The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042942	Escherichia fergusonii strain ATCC 35473 chromosome, complete genome	4657720	153272	245966	4657720	plate,lysis,portal,capsid,integrase,transposase,holin,tail,terminase,protease,head	Enterobacteria_phage(33.04%)	130	173164:173179	252113:252128
WP_148047506.1|153272_154441_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.4	4.3e-170
WP_000749408.1|155117_155549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001349760.1|155909_156242_-	protein flxA	NA	NA	NA	NA	NA
WP_021574462.1|157097_158987_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|159240_159732_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089534.1|159734_160178_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	49.7	3.6e-37
WP_001030518.1|160149_160752_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.0	5.6e-97
WP_148047507.1|160751_161537_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	68.5	1.8e-58
WP_000383549.1|161540_162125_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.8e-113
WP_000785342.1|162115_163174_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	3.1e-199
WP_001568582.1|163160_163586_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_001259082.1|163585_164134_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	1.5e-96
WP_000999503.1|164133_165213_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
WP_148047508.1|165209_166538_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	1.2e-245
WP_000679479.1|166599_167130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085454964.1|167221_169054_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	97.9	8.2e-301
WP_001314907.1|169046_169229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661051.1|169195_169465_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|169464_169821_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_032178267.1|169820_171317_-|tail	tail sheath protein	tail	U5P0H3	Shigella_phage	99.2	8.8e-277
WP_000497751.1|171300_171471_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_053273556.1|171479_172040_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	4.0e-105
WP_000224835.1|172036_172543_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000702401.1|172517_172928_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000927711.1|172924_173248_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
173164:173179	attL	CCAGCAGTTGCAGATG	NA	NA	NA	NA
WP_000601365.1|173250_173451_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000257490.1|173499_174705_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	100.0	8.2e-225
WP_001193631.1|174719_175370_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_072679140.1|175347_176589_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|176588_176771_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_148048688.1|176782_178279_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	3.7e-299
WP_000929175.1|178512_179007_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_001135203.1|179132_179483_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	1.4e-63
WP_000651450.1|179575_179896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116298533.1|179988_180258_-	hypothetical protein	NA	Q8SBD8	Shigella_phage	73.3	2.4e-28
WP_001476996.1|180142_180535_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	91.4	7.4e-58
WP_001075798.1|180531_181146_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	99.0	1.4e-111
WP_000422366.1|181145_181427_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|181413_181800_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_148047509.1|181890_182487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609696.1|182593_183172_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	1.6e-45
WP_148047510.1|183186_184176_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.4e-193
WP_023145982.1|184183_184993_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	5.3e-151
WP_000767113.1|185012_185402_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210156.1|185398_185725_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_148047511.1|185724_186219_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	2.5e-87
WP_148047512.1|186215_187034_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.1	1.4e-122
WP_024182890.1|187030_187255_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	1.2e-36
WP_121335603.1|187259_188096_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.3	8.4e-152
WP_000515845.1|188092_188644_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_000649477.1|188687_188888_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|188978_189653_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000549626.1|189887_190094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|190065_190500_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_087601721.1|190418_190712_-	hypothetical protein	NA	U5P0J5	Shigella_phage	97.9	1.2e-49
WP_000135682.1|190968_191331_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|191396_192221_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|192348_192885_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|192875_193238_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|193237_193543_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077873866.1|193458_193893_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_148047513.1|193769_194933_+|integrase	tyrosine-type recombinase/integrase	integrase	U5P434	Shigella_phage	99.7	1.5e-228
WP_002432462.1|195434_196019_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.8	1.2e-101
WP_000609073.1|196027_196930_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	66.1	1.1e-96
WP_148047514.1|196926_199620_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	57.5	2.1e-55
WP_001233184.1|199684_200284_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	88.9	1.6e-99
WP_125282553.1|200195_200420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148047515.1|200351_203840_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	87.8	0.0e+00
WP_000090847.1|203900_204503_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_000194781.1|204439_205183_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_001152612.1|205188_205887_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|205886_206216_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_148047516.1|206212_208792_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.7	0.0e+00
WP_129942063.1|208784_209219_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.8e-64
WP_129942062.1|209200_209623_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	3.1e-70
WP_148047517.1|209638_210379_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.4e-129
WP_000683145.1|210386_210782_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_129942060.1|210778_211357_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000752972.1|211368_211722_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	98.3	1.7e-61
WP_000158924.1|211733_212132_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.2e-57
WP_000063221.1|212173_213199_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_001358225.1|213254_213587_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_148047518.1|213596_214916_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_021546024.1|214896_216498_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	7.2e-309
WP_000198149.1|216494_216701_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_019842488.1|216697_218623_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453587.1|218597_219143_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_032231044.1|219531_219765_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_148047519.1|219822_220233_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	74.8	1.8e-51
WP_071986113.1|220629_220821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072462.1|220853_221342_-	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	98.8	2.7e-86
WP_001082734.1|221551_222010_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	95.4	3.6e-72
WP_001135258.1|222006_222504_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839582.1|222503_222719_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001146305.1|222907_223639_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592546.1|223988_224948_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|225140_225665_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|225819_226197_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|226282_226423_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_021501029.1|226419_226782_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	2.1e-59
WP_000774476.1|226778_227069_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
WP_000224915.1|227061_227232_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_148047520.1|227231_227687_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	1.6e-59
WP_077759924.1|227683_227785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|227908_228310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|228288_228705_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_032172874.1|229004_229751_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	42.9	5.9e-40
WP_113706567.1|229740_229899_-	Arc family DNA-binding protein	NA	A0A077KAX5	Edwardsiella_phage	63.3	1.1e-09
WP_021550621.1|229998_230316_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	71.4	2.3e-17
WP_032180456.1|230360_230714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032172200.1|230793_231087_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	96.8	7.7e-44
WP_148047521.1|231083_231785_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	1.4e-128
WP_148048689.1|231781_232711_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	3.3e-112
WP_148047522.1|232797_233337_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	7.5e-61
WP_001067459.1|233406_233637_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_000858975.1|233741_234431_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|234553_235303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032176957.1|235299_236127_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|236635_236842_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|236918_237215_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|237220_238006_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186812.1|238002_238683_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000149533.1|238679_238838_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_148047523.1|238834_239899_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	65.1	2.0e-134
WP_000763364.1|240052_240271_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488407.1|240318_240597_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000023575.1|240889_242050_+|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	100.0	1.2e-228
WP_148047524.1|242254_243508_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.7	8.9e-97
WP_001285288.1|243519_244623_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_148047525.1|244910_245966_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
252113:252128	attR	CCAGCAGTTGCAGATG	NA	NA	NA	NA
>prophage 2
NZ_CP042942	Escherichia fergusonii strain ATCC 35473 chromosome, complete genome	4657720	1642402	1658724	4657720	plate,tail	Burkholderia_phage(38.89%)	22	NA	NA
WP_148047875.1|1642402_1643194_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.9	1.1e-47
WP_002431754.1|1643207_1643663_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	43.3	2.3e-26
WP_148047876.1|1643659_1644313_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	41.4	2.1e-17
WP_148047877.1|1644312_1645809_-|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	51.7	1.5e-50
WP_148047878.1|1645811_1646528_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
WP_148047879.1|1646520_1647636_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	2.6e-100
WP_001093498.1|1647626_1647986_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_104919838.1|1648084_1648786_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_148047880.1|1648795_1649836_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	6.7e-74
WP_001269712.1|1649823_1650033_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_046082822.1|1650032_1650986_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_148047881.1|1650985_1653361_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	28.3	2.0e-57
WP_015674804.1|1653461_1653590_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000658213.1|1653549_1653867_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907501.1|1653917_1654442_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	5.6e-69
WP_000729839.1|1654441_1655863_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.4	1.3e-192
WP_000875309.1|1655852_1656050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000404766.1|1656046_1656502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777271.1|1656619_1656934_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.2	7.1e-19
WP_000266449.1|1656946_1657552_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.6	7.4e-57
WP_000724378.1|1657554_1657842_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.0e-16
WP_000619863.1|1658379_1658724_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	47.6	6.3e-21
>prophage 3
NZ_CP042942	Escherichia fergusonii strain ATCC 35473 chromosome, complete genome	4657720	1955006	2029429	4657720	tRNA,portal,integrase,holin,tail,terminase,protease	Enterobacteria_phage(37.74%)	90	1952612:1952627	2034415:2034430
1952612:1952627	attL	CGCATAATCTGCCAGC	NA	NA	NA	NA
WP_001218281.1|1955006_1956230_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.0	9.5e-237
WP_001317460.1|1956490_1956823_-	protein flxA	NA	NA	NA	NA	NA
WP_071821821.1|1957025_1957301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024195021.1|1957306_1957501_-	hypothetical protein	NA	A5LH59	Enterobacteria_phage	95.3	2.2e-31
WP_000008231.1|1957535_1958072_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.3e-99
WP_000081304.1|1958200_1959025_-	YfdQ family protein	NA	U5P439	Shigella_phage	98.9	9.5e-148
WP_000135674.1|1959090_1959453_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.1e-60
WP_074468797.1|1959467_1959668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323606.1|1959821_1960100_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	3.0e-13
WP_001020632.1|1960155_1960848_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_001347307.1|1960821_1960974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148047947.1|1960945_1961206_+	helix-turn-helix domain-containing protein	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_000526668.1|1961198_1961756_+	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
WP_001250269.1|1961931_1962111_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104941.1|1962100_1963042_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_000210133.1|1963533_1963860_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	96.3	6.6e-52
WP_097518719.1|1963856_1964246_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.0e-67
WP_001061398.1|1964265_1965063_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	9.8e-150
WP_016230662.1|1965070_1966060_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_001047084.1|1966073_1966826_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_000087756.1|1967241_1967454_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|1967755_1967971_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|1968723_1968939_+|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189905.1|1968943_1969495_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.9e-35
WP_001306174.1|1969442_1969703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101174.1|1969816_1970350_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	3.2e-96
WP_001071778.1|1970346_1970844_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_148048713.1|1971207_1971420_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	2.1e-22
WP_071528545.1|1971430_1971619_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|1971766_1971922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024256583.1|1972094_1972268_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_148047948.1|1972563_1972770_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	77.9	1.7e-21
WP_032243018.1|1973054_1973333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349501.1|1973322_1973814_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	86.6	6.6e-72
WP_148047949.1|1973813_1975916_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.9	0.0e+00
WP_001072975.1|1975912_1976125_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_015953980.1|1976052_1977633_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_148047950.1|1977577_1979605_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|1979691_1980015_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1980007_1980283_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|1980294_1980873_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079398.1|1980869_1981271_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|1981282_1982026_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001300035.1|1982086_1982473_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|1982481_1982811_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_148047951.1|1982782_1985848_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|1985847_1986177_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152389.1|1986186_1986885_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	3.0e-134
WP_000140749.1|1986890_1987634_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	2.2e-151
WP_000741577.1|1987531_1988179_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.1e-111
WP_148047952.1|1988239_1991716_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	88.8	0.0e+00
WP_001233057.1|1991785_1992385_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	7.7e-107
WP_148047953.1|1992449_1995236_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	58.5	3.7e-58
WP_148047361.1|1995235_1995811_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	5.5e-102
WP_000086527.1|1995908_1996499_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836769.1|1996879_1997113_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|1997181_1997295_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|1997721_1997970_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|1998189_1999776_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_148047954.1|2000168_2000774_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|2000900_2001062_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_002431697.1|2001183_2002257_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563022.1|2002253_2003036_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_148047955.1|2003165_2004029_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_148047956.1|2004000_2005551_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|2005808_2006588_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477829.1|2006754_2008077_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	5.2e-79
WP_000816471.1|2008128_2009352_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224875.1|2009408_2010128_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566247.1|2010288_2010552_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148047957.1|2010583_2011600_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_148047958.1|2011627_2012272_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_148047959.1|2012377_2013346_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_148047960.1|2013394_2014777_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093812.1|2014797_2016030_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000513551.1|2016121_2016454_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000007436.1|2016455_2016740_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000046749.1|2016795_2018463_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_148047961.1|2018673_2020611_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	2.3e-11
WP_000068678.1|2020700_2021027_+	trp operon repressor	NA	NA	NA	NA	NA
WP_032183253.1|2021020_2021536_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000942353.1|2021587_2022235_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371663.1|2022231_2023101_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875492.1|2023311_2023785_+	protein CreA	NA	NA	NA	NA	NA
WP_001188059.1|2023797_2024487_+	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_148047962.1|2024486_2025911_+	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_148047963.1|2025968_2027327_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|2027392_2028109_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001541509.1|2028204_2028345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241206.1|2028742_2029429_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2034415:2034430	attR	CGCATAATCTGCCAGC	NA	NA	NA	NA
>prophage 4
NZ_CP042942	Escherichia fergusonii strain ATCC 35473 chromosome, complete genome	4657720	3148947	3194567	4657720	coat,protease,transposase	Bacillus_phage(33.33%)	50	NA	NA
WP_000156541.1|3148947_3150708_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877154.1|3150892_3151348_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_024256413.1|3151402_3152458_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288735.1|3152814_3153324_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000793790.1|3153540_3154170_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_046081537.1|3154132_3156286_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002431615.1|3156305_3156752_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_148048266.1|3156874_3158929_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_000424177.1|3158960_3159419_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_148048267.1|3159514_3160177_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002432078.1|3160346_3160763_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561985.1|3160809_3161127_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_148048268.1|3161184_3162375_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_104917561.1|3162469_3162748_+	acylphosphatase	NA	NA	NA	NA	NA
WP_148048269.1|3162744_3163074_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375129.1|3163164_3163824_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_148048270.1|3164410_3165166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148048271.1|3165475_3166594_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_104919634.1|3166590_3168384_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_148048272.1|3168402_3169110_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_148048273.1|3169106_3169694_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063963.1|3169690_3170089_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004888.1|3170085_3170940_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_001091689.1|3171033_3171699_+	YecA family protein	NA	NA	NA	NA	NA
WP_024256713.1|3171738_3172950_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_071985852.1|3172903_3173167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094892.1|3173144_3173384_+	YecH family protein	NA	NA	NA	NA	NA
WP_000909918.1|3173421_3173919_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_000706230.1|3174048_3174384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246690.1|3174529_3175033_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_148047332.1|3176255_3176558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148048274.1|3176793_3177312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148048275.1|3177663_3177978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148048276.1|3178140_3178710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148048719.1|3178888_3178969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148048277.1|3179122_3180259_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_046077441.1|3180643_3181633_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_148048720.1|3181727_3183242_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	1.1e-11
WP_000100214.1|3183256_3184243_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_148048278.1|3184395_3185199_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000089023.1|3185173_3186598_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000332011.1|3186604_3187033_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_002431607.1|3187850_3188201_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291584.1|3188203_3188782_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000905460.1|3188906_3189794_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000796096.1|3189790_3190705_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_072274242.1|3190709_3192665_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_001098482.1|3192681_3193176_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001038662.1|3193445_3194015_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032242962.1|3194093_3194567_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP042942	Escherichia fergusonii strain ATCC 35473 chromosome, complete genome	4657720	4024281	4062430	4657720	integrase,transposase,plate	uncultured_Caudovirales_phage(50.0%)	30	4024093:4024120	4067157:4067184
4024093:4024120	attL	GTTCGAGTCCAGTCAGAGGAGCCAAATT	NA	NA	NA	NA
WP_148048478.1|4024281_4024503_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	51.5	2.4e-13
WP_148048479.1|4025137_4025458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148048480.1|4025469_4025928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148048481.1|4026341_4026713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148048482.1|4026717_4027167_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_148048730.1|4027166_4027838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284965.1|4028090_4028570_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_148048483.1|4028587_4029946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148048731.1|4029956_4033388_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_148048484.1|4033496_4034936_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088869.1|4034932_4035676_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_148048485.1|4035672_4038399_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	4.6e-82
WP_148048732.1|4038395_4039172_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_125282645.1|4039209_4040565_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_123059606.1|4040567_4041071_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000829652.1|4041097_4042378_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_125400478.1|4042401_4043439_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_148048486.1|4043402_4045235_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_148048487.1|4045240_4045678_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_148048488.1|4045680_4047162_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002432281.1|4047176_4047776_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|4048368_4048887_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_148048489.1|4049096_4051043_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	39.4	5.4e-24
WP_148048490.1|4051064_4051484_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_148048491.1|4056059_4056764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148048492.1|4056807_4057617_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.7	4.8e-27
WP_148048493.1|4057792_4058800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148048494.1|4060167_4060611_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_148048733.1|4060607_4061093_+	phosphotriesterase	NA	NA	NA	NA	NA
WP_148048495.1|4061293_4062430_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
4067157:4067184	attR	AATTTGGCTCCTCTGACTGGACTCGAAC	NA	NA	NA	NA
>prophage 6
NZ_CP042942	Escherichia fergusonii strain ATCC 35473 chromosome, complete genome	4657720	4091366	4170512	4657720	lysis,portal,terminase,integrase,holin,tail,coat,head	Enterobacteria_phage(60.0%)	104	4142489:4142503	4171025:4171039
WP_148048519.1|4091366_4092641_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.7	8.2e-74
WP_001027998.1|4093013_4094450_-	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_000926369.1|4095031_4095610_+	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.1	3.4e-11
WP_001270146.1|4095632_4096451_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001217010.1|4096450_4096969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000280358.1|4097047_4097308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502008.1|4097488_4097767_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502010.1|4097784_4098069_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001206281.1|4098083_4098362_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000570990.1|4098415_4100002_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_000599365.1|4100028_4100286_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_148048520.1|4100301_4101456_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_105283566.1|4101482_4104869_+|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_148048521.1|4104920_4105868_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_148048522.1|4105879_4106353_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000564322.1|4106349_4106970_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_046083392.1|4106981_4107647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095888.1|4107679_4108081_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000481836.1|4108096_4108426_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000621210.1|4108492_4109419_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_046077397.1|4109645_4110116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148048523.1|4110629_4111547_-	regulatory protein PocR	NA	NA	NA	NA	NA
WP_024256672.1|4111741_4112533_-	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.0	1.9e-12
WP_015953494.1|4113036_4113321_+	propanediol utilization microcompartment protein PduA	NA	NA	NA	NA	NA
WP_000097503.1|4113317_4114127_+	propanediol utilization microcompartment protein PduB	NA	NA	NA	NA	NA
WP_001256900.1|4114145_4115810_+	propanediol dehydratase large subunit PduC	NA	NA	NA	NA	NA
WP_000405059.1|4115820_4116483_+	propanediol dehydratase medium subunit PduD	NA	NA	NA	NA	NA
WP_001090594.1|4116497_4117022_+	propanediol dehydratase small subunit PduE	NA	NA	NA	NA	NA
WP_001268868.1|4117032_4118865_+	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_148048524.1|4118854_4119205_+	propanediol dehydratase	NA	NA	NA	NA	NA
WP_001057752.1|4119224_4119500_+	propanediol utilization microcompartment protein PduJ	NA	NA	NA	NA	NA
WP_000814169.1|4119525_4119960_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000360798.1|4119959_4120592_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_148048525.1|4120588_4121080_+	microcompartment protein PduM	NA	NA	NA	NA	NA
WP_000549821.1|4121083_4121359_+	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
WP_046083396.1|4121369_4122377_+	two-domain cob(I)yrinic acid a,c-diamide adenosyltransferase PduO	NA	NA	NA	NA	NA
WP_148048526.1|4122373_4123756_+	CoA-acylating propionaldehyde dehydrogenase PduP	NA	NA	NA	NA	NA
WP_148048527.1|4123766_4124879_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_148048528.1|4124875_4126216_+	electron transport complex protein RnfC	NA	NA	NA	NA	NA
WP_000075780.1|4126218_4126773_+	propanediol utilization microcompartment protein PduT	NA	NA	NA	NA	NA
WP_024256479.1|4127126_4127573_+	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_104918485.1|4127562_4128777_+	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_000449651.1|4128884_4129220_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200864.1|4129387_4130446_-	FUSC family protein	NA	NA	NA	NA	NA
WP_148048529.1|4130552_4131020_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_071595392.1|4131386_4131518_-	umuD domain protein	NA	O64339	Escherichia_phage	66.7	4.7e-09
WP_148048530.1|4131840_4132203_+	GtrA family protein	NA	U5P0S6	Shigella_phage	91.7	9.2e-55
WP_148048531.1|4132199_4133129_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	92.7	4.2e-160
WP_148048532.1|4133115_4134765_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	33.3	4.5e-64
WP_148048533.1|4134794_4137218_-|tail	phage tail protein	tail	A0A088CQ58	Enterobacteria_phage	84.2	4.0e-61
WP_148048734.1|4137348_4139190_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	72.4	4.0e-239
WP_000246965.1|4139189_4140602_-	acyltransferase	NA	I6RSG0	Salmonella_phage	56.1	1.7e-128
WP_148048534.1|4140614_4141268_-	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	58.0	2.7e-57
WP_097507412.1|4141242_4141722_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	73.4	1.4e-63
WP_148048535.1|4141721_4142570_-	hypothetical protein	NA	Q716G6	Shigella_phage	92.2	2.9e-99
4142489:4142503	attL	AGAAGATATTGCGTG	NA	NA	NA	NA
WP_148048536.1|4142569_4143988_-	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	97.7	2.0e-270
WP_148048537.1|4143935_4144520_-	endodeoxyribonuclease	NA	A0A2H4FQU5	Salmonella_phage	99.0	7.3e-110
WP_104858431.1|4144670_4145132_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	99.3	7.8e-83
WP_001389518.1|4145112_4145301_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_000013272.1|4145342_4146596_-|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	100.0	2.6e-237
WP_148048538.1|4146614_4147508_-	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	97.6	1.7e-126
WP_112910358.1|4147598_4149797_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.4	0.0e+00
WP_000200766.1|4149798_4151214_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
WP_001436504.1|4151210_4151633_-	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_000205033.1|4151656_4151836_-	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	93.2	2.1e-23
WP_000139136.1|4151845_4152133_-	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.6e-06
WP_000807780.1|4152136_4152379_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	78.8	7.6e-29
WP_071986113.1|4152588_4152780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072462.1|4152812_4153301_-	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	98.8	2.7e-86
WP_001082734.1|4153510_4153969_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	95.4	3.6e-72
WP_000229390.1|4153965_4154442_-	glycoside hydrolase family protein	NA	G5DA94	Enterobacteria_phage	100.0	9.8e-89
WP_000783734.1|4154425_4154749_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001429278.1|4155237_4155456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001235461.1|4155822_4156446_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994516.1|4156442_4156631_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_021499322.1|4156627_4156990_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_148048539.1|4156986_4157277_-	DUF1364 family protein	NA	A0A192Y6R9	Salmonella_phage	99.0	1.3e-51
WP_148048540.1|4157276_4157999_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	95.0	4.2e-123
WP_000950943.1|4157991_4158168_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	98.3	2.5e-26
WP_000386643.1|4158160_4158502_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254255.1|4158504_4158681_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000736913.1|4158677_4159118_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000806596.1|4159191_4160568_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.3e-253
WP_148048541.1|4160564_4161386_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	98.9	1.7e-152
WP_001177653.1|4161568_4161847_-	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000620665.1|4161955_4162150_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000428318.1|4162256_4162973_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000233126.1|4162990_4163359_+	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	100.0	1.3e-56
WP_016063037.1|4163933_4164197_+	hypothetical protein	NA	K7PKE4	Enterobacteria_phage	100.0	1.7e-29
WP_000394299.1|4164487_4164739_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000333101.1|4164912_4165113_+	hypothetical protein	NA	A0A088CQ77	Enterobacteria_phage	100.0	2.8e-29
WP_000972063.1|4165298_4165433_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|4165417_4165570_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_097563402.1|4165826_4166432_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	99.5	1.2e-107
WP_069916078.1|4166431_4166815_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	99.2	6.5e-67
WP_001111299.1|4166838_4167135_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	3.9e-51
WP_001214443.1|4167145_4167310_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	100.0	1.1e-23
WP_148048542.1|4167306_4167867_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	69.9	1.2e-58
WP_071837016.1|4167863_4168097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148048543.1|4168083_4168614_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	76.8	3.8e-73
WP_032162000.1|4168606_4168891_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	2.7e-49
WP_001569079.1|4168963_4169131_+	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	7.0e-26
WP_000132739.1|4169161_4169353_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_148048544.1|4169333_4170512_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.5	1.2e-231
4171025:4171039	attR	CACGCAATATCTTCT	NA	NA	NA	NA
>prophage 7
NZ_CP042942	Escherichia fergusonii strain ATCC 35473 chromosome, complete genome	4657720	4302771	4312213	4657720		Enterobacteria_phage(85.71%)	10	NA	NA
WP_046080774.1|4302771_4303908_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	2.9e-163
WP_148048592.1|4303904_4305896_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	92.3	0.0e+00
WP_001353103.1|4306027_4306489_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_046080772.1|4306531_4307002_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	98.7	1.1e-81
WP_000598641.1|4307048_4307768_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002431447.1|4307764_4309450_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	93.8	3.3e-288
WP_001240384.1|4309671_4310403_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	97.0	2.0e-109
WP_001216963.1|4310462_4310570_+	protein YohO	NA	NA	NA	NA	NA
WP_000783130.1|4310550_4311282_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_148048593.1|4311286_4312213_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	7.5e-08
