The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042383	Leuconostoc pseudomesenteroides strain CBA3630 chromosome, complete genome	2234062	193850	237518	2234062	tail,head,transposase,portal,terminase,integrase	Leuconostoc_phage(45.0%)	55	190589:190604	242174:242189
190589:190604	attL	TCATGCAGCGTGCTTT	NA	NA	NA	NA
WP_010279354.1|193850_194804_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	34.7	1.6e-05
WP_004912837.1|194924_195470_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_147652002.1|195606_196218_-	ComF family protein	NA	NA	NA	NA	NA
WP_031941025.1|196285_197554_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	40.7	2.0e-67
WP_147651061.1|197577_198213_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.8	2.4e-37
WP_147651062.1|198429_199389_-	N-acetylmuramoyl-L-alanine amidase	NA	M4I776	Leuconostoc_phage	79.6	9.1e-142
WP_147651063.1|199400_199823_-	hypothetical protein	NA	A0A097BYC6	Leuconostoc_phage	91.2	1.9e-59
WP_147651064.1|199874_200141_-	hypothetical protein	NA	A0A097BYC8	Leuconostoc_phage	92.0	3.0e-39
WP_147651065.1|200142_200376_-	hypothetical protein	NA	A0A097BYE3	Leuconostoc_phage	94.7	7.0e-32
WP_147651066.1|200506_205138_-	hypothetical protein	NA	A0A2P0ZLE1	Lactobacillus_phage	44.2	1.2e-85
WP_147651067.1|205134_205962_-|tail	phage tail protein	tail	Q597U5	Lactobacillus_virus	35.3	3.6e-22
WP_147652004.1|205961_209618_-|tail	phage tail tape measure protein	tail	A0A2P0ZL32	Lactobacillus_phage	31.3	1.7e-10
WP_147651068.1|209673_209910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651069.1|210002_210452_-	hypothetical protein	NA	D2IZN3	Enterococcus_phage	34.9	1.7e-13
WP_147651070.1|210491_211091_-|tail	phage major tail protein, TP901-1 family	tail	Q597U9	Lactobacillus_virus	58.9	9.2e-60
WP_147651071.1|211105_211471_-	hypothetical protein	NA	D2IYX1	Enterococcus_phage	39.5	5.3e-18
WP_147651072.1|211467_211830_-	hypothetical protein	NA	D2IYX0	Enterococcus_phage	36.8	8.2e-11
WP_147651073.1|211831_212122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651074.1|212121_212469_-|head,tail	phage head-tail connector protein	head,tail	Q597V3	Lactobacillus_virus	45.9	5.1e-18
WP_147652006.1|212507_212759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651075.1|212655_213537_-	hypothetical protein	NA	Q6SED2	Lactobacillus_prophage	63.2	2.1e-105
WP_147651076.1|213554_214106_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_147651077.1|214236_215193_-	hypothetical protein	NA	D2IYW4	Enterococcus_phage	39.3	2.6e-56
WP_147651078.1|215185_216469_-|portal	phage portal protein	portal	D2IZM0	Enterococcus_phage	53.8	4.8e-114
WP_147651079.1|216521_217340_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	35.3	2.2e-32
WP_147651080.1|217336_217597_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.3	4.2e-09
WP_147651081.1|217615_217945_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	56.7	1.6e-18
WP_147651082.1|217947_219231_-|terminase	PBSX family phage terminase large subunit	terminase	A0A097BYD0	Leuconostoc_phage	64.2	6.2e-154
WP_147651083.1|219230_219794_-|terminase	terminase small subunit	terminase	A0A097BYC9	Leuconostoc_phage	46.5	4.5e-32
WP_147651084.1|219831_220014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651085.1|220073_220628_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_147651086.1|221091_221658_-	hypothetical protein	NA	A8ASQ2	Listeria_phage	35.6	2.2e-23
WP_147651087.1|221749_222985_-	helix-turn-helix domain-containing protein	NA	A0A097BYC5	Leuconostoc_phage	53.4	1.6e-119
WP_147651088.1|224312_224789_-	SAM-dependent methyltransferase	NA	D2IZK8	Enterococcus_phage	60.4	2.4e-50
WP_147651089.1|224799_224985_-	hypothetical protein	NA	E3W8E1	Leuconostoc_phage	88.5	5.6e-24
WP_147651090.1|224981_225203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147652008.1|225501_225930_-	dTDP-glucose pyrophosphorylase	NA	A8AU00	Listeria_phage	39.4	2.8e-18
WP_147651091.1|225935_226640_-	hypothetical protein	NA	E3W8D3	Leuconostoc_phage	79.5	1.1e-104
WP_147651092.1|226810_228130_-	replicative DNA helicase	NA	A0A097BYG3	Leuconostoc_phage	65.3	3.7e-154
WP_147651093.1|228122_229151_-	DnaD domain protein	NA	E3W8D0	Leuconostoc_phage	69.6	3.5e-83
WP_147651094.1|229294_229951_-	hypothetical protein	NA	E3W8C8	Leuconostoc_phage	97.4	2.4e-77
WP_147651095.1|229950_230763_-	recombinase RecT	NA	E3W8C7	Leuconostoc_phage	96.3	1.0e-141
WP_147651096.1|230765_231050_-	hypothetical protein	NA	E3W8C6	Leuconostoc_phage	93.6	1.6e-46
WP_147651097.1|231140_231362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651098.1|231436_231676_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_147651099.1|231774_232167_+	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	39.0	8.0e-20
WP_147651100.1|232163_232349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651101.1|232358_233069_-	hypothetical protein	NA	A0A097BYE0	Leuconostoc_phage	67.1	4.0e-86
WP_147651102.1|233074_233278_-	hypothetical protein	NA	E3W8C1	Leuconostoc_phage	46.0	8.0e-08
WP_147651103.1|233324_233849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651104.1|233888_234134_-	DUF739 family protein	NA	NA	NA	NA	NA
WP_147651105.1|234301_234994_+	helix-turn-helix domain-containing protein	NA	A0A097BY95	Leuconostoc_phage	53.7	4.5e-58
WP_147651106.1|235008_235317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651107.1|235380_236145_+	DUF5067 domain-containing protein	NA	O21991	Streptococcus_virus	42.2	8.9e-07
WP_147651108.1|236450_237518_+|integrase	tyrosine-type recombinase/integrase	integrase	E3W8I1	Leuconostoc_phage	62.0	3.3e-124
242174:242189	attR	AAAGCACGCTGCATGA	NA	NA	NA	NA
>prophage 2
NZ_CP042383	Leuconostoc pseudomesenteroides strain CBA3630 chromosome, complete genome	2234062	758185	797006	2234062	tRNA,integrase,transposase	Bacillus_phage(25.0%)	40	749542:749557	806925:806940
749542:749557	attL	CACAATTATTTTTTGA	NA	NA	NA	NA
WP_010278088.1|758185_758896_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_010278087.1|758879_759437_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_010278085.1|759411_759825_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_010278083.1|759817_760834_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	38.2	1.7e-58
WP_004914549.1|760932_761583_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_010278082.1|761588_762626_+	peptidoglycan bridge formation glycyltransferase FemA/FemB family protein	NA	NA	NA	NA	NA
WP_147651189.1|763203_764490_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_147651191.1|764486_765638_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_142511354.1|766040_767174_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	23.9	1.3e-17
WP_147651193.1|767310_768018_-	helix-turn-helix domain-containing protein	NA	A0A097BY95	Leuconostoc_phage	45.0	1.1e-46
WP_036068589.1|768161_768404_+	helix-turn-helix transcriptional regulator	NA	Q4ZB05	Staphylococcus_virus	49.2	6.7e-09
WP_147651195.1|768438_768723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651197.1|769474_770182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651199.1|770203_770650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651201.1|771853_772120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651203.1|772180_772492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651205.1|772472_773660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651206.1|773685_773985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002816178.1|774975_775239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651208.1|776143_778276_+	aggregation substance precursor	NA	NA	NA	NA	NA
WP_004914506.1|778355_778574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651210.1|778592_779501_+	serine-rich aggregation substance UasX	NA	NA	NA	NA	NA
WP_031559800.1|779910_780102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651212.1|782753_782969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084013492.1|782965_783238_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	X2KQ37	Campylobacter_phage	36.6	6.3e-08
WP_147651045.1|783312_784218_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.9	6.7e-46
WP_036066640.1|784160_784661_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_100665893.1|784872_785088_+	AbrB family transcriptional regulator	NA	Q708N8	Streptococcus_phage	46.2	5.5e-07
WP_142511340.1|785080_785419_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SAB3	Streptococcus_phage	37.6	1.6e-08
WP_147651214.1|785678_786884_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.7	9.5e-96
WP_147651216.1|789249_789648_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_147651218.1|789667_790180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651220.1|790182_790713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651221.1|790712_791342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651223.1|791387_792641_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_147651225.1|792778_793960_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	29.6	5.7e-29
WP_147651227.1|795008_795311_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_100665871.1|795307_795652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651229.1|795903_796674_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.7	1.6e-35
WP_100665863.1|796730_797006_-|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	39.3	7.1e-07
806925:806940	attR	TCAAAAAATAATTGTG	NA	NA	NA	NA
>prophage 3
NZ_CP042383	Leuconostoc pseudomesenteroides strain CBA3630 chromosome, complete genome	2234062	1252601	1261305	2234062		Synechococcus_phage(33.33%)	9	NA	NA
WP_010277619.1|1252601_1253087_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.7	4.0e-21
WP_010277615.1|1253083_1254199_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_147651337.1|1254176_1254926_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SS43	Cyanophage	36.4	4.4e-35
WP_010277607.1|1254928_1255198_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_010277604.1|1255194_1255860_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_010277601.1|1255863_1258080_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.7	3.7e-138
WP_010277598.1|1258061_1259687_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	2.8e-50
WP_147651339.1|1259683_1260721_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FZ01	Synechococcus_phage	39.4	1.3e-56
WP_010277594.1|1260714_1261305_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	1.6e-24
>prophage 4
NZ_CP042383	Leuconostoc pseudomesenteroides strain CBA3630 chromosome, complete genome	2234062	1503744	1544801	2234062	transposase	Streptococcus_phage(22.22%)	36	NA	NA
WP_147651513.1|1503744_1504797_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	32.0	1.4e-23
WP_147651515.1|1505086_1508875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651517.1|1508847_1509030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651519.1|1509047_1511228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651521.1|1511261_1511711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651523.1|1511846_1512197_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SAB3	Streptococcus_phage	45.3	8.7e-18
WP_147651525.1|1512186_1512414_-	antitoxin of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_139968635.1|1513264_1514080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651527.1|1514471_1514987_+	nucleoside 2-deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	38.8	5.4e-24
WP_147651528.1|1515065_1515701_-	membrane protein	NA	NA	NA	NA	NA
WP_147652040.1|1515832_1516378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651530.1|1517044_1517989_-	zinc-binding dehydrogenase	NA	K7Z7U2	Megavirus	25.1	1.5e-08
WP_147651532.1|1517999_1519343_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	3.9e-34
WP_010294468.1|1519329_1519812_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031941341.1|1520121_1520379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139968702.1|1520499_1520820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139968703.1|1520908_1521091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651534.1|1521179_1521422_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_147651536.1|1521428_1522271_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	37.2	3.0e-32
WP_147651538.1|1522473_1523109_+	DUF4230 domain-containing protein	NA	NA	NA	NA	NA
WP_147651540.1|1523511_1524840_-	CapA family protein	NA	NA	NA	NA	NA
WP_147651542.1|1524849_1525713_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_147651544.1|1525793_1526912_-	lactate oxidase	NA	NA	NA	NA	NA
WP_147651546.1|1527065_1527914_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_147651548.1|1529136_1530327_-	galactokinase	NA	NA	NA	NA	NA
WP_147651550.1|1530349_1531354_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.7	3.1e-52
WP_147651552.1|1531360_1532869_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_147651554.1|1532998_1534237_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_147651556.1|1534258_1536178_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_011679809.1|1536193_1538245_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_011679808.1|1538457_1539471_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_147651558.1|1541007_1541322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651560.1|1541311_1542025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651562.1|1542318_1543524_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.7	5.5e-96
WP_139968603.1|1543709_1543952_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_147651563.1|1543958_1544801_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.1e-31
>prophage 5
NZ_CP042383	Leuconostoc pseudomesenteroides strain CBA3630 chromosome, complete genome	2234062	1688184	1736459	2234062	protease,integrase,transposase	Bacillus_phage(30.0%)	51	1729393:1729412	1748362:1748381
WP_147651743.1|1688184_1689183_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.1	7.5e-38
WP_112132937.1|1689736_1691689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952137.1|1691820_1692702_-	class A sortase	NA	NA	NA	NA	NA
WP_147651745.1|1692712_1694881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952133.1|1694896_1695286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952131.1|1695444_1696068_-	type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_071952128.1|1696210_1696729_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_147651747.1|1696813_1697329_+	nucleoside 2-deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	37.5	4.6e-23
WP_071952123.1|1697406_1698042_-	membrane protein	NA	NA	NA	NA	NA
WP_071952120.1|1698174_1698771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952118.1|1698773_1699331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952115.1|1699333_1699759_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_147651749.1|1699771_1701022_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A191KBX1	Streptococcus_virus	34.1	2.2e-07
WP_071952110.1|1701025_1701220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952107.1|1701221_1703177_-	type IV secretion system protein VirB4	NA	NA	NA	NA	NA
WP_147651751.1|1703179_1703833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651753.1|1703832_1704162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952099.1|1704543_1705323_+	ParA family protein	NA	Q7M293	Enterobacteria_phage	29.9	1.1e-09
WP_071952096.1|1705322_1705604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651755.1|1705650_1706154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651757.1|1706216_1708328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952089.1|1708324_1711345_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_071952087.1|1711331_1713230_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1S6UBG5	Serratia_phage	31.1	2.7e-60
WP_071952085.1|1713226_1713709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952082.1|1713722_1715993_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_147651759.1|1715979_1716246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952073.1|1716699_1717068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071952071.1|1717071_1717704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071952068.1|1718103_1718337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651761.1|1718333_1718774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071952063.1|1718766_1718979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071952060.1|1718989_1719208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651763.1|1719429_1719639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952056.1|1719658_1719889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071952053.1|1719869_1720193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147651765.1|1720205_1720469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071952049.1|1720665_1722618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651767.1|1722627_1723575_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	36.4	1.7e-44
WP_071952045.1|1723579_1724227_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_071952043.1|1724280_1724520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071952041.1|1724578_1725223_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_147651768.1|1725497_1726832_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.6	1.7e-13
WP_071952037.1|1726824_1727508_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_081365849.1|1727589_1728231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651778.1|1729187_1730144_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.0e-31
1729393:1729412	attL	TTAAATTCAGCACTCGTGTA	NA	NA	NA	NA
WP_050884923.1|1729999_1730260_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.3	1.4e-09
WP_010295451.1|1730513_1732658_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_010295453.1|1732654_1733551_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_010295455.1|1733861_1734338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651159.1|1734707_1735913_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.8	1.3e-100
WP_147651782.1|1736225_1736459_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1748362:1748381	attR	TACACGAGTGCTGAATTTAA	NA	NA	NA	NA
>prophage 6
NZ_CP042383	Leuconostoc pseudomesenteroides strain CBA3630 chromosome, complete genome	2234062	2113173	2121277	2234062		Catovirus(33.33%)	6	NA	NA
WP_010275790.1|2113173_2113593_-	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	38.2	4.4e-16
WP_010275787.1|2113653_2114172_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	35.2	3.4e-18
WP_010275781.1|2114184_2116134_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.1	2.5e-69
WP_010275777.1|2116137_2118705_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.5	1.4e-40
WP_010275773.1|2118821_2120219_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	47.6	1.4e-119
WP_004910532.1|2120293_2121277_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	28.1	4.9e-18
>prophage 7
NZ_CP042383	Leuconostoc pseudomesenteroides strain CBA3630 chromosome, complete genome	2234062	2216839	2224165	2234062		Leuconostoc_phage(62.5%)	13	NA	NA
WP_147651958.1|2216839_2217211_-	hypothetical protein	NA	A0A097BYH9	Leuconostoc_phage	92.6	9.7e-60
WP_147651960.1|2217511_2218939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651961.1|2218925_2219744_-	DNA replication protein	NA	NA	NA	NA	NA
WP_147651963.1|2219746_2219929_-	hypothetical protein	NA	A0A097BYL1	Leuconostoc_phage	96.7	4.6e-23
WP_147651965.1|2219925_2220210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651967.1|2220212_2220533_-	MarR family transcriptional regulator	NA	A0A097BYF1	Leuconostoc_phage	54.9	1.5e-24
WP_147651968.1|2220529_2220742_-	hypothetical protein	NA	A0A097BYJ5	Leuconostoc_phage	64.3	1.7e-16
WP_147651970.1|2220883_2221669_-	hypothetical protein	NA	Q5K5I3	Oenococcus_phage	54.7	4.8e-48
WP_147651972.1|2221682_2221952_-	hypothetical protein	NA	A0A097BYJ6	Leuconostoc_phage	94.3	6.0e-43
WP_147651973.1|2221962_2222124_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_147651975.1|2222691_2223312_-	transcriptional regulator	NA	R9QNB1	Lactococcus_phage	34.7	1.1e-15
WP_147651977.1|2223321_2223510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147651979.1|2223625_2224165_+	helix-turn-helix domain-containing protein	NA	L0P7E1	Lactobacillus_phage	50.7	2.5e-11
