The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042865	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682561	1020986	1028125	4682561		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1020986_1021625_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|1021716_1022883_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|1022879_1023788_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001300386.1|1023983_1024751_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141337.1|1024801_1025458_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|1025563_1028125_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP042865	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682561	1408706	1419916	4682561	tail,integrase	Enterobacteria_phage(53.33%)	16	1405016:1405032	1421926:1421942
1405016:1405032	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1408706_1408907_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|1409038_1409344_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|1409343_1409706_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|1409696_1410233_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|1410360_1411185_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|1411250_1411613_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_001393497.1|1412335_1412830_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|1412829_1413105_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|1413154_1413673_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|1413699_1414140_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|1414438_1414720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|1414754_1416086_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_000703651.1|1416082_1417003_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_000915541.1|1416999_1417362_-	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|1417514_1418672_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|1418983_1419916_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1421926:1421942	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP042865	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682561	1771854	1780525	4682561		Enterobacteria_phage(28.57%)	8	NA	NA
WP_001116026.1|1771854_1773249_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183060.1|1773423_1774317_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699460.1|1774689_1775775_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_001023610.1|1775774_1776674_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000783975.1|1776731_1777613_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001100981.1|1777612_1778170_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_001393538.1|1778166_1779414_+	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000272486.1|1779421_1780525_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
>prophage 4
NZ_CP042865	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682561	2238297	2257508	4682561	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000379575.1|2238297_2238453_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2238619_2239027_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2239110_2239341_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2239637_2239787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2240223_2240556_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2240758_2241064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2241088_2241328_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2241327_2241615_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2241686_2241842_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2242058_2242310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2242376_2242655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2242656_2243706_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2243719_2244472_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2244749_2244839_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2244893_2245106_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2245406_2245622_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2246375_2246591_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2246595_2246907_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2246903_2247437_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2247433_2247931_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2248293_2248506_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2248516_2248705_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2248707_2248773_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2248851_2249007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2249178_2249352_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2249503_2249914_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2249971_2250205_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|2250593_2251163_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|2251113_2252076_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|2252075_2252651_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|2252748_2253339_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2253655_2253889_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2253957_2254071_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2254675_2255959_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527743.1|2256047_2257508_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
NZ_CP042865	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682561	2382095	2480396	4682561	tRNA,tail,transposase,lysis	Escherichia_phage(40.0%)	83	NA	NA
WP_000826416.1|2382095_2383304_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|2383835_2384504_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|2384805_2385399_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001301046.1|2385395_2386388_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234042.1|2386511_2387492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140873.1|2387483_2388023_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2388085_2388310_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375961.1|2388449_2390105_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|2390329_2391673_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|2391889_2392813_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098559.1|2392850_2394491_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2394889_2395039_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2395110_2395284_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2395528_2396059_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115943.1|2397289_2398729_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2398925_2399726_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139543.1|2399997_2403900_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048950.1|2404100_2404706_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627368.1|2404759_2406076_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431845.1|2406065_2407823_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890941.1|2407838_2408735_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177515.1|2408734_2409340_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000910026.1|2409510_2411817_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|2411879_2412740_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_032313496.1|2412947_2415359_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001254932.1|2416451_2417603_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_088895425.1|2417811_2419039_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_010723099.1|2421730_2421796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|2421899_2422490_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|2422471_2423422_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2423522_2424836_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2424862_2426068_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2426067_2426490_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|2426479_2427907_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|2427908_2428697_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2428696_2429464_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2429460_2430531_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2430538_2431036_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2431050_2431797_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2431805_2432093_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2432104_2433034_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|2433318_2435364_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|2435611_2437885_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2437942_2439442_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|2439677_2440583_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2440754_2441081_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2441088_2441274_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|2441270_2443910_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2444117_2445107_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2445217_2445640_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2445636_2445903_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|2446176_2449701_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|2450067_2451201_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|2451341_2451776_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|2452554_2452668_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2452736_2452970_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|2453286_2453877_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2453974_2454550_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|2454549_2457912_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000019448.1|2458234_2459215_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000091628.1|2460980_2461340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|2461320_2461584_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001228696.1|2463374_2463560_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|2463647_2464208_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|2464230_2464977_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000693797.1|2465852_2466275_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2466297_2466594_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2466717_2467194_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|2467647_2467803_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2467799_2468288_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2468729_2468951_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2468950_2469121_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2469195_2469471_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|2469572_2472173_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|2472165_2472975_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2473031_2473226_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2473218_2473428_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2473506_2473722_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2473723_2474959_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2475010_2475946_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2476074_2477448_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2477925_2478909_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2479163_2480396_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 6
NZ_CP042865	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682561	2675520	2686063	4682561	plate,integrase,portal	Shigella_phage(41.67%)	15	2682369:2682381	2689497:2689509
WP_000905001.1|2675520_2676075_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000383574.1|2678244_2678829_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|2678819_2679611_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|2679537_2680011_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|2680010_2680193_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|2680204_2681572_-	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|2681561_2681741_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|2681916_2682474_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
2682369:2682381	attL	AGTCAGCCGCTTC	NA	NA	NA	NA
WP_000649480.1|2682517_2682718_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|2682808_2683483_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|2683657_2683966_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|2683903_2684245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|2684361_2684673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|2684709_2684955_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|2684935_2686063_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	61.5	7.2e-122
2689497:2689509	attR	AGTCAGCCGCTTC	NA	NA	NA	NA
>prophage 7
NZ_CP042865	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682561	3082942	3129792	4682561	terminase,integrase,tail,lysis,portal,protease,holin,transposase,capsid,head	Enterobacteria_phage(74.24%)	66	3106700:3106715	3131500:3131515
WP_088895425.1|3082942_3084171_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000162952.1|3085182_3086415_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_016063193.1|3086543_3087128_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_001407643.1|3087127_3089452_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_001246632.1|3089516_3090137_-	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_000515496.1|3090198_3093597_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_000090889.1|3093657_3094290_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000194780.1|3094226_3094970_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152639.1|3094975_3095674_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3095673_3096003_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840207.1|3095999_3098561_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000459457.1|3098553_3098988_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|3098969_3099392_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3099407_3100148_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|3100155_3100551_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|3100547_3101126_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|3101137_3101491_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158919.1|3101502_3101901_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000063280.1|3101942_3102968_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|3103023_3103356_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123343.1|3103365_3104685_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001359455.1|3104665_3106267_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|3106263_3106470_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|3106466_3108392_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
3106700:3106715	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453580.1|3108366_3108912_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001421937.1|3109300_3109495_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3109659_3109866_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_012775990.1|3110151_3110562_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_000738492.1|3110851_3111145_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012738274.1|3111235_3111418_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000229403.1|3111634_3112111_-	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_000783735.1|3112094_3112418_-|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_001235459.1|3113094_3113718_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_001271136.1|3113714_3114380_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_000144614.1|3114357_3114564_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001108044.1|3114560_3115172_-	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000566997.1|3115164_3115335_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_000113775.1|3115331_3115514_-	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000984218.1|3115480_3115654_-	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000611491.1|3115650_3116523_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000736903.1|3116519_3116960_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145933.1|3117033_3117324_-	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000788910.1|3117320_3118022_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000185505.1|3118018_3118918_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000251069.1|3118950_3119244_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3119362_3119563_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000104863.1|3119663_3120377_+	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000788349.1|3120489_3121329_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_001245922.1|3121344_3121779_+	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_001564525.1|3122243_3122567_+	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_000281856.1|3122567_3123050_-	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213975.1|3123316_3123517_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000065374.1|3123699_3124068_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|3124140_3124305_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3124273_3124417_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995451.1|3124491_3124788_+	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000100844.1|3124793_3125579_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186853.1|3125575_3126256_+	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000149542.1|3126252_3126435_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000548551.1|3126407_3126599_+	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000763367.1|3126990_3127212_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001289873.1|3127208_3127757_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000026224.1|3127948_3128230_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545733.1|3128318_3128486_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_002414258.1|3128525_3128744_+	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000533640.1|3128721_3129792_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
3131500:3131515	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 8
NZ_CP042865	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682561	3328030	3372393	4682561	terminase,integrase,lysis,protease,transposase	Enterobacteria_phage(56.0%)	48	3351105:3351151	3372407:3372453
WP_001300563.1|3328030_3329143_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3329219_3329372_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130654.1|3329824_3330943_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|3331008_3331257_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3331321_3331690_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|3331783_3332437_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3332544_3333792_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786319.1|3333872_3335249_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3335350_3338494_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3338505_3339729_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3339744_3340077_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3340234_3341608_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3341764_3342448_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|3342437_3343880_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|3344029_3346267_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|3346253_3349226_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|3349226_3350117_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|3350299_3351061_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3351105:3351151	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|3351574_3352528_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3352777_3353527_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|3354429_3355056_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001027248.1|3355110_3355854_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
WP_000453566.1|3355828_3356374_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|3356762_3356957_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3357121_3357328_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|3357613_3358024_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3358314_3358608_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3358698_3358881_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3359097_3359595_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|3359594_3359810_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|3360382_3361450_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|3361454_3362471_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|3362868_3363252_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3363337_3363478_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3363474_3363837_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|3363833_3364124_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|3364116_3364287_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|3364286_3364742_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3364738_3364840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3364956_3365754_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3365763_3366315_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|3366779_3368306_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|3368363_3368513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3368560_3368893_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_085947771.1|3369203_3370366_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000145909.1|3370428_3370524_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|3370846_3371110_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|3371229_3372393_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
3372407:3372453	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP042865	Escherichia coli strain ATCC BAA-196 chromosome, complete genome	4682561	3605711	3657184	4682561	holin,transposase,integrase	Acinetobacter_phage(28.57%)	46	3597139:3597155	3659467:3659483
3597139:3597155	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000131044.1|3605711_3607745_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3607873_3608461_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3608474_3609947_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3609960_3611631_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3611843_3612512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3612754_3613450_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3613442_3614870_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3614880_3615600_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3616126_3616981_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|3617206_3618532_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3618640_3618877_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3618888_3619482_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085947771.1|3620754_3621917_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000662258.1|3623965_3624067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3624430_3624694_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3624693_3624834_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3624868_3625096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3625919_3626462_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3626536_3627124_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3627181_3627850_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3627875_3630401_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001310578.1|3630390_3632034_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3632002_3632713_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3633025_3633355_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3633602_3634217_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3634634_3635324_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3635320_3636277_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|3636273_3638472_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3638481_3639438_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|3639416_3639827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|3640111_3641512_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|3641628_3642069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|3642065_3642290_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|3642408_3643263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|3643289_3643988_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|3644259_3644886_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|3644976_3645708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|3646902_3647907_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|3648045_3648804_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|3648808_3650419_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|3650430_3651813_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|3652039_3654007_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|3654021_3654930_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|3655224_3656379_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001030800.1|3656472_3656823_+	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_000015532.1|3656845_3657184_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
3659467:3659483	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 1
NZ_CP042866	Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence	266396	1051	54231	266396	integrase,transposase,protease	Enterobacteria_phage(24.0%)	53	17453:17512	25861:26422
WP_001067855.1|1051_1756_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_073972769.1|1791_2337_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.6	2.2e-31
WP_004197546.1|2366_3233_-	class A beta-lactamase SCO-1	NA	A0A1B0VBP7	Salmonella_phage	42.0	5.3e-56
WP_004197531.1|3394_4594_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_004197529.1|5479_6154_+	recombinase family protein	NA	NA	NA	NA	NA
WP_004197526.1|6155_6482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197540.1|6517_7795_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	44.2	6.7e-84
WP_004197551.1|7800_8229_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	39.5	1.3e-15
WP_004197545.1|8324_8597_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085947932.1|8721_9481_+|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
WP_004197549.1|10373_10559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162832797.1|10624_11763_-|transposase	IS3-like element ISKpn11 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	32.3	1.5e-18
WP_000587836.1|11815_12109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557452.1|12121_12982_-	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_000027061.1|13123_13984_-	class A extended-spectrum beta-lactamase TEM-10	NA	Q1MVP3	Enterobacteria_phage	99.3	8.6e-160
WP_001235713.1|14166_14724_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067855.1|15489_16194_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|16323_17139_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|17245_17950_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
17453:17512	attL	CTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAG	NA	NA	NA	NA
WP_001324342.1|18724_20248_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000983249.1|20234_21020_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_000376623.1|21195_21696_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|21823_22663_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|22656_23004_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|23167_23959_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845048.1|24107_25121_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_021529705.1|25952_28958_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
25861:26422	attR	CTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGCAACGTTTTCTGCCTCTGACGCCTCTTTTAATGGTCTCAGATGTCCTTTGGTCACCAGTTCTGCCAGCGTGAAGGAATAATGGCCGAGCATATTGATATGTCCGTGGCAAAGCGGGGAGAGGCGTGCGATATCTTCATCATTCAGTGTTTCACCCTGCGCCCGGAGATGATCCAGGGCTGCCTGCATATAAATAGTGTTCCATAACACGACGGCGTTAGTGACCAGCCCCAGTGTGCCCAGTTGATCTTCCTGACCGTCGGTATATCGTTTTCTTATCTCACCTTTTTGACCGTGACAGATGGCTCTGGCAACGGCATGGCGACTTTCTCCCCGATTAAGCTGGGTCAGAATGCGCCGGCGGTAATCTTCATCATCAATATAATTAAGCAGATACAGCGTTTTGTTGATGCGCCCCACTTCAATGATTGCCTGAGTCAGTCCGGAAGGACGTTCACTTTTCAGCA	NA	NA	NA	NA
WP_001235713.1|29121_29679_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_014454105.1|29912_30467_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001206315.1|30536_31325_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|31384_32209_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|32908_33769_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_172619141.1|33884_34547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|34668_35553_-	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_014386535.1|36806_37265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124036893.1|37318_37504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196917.1|38169_38382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118062.1|38475_38754_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004196937.1|39301_39685_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004196907.1|40094_41633_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
WP_004196919.1|41681_42029_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
WP_004196883.1|42025_42430_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.1e-69
WP_004196929.1|42826_43309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196935.1|43687_45187_-	kinase	NA	NA	NA	NA	NA
WP_004196924.1|45214_46948_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|46947_47988_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026585.1|48080_48719_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|48719_49361_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_004026588.1|49385_50024_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004196888.1|50500_50959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196894.1|50961_52185_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_004196886.1|52195_53152_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_004196911.1|53151_54231_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	3.9e-40
>prophage 2
NZ_CP042866	Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence	266396	66809	130985	266396	transposase	Pseudomonas_phage(25.0%)	55	NA	NA
WP_001352368.1|66809_68018_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_004178082.1|68486_69974_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_147633750.1|70286_71498_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|71941_72262_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|72254_72641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|72648_73335_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|73312_73936_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089072.1|74017_75223_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|75335_75929_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001339197.1|76442_77651_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_004197614.1|78474_79077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197616.1|80068_81340_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_004197615.1|81522_82017_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.0	4.2e-18
WP_069335023.1|82126_82945_+	DNA repair protein	NA	NA	NA	NA	NA
WP_004026629.1|83347_83746_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001567369.1|84332_84965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|84993_86397_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_009310015.1|86508_88041_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	4.1e-51
WP_001567369.1|88217_88850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|88878_90282_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_023332914.1|90474_91962_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_004196316.1|92397_92712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196342.1|92720_93230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196329.1|93219_93660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181937.1|93689_94346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181934.1|94619_95222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196349.1|95224_95740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196319.1|97042_97999_-	DsbA family protein	NA	NA	NA	NA	NA
WP_004181929.1|98058_98400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181928.1|98413_98725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181926.1|98741_99470_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_004026303.1|99603_100218_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_096833975.1|100485_103827_-	viral (Super1) RNA helicase	NA	NA	NA	NA	NA
WP_045289293.1|104511_108426_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045289292.1|108427_109783_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_045289282.1|109826_110864_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_004026315.1|111229_111772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181918.1|111789_112314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196341.1|112506_113262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|113859_114324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042935928.1|114323_115112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042935926.1|115125_118074_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_045289280.1|118063_120190_+	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_042935923.1|120192_121290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026331.1|121302_121977_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_004883400.1|121985_123122_+	S49 family peptidase	NA	G0YPK2	Erwinia_phage	32.2	5.7e-10
WP_042935920.1|123124_123898_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	46.7	1.5e-09
WP_042935918.1|123951_124308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042935952.1|124849_125083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042935949.1|125161_125509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061891936.1|125664_126732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060589151.1|127421_127799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181899.1|127996_128971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181898.1|129573_129732_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_004883380.1|129803_130985_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP042866	Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence	266396	145742	154336	266396	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_000412211.1|145742_146402_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|146602_146980_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|147290_148295_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138064.1|148373_151340_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_001067855.1|151632_152337_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000144779.1|152373_153030_-	metallophosphoesterase	NA	A0A2H4P756	Pseudomonas_phage	43.7	7.0e-45
WP_000571065.1|153026_153536_-	trimethoprim-resistant dihydrofolate reductase DfrA8	NA	A0A1Y0SUI9	Pseudomonas_phage	38.8	6.5e-14
WP_001067855.1|153631_154336_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
NZ_CP042866	Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence	266396	228812	236004	266396		Burkholderia_phage(33.33%)	10	NA	NA
WP_004196710.1|228812_229391_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
WP_004181824.1|229381_229696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196691.1|229820_230231_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.0	1.7e-41
WP_004196726.1|230415_230775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026468.1|231005_231449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|231702_231963_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004196690.1|231995_232430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026464.1|232426_233170_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
WP_075043065.1|233326_234712_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_004026461.1|234801_236004_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
>prophage 5
NZ_CP042866	Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence	266396	243611	250512	266396	transposase	Escherichia_phage(50.0%)	10	NA	NA
WP_000019450.1|243611_244592_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_004197220.1|244793_245000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197207.1|245083_245356_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_162138575.1|245419_245581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147633751.1|245636_245903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019450.1|245948_246929_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_004197199.1|247577_248102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197222.1|248165_248933_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.7	3.5e-43
WP_004197181.1|249384_249834_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	40.7	1.3e-18
WP_004026394.1|249903_250512_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
