA	NA
WP_072053173.1|4067669_4067981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021067.1|4068002_4068512_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032145296.1|4070781_4071183_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	88.0	6.8e-59
WP_000842052.1|4074288_4075125_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_148050720.1|4076106_4076493_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	46.8	3.7e-17
WP_148050635.1|4076553_4077766_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.0	2.8e-164
WP_000234512.1|4079060_4079768_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_047084944.1|4080166_4082302_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|4082351_4083608_-	nucleoside permease	NA	NA	NA	NA	NA
WP_001298916.1|4083809_4084889_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|4084953_4085229_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001321419.1|4085256_4086309_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|4086469_4087189_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|4087188_4087515_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|4087698_4088418_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394107.1|4088593_4089640_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_032294388.1|4091782_4092919_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174747.1|4092911_4093505_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
4093331:4093346	attR	TTGCCGCATGGCGCGC	NA	NA	NA	NA
WP_001277222.1|4093512_4093803_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|4093799_4094366_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|4094383_4095088_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_072048899.1|4095105_4096086_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|4096260_4096677_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|4096676_4097240_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_040062533.1|4097348_4098299_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|4098311_4099043_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|4099122_4099830_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300769.1|4099924_4100422_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	4330642	4343825	5270611		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|4330642_4331404_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4331397_4332024_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|4332163_4333303_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|4333365_4334358_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|4334451_4335816_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|4335904_4336681_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|4336685_4337324_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|4337320_4338583_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847974.1|4338579_4339488_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.9e-118
WP_001300386.1|4339683_4340451_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141341.1|4340501_4341158_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.3	5.2e-48
WP_001272924.1|4341263_4343825_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 12
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	4690325	4763668	5270611	capsid,tRNA,holin,plate,portal,lysis,head,terminase,integrase,tail,protease	Enterobacteria_phage(29.41%)	98	4686635:4686651	4734982:4734998
4686635:4686651	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|4690325_4690526_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001281193.1|4690648_4690993_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	1.0e-58
WP_136755935.1|4691235_4691838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|4692048_4692270_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_077250124.1|4692368_4692650_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	7.9e-46
WP_000548531.1|4692660_4692852_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682311.1|4692824_4693007_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
WP_021571945.1|4693003_4693684_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	3.0e-131
WP_047084740.1|4693680_4694466_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	99.6	6.9e-148
WP_000995439.1|4694471_4694768_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|4694842_4694986_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|4694954_4695119_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065351.1|4695191_4695560_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_000167595.1|4695709_4696180_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|4696238_4696622_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_001278657.1|4697082_4697703_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
WP_001207140.1|4697699_4698134_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
WP_000885926.1|4698204_4698546_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_148050695.1|4698555_4699269_-	helix-turn-helix domain-containing protein	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
WP_000437871.1|4699369_4699570_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_148050696.1|4699708_4700005_+	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	98.0	1.5e-47
WP_052924360.1|4700037_4700976_+	replication protein	NA	H6WZI2	Escherichia_phage	99.7	2.2e-172
WP_000788869.1|4700972_4701674_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145931.1|4701670_4701961_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001543887.1|4702034_4702451_+	hypothetical protein	NA	A0A2D1GLH4	Escherichia_phage	99.3	5.1e-73
WP_000573864.1|4702443_4703046_+	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_000153293.1|4703042_4703570_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	100.0	9.5e-101
WP_001254256.1|4703566_4703749_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_042970717.1|4704023_4704758_+	antirepressor	NA	A0A0N7C203	Escherichia_phage	98.8	2.3e-121
WP_000002243.1|4705555_4705846_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_136756023.1|4705842_4706205_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	98.3	4.6e-62
WP_033883930.1|4706204_4706399_+	protein ninH	NA	A0A088CC23	Shigella_phage	92.2	1.8e-28
WP_001204859.1|4706391_4706826_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001364109.1|4706852_4707059_-	hypothetical protein	NA	K0JCU8	Escherichia_phage	91.2	2.4e-23
WP_000691354.1|4707331_4708279_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|4708288_4708558_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_077628410.1|4708862_4709033_-	DUF2116 family Zn-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000783764.1|4709241_4709565_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	82.5	6.8e-41
WP_001195013.1|4709548_4709998_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	80.5	3.2e-65
WP_071820177.1|4710045_4710252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077790475.1|4710223_4710409_+|lysis	lysis protein	lysis	M9NZE8	Enterobacteria_phage	95.1	2.5e-24
WP_000839225.1|4710663_4711161_+	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_001283921.1|4711157_4711415_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_047087344.1|4711826_4712177_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	3.1e-63
WP_000929175.1|4712303_4712798_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_122997149.1|4713031_4714528_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.6	4.1e-290
WP_000923135.1|4714675_4715902_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.8	3.4e-242
WP_000999805.1|4715894_4716497_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766098.1|4716507_4717737_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.8	1.5e-226
WP_000924830.1|4717815_4718139_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	2.2e-52
WP_001522200.1|4718135_4718546_+|head	phage head closure protein	head	U5P0R0	Shigella_phage	96.3	1.0e-70
WP_001522202.1|4718517_4719042_+	hypothetical protein	NA	U5P416	Shigella_phage	100.0	8.6e-94
WP_040075042.1|4719038_4719599_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.4	2.0e-104
WP_148050697.1|4719607_4719778_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	96.4	7.9e-25
WP_148050698.1|4719761_4721258_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.6	2.2e-272
WP_000090997.1|4721257_4721614_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	9.0e-63
WP_000661054.1|4721613_4721883_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_001314907.1|4721849_4722032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085212.1|4722024_4723860_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.9	1.9e-305
WP_001514801.1|4723912_4724290_+	PH domain-containing protein	NA	A5GZ63	Lactococcus_phage	35.6	2.3e-08
WP_047085211.1|4724353_4725682_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	95.9	2.5e-238
WP_148050699.1|4725678_4726758_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	3.8e-205
WP_001259084.1|4726757_4727306_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000424737.1|4727305_4727731_+	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_047087384.1|4727717_4728776_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.0	6.8e-199
WP_136766484.1|4728766_4729351_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	3.5e-112
WP_148050700.1|4729354_4730035_+	hypothetical protein	NA	U5P0I1	Shigella_phage	62.2	1.7e-62
WP_136755982.1|4730039_4730483_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.4	4.3e-22
WP_047084672.1|4730570_4731728_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	6.3e-222
WP_000368140.1|4732039_4732972_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000776768.1|4733265_4734021_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937786.1|4734202_4735261_-	hypothetical protein	NA	NA	NA	NA	NA
4734982:4734998	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001296861.1|4735626_4736967_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296261.1|4737338_4737623_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001530662.1|4737802_4739113_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_148050701.1|4739112_4741257_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|4741459_4741945_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_001363244.1|4742628_4743192_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_047084674.1|4743273_4745919_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_038994040.1|4745938_4746691_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_077790439.1|4746690_4747218_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001232541.1|4747199_4747688_+	fimbrial protein	NA	NA	NA	NA	NA
WP_038994037.1|4747684_4748224_+	fimbrial protein	NA	NA	NA	NA	NA
WP_148050702.1|4748321_4749050_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|4749131_4749683_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001339812.1|4749848_4750781_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_047084676.1|4751018_4752104_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001043813.1|4752107_4752932_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|4752931_4753741_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_047084677.1|4753740_4754289_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|4754322_4754601_+	YfcL family protein	NA	NA	NA	NA	NA
WP_047084678.1|4754721_4756728_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|4756886_4758107_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_047084679.1|4758371_4759550_+	arabinose transporter	NA	NA	NA	NA	NA
WP_000615813.1|4759546_4760542_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_047084680.1|4760640_4761777_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.0e-22
WP_001289166.1|4761842_4762856_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283581.1|4762855_4763668_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	4979681	4989122	5270611		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|4979681_4980608_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|4980612_4981344_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4981324_4981432_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4981491_4982223_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4982444_4984130_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4984126_4984846_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|4984892_4985363_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|4985402_4985864_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001370558.1|4985988_4987989_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001300968.1|4987985_4989122_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 14
NZ_CP042298	Escherichia coli strain RM9088 chromosome, complete genome	5270611	5123209	5240837	5270611	capsid,transposase,holin,portal,head,terminase,integrase,tail,protease	Enterobacteria_phage(31.34%)	104	5145928:5145942	5195096:5195110
WP_137486555.1|5123209_5124423_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.6	1.5e-165
WP_137486480.1|5125564_5125858_-	toxin	NA	NA	NA	NA	NA
WP_097561733.1|5125895_5127108_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	5.1e-166
WP_001339397.1|5129081_5129759_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|5129758_5130106_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|5130125_5131697_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001538127.1|5133424_5134018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113705759.1|5134034_5135308_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	3.8e-172
WP_001538125.1|5135351_5135519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148050711.1|5135532_5136255_-	ribokinase	NA	NA	NA	NA	NA
WP_047085540.1|5139573_5140119_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|5140115_5140859_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193786.1|5140870_5141950_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001310930.1|5142011_5142947_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011447.1|5143404_5144322_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001600085.1|5144423_5145374_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_137486512.1|5145491_5147135_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
5145928:5145942	attL	CTATCGATCTTGGTA	NA	NA	NA	NA
WP_000532923.1|5147768_5148485_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_047085542.1|5148827_5150282_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378563.1|5150383_5151700_-	shikimate transporter	NA	NA	NA	NA	NA
WP_001311901.1|5155965_5156136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085404.1|5156062_5156821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000784542.1|5157471_5159493_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_001088820.1|5159623_5161201_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_047085405.1|5161204_5162008_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_000982866.1|5162004_5163105_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_047085406.1|5172680_5178788_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000140405.1|5178978_5179938_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_001327954.1|5180194_5181907_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.4e-31
WP_000654453.1|5181893_5183696_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	7.9e-22
WP_047085408.1|5183688_5184969_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_137486542.1|5184996_5186250_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_000480163.1|5186493_5187756_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
WP_001300801.1|5188093_5188891_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_047085409.1|5189126_5190152_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_000096344.1|5190151_5190355_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_047087128.1|5190413_5192885_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001098306.1|5192978_5193170_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_047085602.1|5193166_5193355_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_047085263.1|5194050_5194497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085262.1|5194586_5194802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052073903.1|5194961_5195117_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
5195096:5195110	attR	TACCAAGATCGATAG	NA	NA	NA	NA
WP_000381213.1|5195285_5195693_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	1.2e-31
WP_047085261.1|5195773_5196001_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705388.1|5195984_5196536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087522.1|5196507_5197548_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	85.6	2.5e-89
WP_064236784.1|5197579_5198002_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	97.9	1.2e-77
WP_047085396.1|5198036_5198216_+	DNA-binding protein	NA	A0A0U2SAW4	Escherichia_phage	89.4	1.3e-14
WP_097759619.1|5198179_5198797_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	3.2e-63
WP_077790485.1|5198853_5199108_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	68.3	3.8e-23
WP_000699804.1|5199104_5199350_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	3.8e-12
WP_047085392.1|5199324_5199798_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.2	1.2e-65
WP_001224671.1|5199942_5200125_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	3.4e-26
WP_038813042.1|5200317_5200713_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
WP_047085390.1|5200946_5201159_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	2.8e-27
WP_047085389.1|5201411_5201672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085388.1|5201738_5202017_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_047085387.1|5202018_5203068_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.3e-109
WP_047085386.1|5203080_5203452_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.4e-34
WP_000942766.1|5203441_5203813_+	Probable antitermination protein Q	NA	Q777W5	Enterobacteria_phage	83.3	4.7e-54
WP_000265262.1|5203967_5204786_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917767.1|5205075_5205273_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_038813804.1|5206584_5207127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042966258.1|5207337_5207763_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	3.8e-60
WP_040091348.1|5207759_5207924_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	69.8	6.1e-06
WP_038813346.1|5208185_5208521_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	3.6e-45
WP_000284517.1|5208693_5208909_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_001015166.1|5208912_5209554_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000282141.1|5209563_5209878_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_042966549.1|5210006_5210540_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	5.1e-102
WP_077790507.1|5210500_5210680_-	hypothetical protein	NA	Q8VNN9	Enterobacteria_phage	97.7	1.7e-14
WP_052834940.1|5210695_5210878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123000865.1|5211238_5211424_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.5e-16
WP_000735650.1|5211509_5211734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085548.1|5211694_5211895_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	75.6	9.0e-12
WP_000095729.1|5212769_5212982_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000235436.1|5213375_5213885_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001360690.1|5213856_5215785_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.9e-262
WP_000259002.1|5215768_5215975_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001360691.1|5215971_5217564_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000381395.1|5217756_5219328_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5219347_5219695_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5219694_5220372_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_137486574.1|5220443_5221766_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	2.2e-85
WP_000256809.1|5221802_5222150_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522660.1|5222207_5223236_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.3e-113
WP_001355131.1|5223287_5223671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021499114.1|5223663_5224017_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.1e-41
WP_000975024.1|5224031_5224565_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683087.1|5224561_5224957_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	2.0e-58
WP_000235024.1|5224964_5225717_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	3.2e-126
WP_000479079.1|5225730_5226162_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	2.4e-41
WP_047085479.1|5226188_5226602_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.8	8.6e-41
WP_148050712.1|5226582_5229162_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.0	0.0e+00
WP_000847337.1|5229158_5229488_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	1.2e-53
WP_047085486.1|5229487_5230186_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_047085485.1|5230196_5230940_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	8.9e-145
WP_071533105.1|5230876_5231509_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.2e-94
WP_047085484.1|5231569_5235049_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.3	0.0e+00
WP_047085483.1|5235116_5235716_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	3.1e-100
WP_148050713.1|5235780_5237871_+|tail	phage tail protein	tail	A0A0U2SH60	Escherichia_phage	62.1	1.4e-91
WP_047662566.1|5237885_5238458_+	DUF4376 domain-containing protein	NA	Q8W610	Enterobacteria_phage	74.5	4.8e-74
WP_001217550.1|5238782_5239031_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
WP_000202564.1|5239250_5240837_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 1
NZ_CP042296	Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence	167256	11054	150198	167256	transposase,integrase,plate	Stx2-converting_phage(25.93%)	110	11000:11059	110240:111550
11000:11059	attL	CTGAACCGCCCCGGAAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGAC	NA	NA	NA	NA
WP_097561733.1|11054_12267_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	5.1e-166
WP_047087513.1|14465_14699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170150.1|16746_17940_-	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_000781198.1|17954_18599_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000196048.1|18607_19309_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000132382.1|19324_20353_-	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000194204.1|20364_21723_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_001151754.1|21845_22772_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205483.1|26248_26602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000395613.1|26887_29938_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_001251453.1|29950_30838_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000045939.1|30830_31484_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_001028043.1|32388_33561_-	nucleotide sugar dehydrogenase	NA	M1IAF7	Acanthocystis_turfacea_Chlorella_virus	49.4	1.2e-98
WP_052318704.1|33592_34738_-	alginate export family protein	NA	NA	NA	NA	NA
WP_001355418.1|34914_35928_-	phosphotransferase	NA	NA	NA	NA	NA
WP_000930903.1|35902_37189_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_000834219.1|37178_38993_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	1.9e-55
WP_001261744.1|38982_40152_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_042966208.1|40148_41384_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_050541220.1|41406_42567_-	glycosyl transferase family 28	NA	NA	NA	NA	NA
WP_047084852.1|43646_47486_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	34.5	1.2e-171
WP_047084853.1|47522_48395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097467459.1|49268_49904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966204.1|49970_50744_-	F4 (K88) fimbria accessory protein FaeJ	NA	NA	NA	NA	NA
WP_042966203.1|50760_51525_-	F4 (K88) fimbria minor subunit FaeI	NA	NA	NA	NA	NA
WP_042966202.1|51555_52353_-	F4 (K88) fimbria minor subunit FaeH	NA	NA	NA	NA	NA
WP_148050542.1|52550_53330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966200.1|53561_54053_-	F4 (K88) fimbria minor subunit FaeF	NA	NA	NA	NA	NA
WP_042966198.1|54087_54864_-	F4 (K88) fimbrial chaperone FaeE	NA	NA	NA	NA	NA
WP_096987985.1|54856_57259_-	F4 (K88) fimbrial usher FaeD	NA	NA	NA	NA	NA
WP_047084850.1|57315_57852_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_042966194.1|58040_58865_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042966193.1|59395_60244_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042966192.1|60578_60875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|61571_62723_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001137792.1|64331_64661_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957246.1|64647_65028_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_040091524.1|65070_66654_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.2	3.4e-77
WP_042966386.1|67743_68106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047084734.1|68105_68732_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	40.1	1.2e-28
WP_136752745.1|69726_69960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966383.1|70272_71250_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	2.3e-100
WP_042966382.1|71534_72275_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_047084736.1|72629_72758_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000586177.1|73850_75017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000870678.1|76425_77034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966321.1|77105_77702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000359996.1|78005_79091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966322.1|81164_83696_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.4	2.4e-93
WP_047084735.1|83699_87104_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_077783240.1|87110_87725_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_042965808.1|89761_91114_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000202243.1|91132_91684_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_042965811.1|91691_92768_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_032194046.1|92771_93071_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_042965813.1|93086_93548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042965814.1|93558_95541_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.4	8.2e-12
WP_042965817.1|95553_96486_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042965819.1|96476_98279_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_042965821.1|98271_98694_-	lysozyme family protein	NA	NA	NA	NA	NA
WP_123000873.1|98704_99214_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_042965824.1|99220_100699_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_042965825.1|100701_101178_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_047085420.1|101715_101937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096913045.1|104825_105581_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_148050543.1|105577_107077_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_137486424.1|107464_108247_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.5	1.9e-137
WP_097561733.1|110294_111507_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	5.1e-166
WP_000220564.1|112038_112320_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	61.3	1.5e-23
110240:111550	attR	CTGAACCGCCCCGGAAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGTCAACGCGCAGTTCGTATGGTTCTGGAAAGTCAGGGCGAATATGACTCACAATGGGCGGCAATTTGTTCCATTGCTCCAAAGATTGGCTGTACGCCAGAGACTCTGCGTGTCTGGGTTCGCCAGCATGAGAGGGATACCGGGAGCGGTGATGGTGGGCTCACCACCGCTGAACGTCAGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATAATGCCACTGCTGGATAAGCTGCGTGAGCAGTACGGGGTCGGACCGGTATGCAGTGAACTGCATATTGCCCCGTCAACGTATTACCATTGTCAGCAGCAGCGGCATCATCCTGATAAACGCAGTGCCCGTGCGCAGCGCGATGACTGGCTGAAGAGAGAGATACAGCGCGTATACGATGAAAATCATCAGGTGTACGGTGTGCGTAAAGTCTGGCGTCAGTTGTTACGGGAAGGAATCAGGGTGGCCAGATGTACAGTGGCGCGCCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGCACTACCGTCAGCCGGAAAACCGTTGCCACAGGTGACCGCGTAAACCGTCAGTTCGTGGCAGAACGTCCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTCATCATTGATGTGTTTGCCGGATACATCGTGGGGTGGCGGGTCTCATCGTCTATGGAAACGACATTCGTGCTGGATGCGCTGGAGCAGGCGTTGTGGGCCCGTCGTCCGTCTGGCACCATCCATCACAGCGATAAAGGCTCTCAGTATGTGTCACTGGCCTATACGGAGCGACTAAAAGAAGCAAAACTGCTGGCATCAACAGGGAGTACAGGCGACTCGTATGACAACGCGATGGCTGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTCACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGGAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACAATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCA	NA	NA	NA	NA
WP_000121742.1|112309_112561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096913040.1|112836_113856_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071986331.1|113974_114157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|115990_117562_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|117581_117929_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|117928_118606_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_137486444.1|118582_118705_+	copper resistance protein	NA	NA	NA	NA	NA
WP_000269722.1|119245_119866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001364071.1|120149_120362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042967066.1|120522_121032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148050544.1|121663_122065_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557618.1|121997_122255_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000460640.1|122628_122865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097185.1|122803_122989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042967064.1|122914_123775_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	24.1	2.8e-09
WP_097561733.1|123853_125066_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	5.1e-166
WP_040091175.1|126294_126684_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_040091173.1|127075_127426_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	8.1e-40
WP_148050545.1|127966_128329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042967019.1|128449_129040_-	hypothetical protein	NA	Q9MBM1	Phage_Gifsy-1	34.7	4.1e-20
WP_040090730.1|129668_130133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139320987.1|130411_131452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829162.1|132453_133311_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001364037.1|133303_133378_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_071533137.1|133444_133621_+	replication protein RepA	NA	NA	NA	NA	NA
WP_000083838.1|133621_133870_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|134153_134303_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_071533136.1|134357_134540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042966773.1|134558_135023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766788.1|135177_135768_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001355319.1|135805_136015_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001364091.1|136342_136555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|136725_137403_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|137402_137750_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|137769_139341_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000139355.1|139396_139957_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_047088734.1|140011_140749_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	31.2	2.4e-09
WP_000447371.1|140770_141202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148050546.1|141250_146521_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_148050548.1|146520_148461_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001298859.1|148656_150198_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 1
NZ_CP042297	Escherichia coli strain RM9088 plasmid p2RM9088, complete sequence	86529	711	14481	86529	transposase	Stx2-converting_phage(46.15%)	18	NA	NA
WP_042967003.1|711_1395_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	2.1e-28
WP_077781756.1|1778_2681_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_072034666.1|2718_2988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042967000.1|3098_3347_+	DinI-like family protein	NA	A0A1S6L014	Salmonella_phage	38.5	6.6e-12
WP_042966998.1|3343_3781_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.1	6.4e-26
WP_148050549.1|3780_5052_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.7	1.6e-141
WP_000587689.1|5247_5874_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_005015281.1|5993_6173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137561226.1|6226_6340_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001339397.1|6316_6994_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|6993_7341_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|7360_8932_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000102288.1|9623_10553_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	27.0	1.2e-05
WP_137486450.1|11402_11657_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.5e-06
WP_148050550.1|11735_11945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|11865_13437_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|13456_13804_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|13803_14481_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
