The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042934	Escherichia coli 042 chromosome, complete genome	4692707	796280	824820	4692707	transposase,capsid,tail,integrase,lysis	Enterobacteria_phage(45.71%)	49	789515:789529	820499:820513
789515:789529	attL	AAATTAATGAAAAAA	NA	NA	NA	NA
WP_000533646.1|796280_797351_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
WP_001303849.1|797328_797547_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|797586_797754_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_071525073.1|797686_797872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120065.1|797996_798599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763365.1|798809_799031_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_001395510.1|799129_799411_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_023148020.1|799421_799613_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_072126246.1|799585_799768_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_001372450.1|799764_800445_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_000100847.1|800441_801227_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|801232_801529_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|801604_801811_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000210934.1|802319_803147_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000389051.1|803143_803893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000858975.1|804015_804705_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|804809_805040_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182899.1|805109_805649_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001415152.1|805735_806665_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001372464.1|806661_807363_+	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_000145917.1|807359_807653_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001403556.1|807689_807881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|808137_808698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|808694_809147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072157016.1|809239_809341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372486.1|809337_809793_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224914.1|809792_809963_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372487.1|809955_810246_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_001372483.1|810242_810605_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_000971068.1|810601_810742_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204777.1|810827_811205_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|811360_811885_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592543.1|812077_813037_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_124039027.1|813172_813370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001470134.1|813388_813523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|813807_815081_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000839582.1|815642_815858_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001372488.1|815857_816355_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_001228702.1|816571_816778_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|816806_816959_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|817310_817721_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|817777_818011_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_001372490.1|818399_818960_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_072035100.1|819768_819906_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_000239881.1|819850_820519_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
820499:820513	attR	TTTTTTCATTAATTT	NA	NA	NA	NA
WP_072163407.1|820668_820845_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_001753290.1|820918_822250_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000767389.1|822995_823472_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001356070.1|823530_824820_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
>prophage 2
NZ_CP042934	Escherichia coli 042 chromosome, complete genome	4692707	1221915	1232693	4692707	integrase	Enterobacteria_phage(40.0%)	11	1223190:1223213	1234698:1234721
WP_000444487.1|1221915_1223166_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
1223190:1223213	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000741339.1|1223279_1224422_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000088653.1|1224411_1224648_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|1224787_1225027_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_001678640.1|1225074_1225293_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_001678641.1|1225446_1226511_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_000149533.1|1226507_1226666_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001372461.1|1226662_1227343_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_072163463.1|1227339_1227651_-	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001753331.1|1227833_1228373_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_000379042.1|1230737_1232693_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
1234698:1234721	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 3
NZ_CP042934	Escherichia coli 042 chromosome, complete genome	4692707	1633058	1661661	4692707	integrase,tail,lysis	Enterobacteria_phage(25.0%)	32	1636805:1636819	1660583:1660597
WP_072163404.1|1633058_1633184_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
WP_032181053.1|1633238_1634636_-	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
WP_001373320.1|1635467_1637630_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
1636805:1636819	attL	CAATCCGCGACGGCG	NA	NA	NA	NA
WP_000762889.1|1638375_1639197_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_000904112.1|1639193_1639568_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_001373319.1|1639580_1640630_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_023147795.1|1640631_1640910_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000980999.1|1640976_1641228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013632.1|1641443_1641656_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_122083109.1|1641700_1641808_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_032181055.1|1641814_1642123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023147794.1|1642327_1643308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023147793.1|1643667_1644270_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_001678529.1|1644587_1645937_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_001678528.1|1646484_1647429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373616.1|1647558_1647981_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_000054501.1|1648021_1648987_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_072163420.1|1648967_1649210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1649293_1649482_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083281.1|1649478_1649670_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001372999.1|1649763_1652235_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001296941.1|1652322_1652559_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000877001.1|1652593_1653874_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|1653893_1654004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836058.1|1654061_1655081_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1655092_1656307_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1656512_1656839_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1656973_1657315_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1657349_1657910_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1657912_1658623_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1658730_1659036_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|1659234_1661661_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
1660583:1660597	attR	CAATCCGCGACGGCG	NA	NA	NA	NA
>prophage 4
NZ_CP042934	Escherichia coli 042 chromosome, complete genome	4692707	2201549	2209858	4692707		Enterobacteria_phage(83.33%)	9	NA	NA
WP_089455097.1|2201549_2203550_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2203674_2204136_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2204176_2204647_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2204693_2205413_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2205409_2207095_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2207316_2208048_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2208107_2208215_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2208195_2208927_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|2208931_2209858_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 5
NZ_CP042934	Escherichia coli 042 chromosome, complete genome	4692707	2733503	2758442	4692707	tail,lysis	Enterobacteria_phage(28.57%)	33	NA	NA
WP_137675748.1|2733503_2734088_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	3.0e-103
WP_137675747.1|2734087_2737618_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.5e-11
WP_000373425.1|2737806_2738301_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001139675.1|2738975_2739128_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|2739115_2739583_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|2739579_2740077_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|2740076_2740292_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|2740359_2741412_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_001504956.1|2741561_2741756_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	5.1e-28
WP_024227970.1|2742021_2742948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131905.1|2742934_2743483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|2743495_2743837_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_024173873.1|2743854_2744844_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	7.5e-192
WP_024227971.1|2744851_2745661_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.1	1.4e-148
WP_000767113.1|2745680_2746070_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|2746066_2746393_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001377816.1|2746389_2747043_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	8.1e-126
WP_077785391.1|2747042_2747537_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	8.1e-86
WP_000104977.1|2747533_2748475_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
WP_001250269.1|2748464_2748644_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|2748819_2749371_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|2749408_2749609_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|2749706_2750333_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000196297.1|2750753_2751233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|2751795_2752158_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_023277820.1|2752223_2753048_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	4.3e-148
WP_023363286.1|2753176_2753713_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.1e-99
WP_001596853.1|2753703_2754066_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	1.5e-65
WP_001331173.1|2754062_2754278_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|2754337_2754544_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001596854.1|2754504_2755671_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.2	1.8e-147
WP_001596855.1|2755729_2757463_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023363292.1|2757542_2758442_+	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	23.2	2.5e-08
>prophage 6
NZ_CP042934	Escherichia coli 042 chromosome, complete genome	4692707	2847372	2860555	4692707		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|2847372_2849934_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|2850039_2850696_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001297141.1|2850746_2851514_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2851709_2852618_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2852614_2853877_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2853873_2854512_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|2854516_2855293_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|2855381_2856746_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2856839_2857832_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2857894_2859034_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2859173_2859800_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001374723.1|2859793_2860555_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
>prophage 7
NZ_CP042934	Escherichia coli 042 chromosome, complete genome	4692707	4583160	4589719	4692707	transposase	Rhizobium_phage(16.67%)	7	NA	NA
WP_000594911.1|4583160_4583985_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|4584033_4584606_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000747102.1|4584706_4585057_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_001254876.1|4584976_4586128_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000177060.1|4587179_4587437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4587994_4588762_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4588762_4589719_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
