The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041927	Klebsiella pneumoniae strain 18-2374 chromosome, complete genome	5253969	142217	209179	5253969	tRNA,head,protease,tail,terminase,integrase,portal,holin,capsid	Klebsiella_phage(50.0%)	84	164948:164971	206207:206230
WP_009307375.1|142217_143030_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002913227.1|143029_144043_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_009307374.1|144106_145243_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_023282884.1|145353_146331_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004149211.1|146417_147593_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|147802_149023_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_023301691.1|149181_151170_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|151231_151513_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002913339.1|151544_152093_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|152092_152902_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_004174960.1|152901_153726_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_023287874.1|153728_154814_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	7.7e-89
WP_040181913.1|154855_155788_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|155955_156507_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913355.1|156527_157013_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_004174952.1|157222_159367_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913358.1|159366_160677_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002913359.1|160836_161121_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_004149222.1|161488_162817_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|162878_163640_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149224.1|163929_164859_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
164948:164971	attL	TGTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
WP_109027944.1|165065_165437_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.7	8.3e-27
WP_109027943.1|165393_165633_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	54.4	2.2e-20
WP_101998377.1|166006_166474_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	42.6	2.0e-22
WP_080925616.1|166482_166863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109027942.1|167113_167914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109027941.1|169963_173032_-	kinase	NA	A0A286S259	Klebsiella_phage	66.2	0.0e+00
WP_029497207.1|173028_173415_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
WP_064159804.1|173422_173905_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.7	1.7e-56
WP_001018848.1|173891_174371_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	78.6	1.9e-76
WP_070991631.1|174370_176797_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	83.5	0.0e+00
WP_077270814.1|176858_177290_-	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	94.3	2.2e-63
WP_001333686.1|177286_177550_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
WP_065806535.1|177582_177936_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	98.3	1.1e-60
WP_000115125.1|177979_178471_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_000561415.1|178526_178892_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_004216814.1|178888_179428_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_070991632.1|179420_179753_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	9.0e-57
WP_004143899.1|179754_179952_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_017880223.1|180012_180339_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_044067369.1|180286_180529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070991633.1|180565_181729_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.5	1.3e-211
WP_077270815.1|181740_182421_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	3.5e-124
WP_070991634.1|182426_183704_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.5	1.8e-246
WP_004143904.1|183706_185239_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143905.1|185248_185683_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_017880219.1|185804_186014_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	100.0	7.0e-31
WP_077270817.1|186026_186317_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	3.8e-51
WP_023339166.1|186388_186874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065519868.1|186992_187238_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	93.8	8.7e-33
WP_031592520.1|187304_187694_-	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	48.4	8.7e-27
WP_031592522.1|187778_188267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049026356.1|188337_188535_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	83.6	1.1e-22
WP_070991637.1|188485_188761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070991639.1|188763_189393_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	73.9	8.7e-85
WP_000243811.1|189392_189674_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_001294159.1|189660_190047_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_001018764.1|190212_190452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070991641.1|190602_191181_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	4.9e-50
WP_070991643.1|191177_191819_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.0	1.9e-82
WP_050484678.1|191815_192460_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_109027976.1|192429_193401_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	61.6	1.7e-108
WP_070991647.1|193397_194927_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	8.6e-203
WP_070991649.1|194919_195195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025711394.1|195356_195635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029497186.1|195673_196189_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	63.4	1.5e-58
WP_109027975.1|196211_196427_-	cell division protein	NA	NA	NA	NA	NA
WP_109027974.1|196527_197154_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	47.3	1.3e-43
WP_109027973.1|197455_197815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109027972.1|197960_198485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104278.1|198842_199202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048267936.1|199245_200058_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_064188250.1|200139_201000_+	hypothetical protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	53.1	2.3e-72
WP_032426413.1|201189_201318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109027971.1|201314_201539_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.8	6.4e-14
WP_145981949.1|201561_202071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004864289.1|202070_202586_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_109027969.1|202582_203242_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	56.1	7.3e-50
WP_071986589.1|203177_203435_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.8	1.2e-13
WP_061891355.1|203475_204789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309602.1|204839_206012_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.0	4.7e-201
WP_004174945.1|206530_207013_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
206207:206230	attR	TGTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
WP_023301636.1|207379_208261_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004149227.1|208270_209179_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
>prophage 2
NZ_CP041927	Klebsiella pneumoniae strain 18-2374 chromosome, complete genome	5253969	2895360	2946744	5253969	tRNA,head,terminase,lysis,integrase	Cronobacter_phage(27.08%)	75	2898244:2898290	2947216:2947262
WP_004143010.1|2895360_2896746_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|2896791_2897004_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|2897005_2897872_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_071579666.1|2897910_2898234_+	hypothetical protein	NA	NA	NA	NA	NA
2898244:2898290	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_021441323.1|2898303_2899467_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_071531921.1|2899343_2899679_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040182114.1|2899680_2899899_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_040182113.1|2899895_2900423_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182112.1|2900451_2901075_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182110.1|2901071_2901818_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182107.1|2901834_2902119_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_019704100.1|2902208_2902403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024622729.1|2902830_2903034_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.0e-18
WP_032434120.1|2903082_2903628_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_032434121.1|2903618_2904335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178801.1|2904533_2904653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024622727.1|2904675_2905365_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_004178811.1|2905469_2905703_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_004139615.1|2905742_2905964_+	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_040181694.1|2906049_2906847_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	67.9	2.8e-88
WP_040181719.1|2906906_2907872_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	78.9	5.1e-60
WP_040181695.1|2907868_2908606_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	55.2	6.9e-65
WP_004218528.1|2908602_2908905_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040181698.1|2908901_2909324_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.9	1.5e-11
WP_048322083.1|2909320_2909584_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.3e-29
WP_048322084.1|2909576_2909774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322086.1|2910276_2910795_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	1.8e-91
WP_048322087.1|2911806_2912073_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	69.8	4.6e-27
WP_032432693.1|2912065_2912263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048322089.1|2912591_2912849_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	6.4e-26
WP_016530701.1|2913039_2913507_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	1.5e-33
WP_032431555.1|2913487_2913658_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_058842819.1|2913650_2914286_+	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.0	2.2e-80
WP_048322092.1|2914282_2914423_+	YlcG family protein	NA	NA	NA	NA	NA
WP_048322093.1|2914419_2915109_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.9e-56
WP_048322094.1|2915453_2915978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151282.1|2916405_2916654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146527.1|2916656_2917187_+	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
WP_058842818.1|2917183_2917651_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	71.6	1.0e-53
WP_058842820.1|2918224_2918683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842816.1|2919532_2920159_+	hypothetical protein	NA	I6S676	Salmonella_phage	84.9	8.4e-104
WP_048294303.1|2920189_2920657_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	73.8	1.5e-57
WP_048294304.1|2920640_2921939_+|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	94.3	3.0e-241
WP_058842815.1|2921951_2923415_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	4.0e-149
WP_064148479.1|2923347_2924361_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.5	1.5e-110
WP_049185996.1|2924460_2924811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040186437.1|2924883_2926269_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.7	1.5e-153
WP_058842813.1|2926272_2926701_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	8.1e-42
WP_004191540.1|2926712_2927807_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	2.2e-123
WP_058842812.1|2927817_2928093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058842811.1|2928095_2928476_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.8e-29
WP_038434988.1|2928475_2928649_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_058842810.1|2928648_2929011_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	3.3e-20
WP_004151265.1|2929013_2929439_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_048294319.1|2929435_2929828_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	2.0e-34
WP_048294321.1|2929896_2930649_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	41.8	1.7e-42
WP_004178855.1|2930701_2931385_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.7	2.3e-75
WP_049182521.1|2931689_2931995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129312537.1|2931991_2932357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072061015.1|2932367_2932799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048294323.1|2932835_2933309_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.6	2.1e-14
WP_071599308.1|2933445_2933784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023328739.1|2933791_2934112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129693860.1|2934163_2934481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074160392.1|2934575_2934803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029884072.1|2934905_2935409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058842809.1|2935503_2938944_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	40.5	7.3e-133
WP_040181302.1|2938984_2939164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071854269.1|2939183_2939597_-	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_016531189.1|2939767_2940187_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
WP_004196571.1|2940186_2940657_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
WP_040181295.1|2940653_2941049_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_109027958.1|2941035_2943513_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	3.0e-197
WP_071854268.1|2945598_2946399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181289.1|2946504_2946744_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
2947216:2947262	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP041927	Klebsiella pneumoniae strain 18-2374 chromosome, complete genome	5253969	3428338	3437812	5253969	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|3428338_3429454_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|3429450_3431391_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|3431467_3431689_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3432014_3432332_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3432362_3434642_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3434772_3434991_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_023302126.1|3435344_3436046_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_023302125.1|3436090_3437812_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 4
NZ_CP041927	Klebsiella pneumoniae strain 18-2374 chromosome, complete genome	5253969	3676830	3746446	5253969	tRNA,head,tail,terminase,integrase,portal,capsid,plate	Enterobacteria_phage(51.43%)	82	3704026:3704043	3741202:3741219
WP_004150803.1|3676830_3677937_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|3677993_3678452_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|3678468_3679119_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|3679359_3680610_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004213085.1|3680882_3681596_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|3681592_3681985_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|3681977_3682301_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_048263900.1|3682389_3682596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704434.1|3682543_3682729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|3682749_3682977_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|3683089_3684283_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_137013050.1|3684498_3684687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|3684906_3685092_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|3685182_3685677_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|3685703_3686210_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|3686226_3687114_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|3687169_3688576_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004183659.1|3688572_3689583_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|3689698_3689896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3690462_3691095_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_032409986.1|3691134_3691314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3691711_3692398_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_023302066.1|3692708_3694217_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_021313530.1|3694337_3695228_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023302065.1|3695234_3697019_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|3697092_3698301_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|3698603_3699647_+	type II asparaginase	NA	NA	NA	NA	NA
WP_023302064.1|3700308_3701223_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|3701312_3701951_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|3702081_3702345_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|3702404_3702530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892898.1|3702647_3702722_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|3702721_3702823_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|3702880_3703894_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3704026:3704043	attL	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_040181453.1|3704158_3705142_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
WP_004213095.1|3705257_3705557_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_020806130.1|3705677_3705956_+	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004216643.1|3705976_3706195_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_040181449.1|3706210_3706588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023329526.1|3706603_3706876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213098.1|3706944_3707169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023329528.1|3707165_3707732_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
WP_046623557.1|3707740_3707968_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	2.5e-05
WP_040181444.1|3707964_3708921_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
WP_109027967.1|3711810_3714081_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_040181440.1|3714080_3714872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048289843.1|3715716_3716778_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
WP_040181438.1|3716771_3718499_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
WP_040181436.1|3718655_3719495_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_023328071.1|3719504_3720539_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_040181433.1|3720588_3721446_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
WP_040181431.1|3721558_3722074_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
WP_004131559.1|3722073_3722274_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_004213110.1|3722264_3722549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339943.1|3722545_3723091_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_031593580.1|3723102_3723432_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_040181428.1|3723613_3724081_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_020316957.1|3724077_3724713_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_009486481.1|3724709_3725297_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_040181426.1|3725293_3725644_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
WP_023300878.1|3725645_3726569_+	hypothetical protein	NA	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040181424.1|3726558_3729585_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023339950.1|3729581_3729794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181419.1|3729793_3730891_+|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_052450975.1|3731490_3732714_+	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_040181417.1|3732731_3733394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181415.1|3733857_3734331_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
WP_040181412.1|3734346_3737322_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
WP_075604421.1|3737308_3737467_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_004131585.1|3737466_3737784_-	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_004216461.1|3737829_3738345_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_040181409.1|3738344_3739517_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
WP_040181406.1|3739671_3740811_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
WP_004213128.1|3740854_3741106_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_004176548.1|3741370_3741610_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3741202:3741219	attR	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_004150779.1|3741599_3741956_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_020802835.1|3741942_3742452_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|3742597_3743290_+	CTP synthase	NA	NA	NA	NA	NA
WP_004148041.1|3743321_3744506_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002901073.1|3744607_3745399_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|3745382_3745829_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004892876.1|3745945_3746446_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP041927	Klebsiella pneumoniae strain 18-2374 chromosome, complete genome	5253969	4126884	4137772	5253969		Escherichia_phage(87.5%)	10	NA	NA
WP_002210516.1|4126884_4127505_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_032423485.1|4127497_4128763_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_109027984.1|4128774_4129677_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	5.9e-159
WP_023148136.1|4129714_4129948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210513.1|4129938_4130700_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|4130720_4131581_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|4131878_4132139_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_040182017.1|4132225_4133314_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176258.1|4133344_4134610_-	MFS transporter	NA	NA	NA	NA	NA
WP_040182019.1|4134664_4137772_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 6
NZ_CP041927	Klebsiella pneumoniae strain 18-2374 chromosome, complete genome	5253969	4795218	4880459	5253969	tRNA,head,tail,terminase,lysis,integrase,transposase,plate	Salmonella_phage(26.15%)	102	4844240:4844257	4882272:4882289
WP_148053328.1|4795218_4796265_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.2	3.5e-06
WP_004891138.1|4796542_4797391_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002910403.1|4797390_4798473_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
WP_004891136.1|4798515_4799772_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|4800042_4800654_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004891134.1|4800650_4801502_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|4801685_4802633_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004189412.1|4802757_4804437_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_023301802.1|4804438_4805485_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|4805705_4805981_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_009307591.1|4806253_4806838_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|4806955_4808047_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_004145442.1|4808127_4808457_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|4808540_4809455_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048289900.1|4809586_4811002_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|4811021_4811465_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_019704158.1|4811467_4812010_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002910494.1|4811984_4813031_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_040181246.1|4813030_4814794_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_029498250.1|4814927_4817894_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_040181245.1|4818358_4819570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029499423.1|4819574_4819832_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032413757.1|4819857_4820265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123618886.1|4820757_4821393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342696.1|4821668_4823696_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	2.6e-74
WP_009307584.1|4823698_4826326_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	2.3e-17
WP_009307583.1|4826784_4828482_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004175498.1|4828485_4829139_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009307582.1|4829135_4830476_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004156898.1|4830523_4830703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910650.1|4831041_4831371_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899028.1|4831440_4832025_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|4832050_4832749_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_048289904.1|4832940_4833423_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_074422971.1|4834397_4834604_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.2	1.9e-09
WP_040181289.1|4834713_4834953_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
WP_074422970.1|4835058_4835859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065802545.1|4835868_4837899_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	27.3	1.2e-23
WP_004152577.1|4837955_4838153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065802524.1|4838152_4839019_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.4	1.4e-32
WP_065802522.1|4839018_4839792_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.8	5.7e-78
WP_065802521.1|4839788_4840985_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	74.6	2.9e-161
WP_048289810.1|4840984_4841338_-	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.6	3.0e-50
WP_065802519.1|4841334_4841991_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	64.0	6.5e-83
WP_127429055.1|4842319_4843045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065802515.1|4843049_4844117_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	67.8	2.7e-134
WP_065802513.1|4844119_4844422_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.1	2.8e-25
4844240:4844257	attL	CGCCAGCAGGTCGGCGCC	NA	NA	NA	NA
WP_065802512.1|4844422_4844998_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	71.2	1.7e-66
WP_109027950.1|4844997_4846995_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	62.1	4.0e-232
WP_065802507.1|4846984_4847137_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	76.0	1.0e-15
WP_065802505.1|4847178_4847598_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	66.7	3.0e-41
WP_023312781.1|4847601_4848045_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_065802503.1|4848054_4849200_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.7	1.3e-166
WP_004152176.1|4849203_4849644_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_065519890.1|4849738_4850125_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	75.8	5.8e-47
WP_064151821.1|4850124_4850739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065802501.1|4850735_4851155_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	4.4e-40
WP_040181209.1|4851123_4851405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065802499.1|4851444_4852386_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	2.3e-137
WP_040181205.1|4852397_4852892_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.5	2.1e-49
WP_040181203.1|4852895_4854098_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	5.3e-107
WP_025714258.1|4854107_4854302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714257.1|4854347_4854896_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_039108763.1|4854951_4856403_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
WP_040181195.1|4856640_4858041_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
WP_065802497.1|4857991_4858768_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	2.4e-12
WP_109027951.1|4858976_4859444_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	72.9	2.8e-56
WP_040181191.1|4859440_4859944_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_012967717.1|4859946_4860261_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
WP_040181186.1|4861087_4861897_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.1	1.9e-116
WP_040181184.1|4861893_4862034_-	YlcG family protein	NA	NA	NA	NA	NA
WP_065802495.1|4862030_4862669_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	3.2e-74
WP_049089532.1|4862661_4862832_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	3.7e-14
WP_064151812.1|4862837_4863434_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.7e-56
WP_039108781.1|4863591_4863840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087750241.1|4863839_4864253_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	34.6	1.1e-11
WP_004141386.1|4864881_4865094_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_040181701.1|4865625_4865886_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_109027952.1|4865882_4866299_-	hypothetical protein	NA	A0A220NRQ7	Escherichia_phage	62.0	2.2e-15
WP_109027953.1|4866295_4866520_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	53.4	9.2e-13
WP_109027954.1|4866516_4866810_-	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.1e-25
WP_109027955.1|4866806_4867655_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	7.1e-90
WP_109027956.1|4867651_4868512_-	replication protein	NA	K7PGT1	Enterobacteria_phage	50.5	2.1e-60
WP_004141720.1|4868842_4869163_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_023284762.1|4869212_4869428_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	4.2e-15
WP_029602664.1|4869527_4870160_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.0	1.2e-33
WP_008807814.1|4870783_4870990_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_040181687.1|4871070_4871355_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
WP_040181685.1|4871370_4872216_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_129693859.1|4872212_4872833_+	hypothetical protein	NA	A0A076GAP8	Staphylococcus_phage	43.8	5.5e-23
WP_040181683.1|4872825_4873512_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
WP_016529279.1|4873508_4873667_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_024264482.1|4873663_4874191_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
WP_040181679.1|4874187_4874958_+	hypothetical protein	NA	D5LH17	Escherichia_phage	51.0	3.2e-65
WP_065802489.1|4875174_4875939_+	hypothetical protein	NA	Q71T76	Escherichia_phage	58.3	3.0e-71
WP_040218332.1|4875935_4876127_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	64.4	1.3e-12
WP_032431536.1|4876123_4876333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483816.1|4876329_4876548_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
WP_040181674.1|4876551_4876797_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
WP_021312745.1|4876839_4878102_+|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
WP_032413763.1|4878342_4879149_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175494.1|4879163_4880459_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
4882272:4882289	attR	CGCCAGCAGGTCGGCGCC	NA	NA	NA	NA
>prophage 7
NZ_CP041927	Klebsiella pneumoniae strain 18-2374 chromosome, complete genome	5253969	5032778	5076745	5253969	head,protease,tail,terminase,integrase,transposase,portal,holin,capsid	Klebsiella_phage(47.17%)	62	5037717:5037776	5076856:5076920
WP_040181715.1|5032778_5033273_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	2.8e-30
WP_009484430.1|5033253_5034687_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
WP_009307518.1|5034730_5035438_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.3	3.7e-07
WP_004151461.1|5035480_5035762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004148893.1|5035642_5035909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911596.1|5036300_5037446_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
5037717:5037776	attL	AGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAG	NA	NA	NA	NA
WP_074376103.1|5038051_5038423_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	9.2e-26
WP_064172351.1|5038379_5038601_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	50.6	2.1e-17
WP_000343760.1|5038661_5039882_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001333465.1|5040584_5041007_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
WP_074177881.1|5041084_5041267_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	88.9	1.5e-18
WP_040181868.1|5041278_5042079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842797.1|5044124_5047184_-	kinase	NA	A0A286S259	Klebsiella_phage	91.0	0.0e+00
WP_017880229.1|5047180_5047561_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_032412796.1|5047570_5048053_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.9	1.6e-83
WP_004899614.1|5048039_5048519_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_058842798.1|5048518_5051065_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.6	0.0e+00
WP_058842799.1|5051126_5051504_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004899621.1|5051567_5051831_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	90.8	7.9e-40
WP_004899623.1|5051833_5052217_-	hypothetical protein	NA	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_000115125.1|5052260_5052752_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_000561415.1|5052808_5053174_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000763233.1|5053170_5053710_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	100.0	1.0e-94
WP_004184710.1|5053702_5054035_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_004143899.1|5054036_5054234_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_017880223.1|5054294_5054621_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_044067369.1|5054568_5054811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842800.1|5054847_5056011_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	100.0	3.1e-213
WP_077254200.1|5056022_5056703_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	6.0e-124
WP_017880221.1|5056708_5057986_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_004143904.1|5057988_5059521_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143905.1|5059530_5059965_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_017880219.1|5060086_5060296_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	100.0	7.0e-31
WP_017880218.1|5060308_5060599_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	99.0	1.4e-53
WP_023301206.1|5060670_5060877_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	5.1e-34
WP_004216876.1|5060948_5061194_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_032426434.1|5061258_5061459_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	65.1	7.9e-16
WP_032420712.1|5061490_5061682_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	88.1	3.2e-22
WP_020317342.1|5061632_5061908_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.8	1.4e-15
WP_058842802.1|5061915_5062545_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	1.7e-104
WP_019705280.1|5062544_5062826_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|5062812_5063208_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_032416155.1|5063770_5064217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031281242.1|5064122_5064380_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
WP_004899672.1|5064692_5065271_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_058842803.1|5065284_5066265_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	2.4e-134
WP_000779146.1|5066277_5066655_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_049026353.1|5066664_5067474_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	1.0e-109
WP_058842804.1|5067470_5068385_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_004213338.1|5068789_5069251_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001191665.1|5069285_5069528_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_023317570.1|5069625_5070321_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
WP_101516289.1|5071114_5072032_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.2	2.6e-45
WP_065954001.1|5072121_5072421_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	5.5e-13
WP_101516288.1|5072420_5073206_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	3.8e-61
WP_101516287.1|5073333_5073795_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.5	4.0e-10
WP_101516286.1|5073791_5073998_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	98.5	2.1e-32
WP_101516285.1|5073994_5074471_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	50.0	3.8e-16
WP_142368272.1|5075012_5075216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101516283.1|5075212_5075491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408630.1|5075523_5075751_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	2.4e-29
WP_101516282.1|5075752_5076745_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	8.4e-175
5076856:5076920	attR	AGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACCGG	NA	NA	NA	NA
>prophage 8
NZ_CP041927	Klebsiella pneumoniae strain 18-2374 chromosome, complete genome	5253969	5190385	5197290	5253969	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|5190385_5191864_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|5191860_5192583_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|5192901_5194263_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|5194508_5195402_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|5195642_5196416_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|5196426_5197290_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 1
NZ_CP041928	Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence	202623	13276	51631	202623	transposase,protease	Escherichia_phage(50.0%)	35	NA	NA
WP_000616807.1|13276_13930_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|14022_14280_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|14212_14614_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|14750_17648_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001067855.1|17917_18622_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|18743_19649_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|19645_20884_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|20883_21468_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336397.1|21413_21770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|21960_22725_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|22905_23610_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|23753_24308_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|24438_25269_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|25900_26605_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000239590.1|26807_27683_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|27729_28062_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|30383_31088_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386147.1|31943_32771_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	9.0e-21
WP_004152695.1|32767_33631_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|33639_34467_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|34475_35486_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|35479_36349_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004159231.1|37054_37381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386148.1|37557_38538_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
WP_004118209.1|39739_40003_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|40017_40281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|40524_40806_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|40840_41410_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|41524_44320_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|44319_44517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|44754_45504_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|45490_46453_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|48295_49642_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032422684.1|49837_50236_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_077255522.1|50284_51631_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP041929	Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374B, complete sequence	110643	0	107611	110643	tail,terminase,portal,integrase	Salmonella_phage(87.38%)	120	23320:23338	104652:104670
WP_070611328.1|457_901_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	2.0e-59
WP_023343104.1|1140_1521_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	64.3	1.0e-43
WP_014342082.1|1532_1832_+	lipoprotein	NA	NA	NA	NA	NA
WP_064164595.1|1987_2419_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.4e-65
WP_070611325.1|2538_3546_+	regulator	NA	J9Q7Z3	Salmonella_phage	88.6	7.0e-145
WP_070611323.1|3606_4551_+	exonuclease	NA	J9Q7S6	Salmonella_phage	92.4	5.4e-171
WP_070611321.1|4550_4817_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	83.0	1.1e-33
WP_070611318.1|4819_5893_+	recombinase	NA	J9Q736	Salmonella_phage	95.4	6.3e-192
WP_032440514.1|7277_7457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440513.1|7453_7789_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	8.0e-37
WP_032734156.1|7788_8001_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	78.6	4.7e-27
WP_032423053.1|8431_9529_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.2e-73
WP_100091244.1|9540_9753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021313778.1|9857_10502_+	hypothetical protein	NA	J9Q739	Salmonella_phage	81.1	3.7e-99
WP_070611316.1|11016_12477_+	hypothetical protein	NA	A0A2I6UHU5	Bacillus_phage	33.2	6.6e-59
WP_070611314.1|12507_13374_-	hypothetical protein	NA	A0A2I6UHT9	Bacillus_phage	55.8	1.1e-05
WP_073579045.1|13370_13583_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032734160.1|14008_15094_+	exonuclease	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
WP_072201193.1|15093_15327_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
WP_019704556.1|15323_17240_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.8	3.3e-300
WP_032734162.1|17229_17976_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	1.6e-77
WP_032443574.1|17985_18555_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.4e-94
WP_064146281.1|18630_20934_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
WP_014342181.1|21064_22207_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_014342180.1|22283_23159_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
23320:23338	attL	TAGGTATGTACTTACTTAT	NA	NA	NA	NA
WP_014342179.1|23352_24456_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_019704560.1|24457_24871_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	2.3e-54
WP_040203768.1|24867_25344_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	2.4e-71
WP_040223254.1|25343_25988_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.1	5.2e-93
WP_023279504.1|26051_26471_+	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_014342174.1|26480_27038_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_040223256.1|27163_27997_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	57.1	1.0e-64
WP_039817730.1|28181_28775_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	84.8	1.3e-98
WP_040203299.1|28972_29215_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.8e-31
WP_148053330.1|29779_30367_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	79.7	1.3e-90
WP_060877018.1|30798_31077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072042572.1|31073_31262_+	hypothetical protein	NA	J9Q800	Salmonella_phage	50.8	2.2e-07
WP_019704567.1|31363_31789_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_014342167.1|31788_31944_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_040203292.1|32071_32650_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	3.0e-55
WP_070611311.1|32778_34464_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	90.9	0.0e+00
WP_095889379.1|34525_35254_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	69.4	6.1e-82
WP_064146275.1|35405_35669_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	3.7e-29
WP_148053331.1|35854_36820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060527990.1|37243_37561_+	hypothetical protein	NA	J9Q750	Salmonella_phage	75.2	4.1e-43
WP_064146271.1|37573_37768_+	hypothetical protein	NA	J9Q6K5	Salmonella_phage	66.7	1.1e-17
WP_142917803.1|38241_38499_-	hypothetical protein	NA	J9Q7T6	Salmonella_phage	70.0	3.6e-13
WP_117616653.1|39041_39302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704577.1|39317_39536_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
WP_023279445.1|39548_39761_+	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
WP_029463947.1|39897_40209_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	67.0	8.8e-30
WP_032439731.1|40328_40736_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	45.0	2.1e-23
WP_070611307.1|40862_41144_+	ABC transporter	NA	J9Q753	Salmonella_phage	82.8	2.6e-41
WP_064164532.1|41348_41831_+	hypothetical protein	NA	J9Q805	Salmonella_phage	71.2	2.6e-65
WP_004109904.1|42422_42626_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_004109892.1|42676_43327_-	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_123609186.1|43651_43951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004109890.1|43960_44491_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	85.1	9.3e-72
WP_019704582.1|44646_45084_+	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_148053332.1|45134_45410_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	67.0	1.2e-25
WP_032423021.1|45412_46972_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.5e-279
WP_021313132.1|47055_47736_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
WP_023279438.1|47735_48404_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
WP_032423019.1|48400_49042_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	96.7	6.8e-109
WP_004109875.1|49031_49583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046882063.1|49579_50470_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	96.6	1.6e-164
WP_070611305.1|50479_50746_+	hypothetical protein	NA	J9Q757	Salmonella_phage	89.8	2.9e-37
WP_004109866.1|50921_51563_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_148053333.1|51565_52822_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.1	1.0e-246
WP_141751811.1|52839_54429_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.5	1.1e-274
WP_023279435.1|54451_55351_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_004109857.1|55377_56256_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_070611363.1|56334_56763_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	70.6	5.1e-28
WP_021313129.1|56810_57245_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_148053334.1|57244_58078_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.0	1.1e-130
WP_004109848.1|58175_58520_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_021313126.1|58510_58984_+	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_047066294.1|58985_59378_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	68.3	2.0e-47
WP_070611361.1|59445_60192_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	82.6	8.1e-106
WP_004109835.1|60253_60571_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109830.1|60687_60921_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_148053335.1|60928_65458_+	tape measure protein	NA	J9Q712	Salmonella_phage	70.0	0.0e+00
WP_040203230.1|65501_65837_+|tail	tail protein	tail	J9Q6E1	Salmonella_phage	85.5	8.8e-52
WP_004109820.1|65923_66622_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109817.1|66614_67412_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_019704527.1|67399_68011_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_070611357.1|68027_80162_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	60.7	3.1e-29
WP_070611355.1|80284_81730_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	1.0e-40
WP_004109805.1|81820_82144_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_148053336.1|82157_82850_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.6	1.6e-119
WP_148053337.1|82852_83104_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	71.1	1.7e-23
WP_032734133.1|83520_83913_+	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	42.2	1.0e-14
WP_148053338.1|83897_84647_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.3	2.7e-16
WP_060877001.1|84831_85497_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_004110193.1|85496_85859_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
WP_148053339.1|85902_87615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114441307.1|87792_88518_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	1.6e-127
WP_070611344.1|88582_89923_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.7	3.5e-240
WP_070611343.1|90075_91194_+	DNA primase	NA	J9Q720	Salmonella_phage	91.6	8.2e-203
WP_064164509.1|91236_92403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070611341.1|92691_93480_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.8	2.6e-70
WP_050484095.1|93555_94023_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	3.4e-49
WP_070611339.1|94022_95345_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	85.2	6.3e-226
WP_052951220.1|95341_95521_+	hypothetical protein	NA	J9Q729	Salmonella_phage	74.5	4.6e-15
WP_023279477.1|95504_95720_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	8.5e-24
WP_087636937.1|95716_95869_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	84.0	7.1e-17
WP_047066207.1|95865_96165_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	65.6	6.7e-27
WP_117616652.1|97217_97319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064164506.1|97430_98243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095889374.1|98393_99170_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.1	2.2e-90
WP_070611336.1|99179_99566_+	hypothetical protein	NA	Q716B1	Shigella_phage	72.0	8.3e-46
WP_032440523.1|99562_99808_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	9.1e-14
WP_070611331.1|99902_100520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070611330.1|100529_100940_+	toxin YafO	NA	NA	NA	NA	NA
WP_021313793.1|101004_101364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439777.1|101712_102813_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	9.4e-18
WP_014342091.1|102807_103188_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014342089.1|103790_106076_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	66.1	8.0e-245
104652:104670	attR	ATAAGTAAGTACATACCTA	NA	NA	NA	NA
WP_049594364.1|106172_107405_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
WP_071556245.1|107407_107611_+	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	7.2e-25
>prophage 1
NZ_CP041930	Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence	86019	24948	65116	86019	transposase	Escherichia_phage(15.0%)	44	NA	NA
WP_001067858.1|24948_25653_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|26703_27408_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_017480460.1|27718_27913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015056392.1|27873_29403_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004201176.1|29591_31232_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_004201172.1|31287_31578_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201171.1|31771_32101_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201169.1|32105_33137_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201168.1|33147_33786_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201167.1|33790_34156_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_063860861.1|34159_34972_-	subclass B1 metallo-beta-lactamase NDM-4	NA	NA	NA	NA	NA
WP_001067834.1|35250_35955_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_001235713.1|37438_37996_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|38178_39039_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|39208_39964_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_014342204.1|40044_40593_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_076611394.1|40708_41911_+|transposase	ISL3-like element ISAeme19 family transposase	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
WP_099147893.1|41925_42318_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.5e-22
WP_058655923.1|42310_42706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040219234.1|43312_44263_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	5.0e-76
WP_040219232.1|44409_44610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652286.1|44663_45296_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_058655909.1|46311_46791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126530401.1|46903_47785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072201938.1|47966_48866_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	28.7	2.9e-17
WP_072201939.1|49324_50281_-	Abi family protein	NA	A0A059NT88	Lactococcus_phage	21.4	3.5e-08
WP_072201940.1|50608_50947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525581.1|51352_52219_+	ParA family protein	NA	NA	NA	NA	NA
WP_058655912.1|52218_53250_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	25.7	1.8e-07
WP_000843283.1|53249_53687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058655913.1|53746_53962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058655914.1|54056_55430_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_058655915.1|55478_56753_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.6e-155
WP_058655916.1|56752_57175_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.8	1.2e-29
WP_000343760.1|57273_58494_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_058655917.1|58678_59350_-	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	2.8e-81
WP_058655918.1|59699_60383_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	8.7e-30
WP_047359680.1|60379_60604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058655919.1|60652_61069_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_058655920.1|61479_61986_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	31.7	8.2e-09
WP_058655921.1|62115_62379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098945567.1|62685_62853_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_059446943.1|62806_63037_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_058672090.1|63106_65116_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	2.1e-23
