The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042806	Terriglobus albidus strain ORNL chromosome, complete genome	6405582	1048291	1113977	6405582	protease,transposase,bacteriocin,tRNA	uncultured_Mediterranean_phage(16.67%)	54	NA	NA
WP_147646494.1|1048291_1049095_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_147646495.1|1049087_1050173_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_147650458.1|1050715_1051927_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_147646496.1|1052149_1052821_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_147646497.1|1052932_1053382_-	ester cyclase	NA	NA	NA	NA	NA
WP_147646498.1|1053560_1054334_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_147646499.1|1054584_1055238_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_147650412.1|1055890_1056943_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_147646500.1|1057384_1058440_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	38.0	3.0e-05
WP_147646501.1|1058466_1058736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147646502.1|1058741_1059962_+	ThiF family adenylyltransferase	NA	E3T5K6	Cafeteria_roenbergensis_virus	29.1	8.6e-12
WP_147646503.1|1059958_1060849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147646504.1|1060845_1061898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147646505.1|1061894_1062479_+	NINE protein	NA	NA	NA	NA	NA
WP_147646506.1|1062514_1063156_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_147646507.1|1063327_1063891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147650459.1|1064267_1065320_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	33.1	3.8e-16
WP_147646508.1|1065276_1067874_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_147646509.1|1067927_1068839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147646510.1|1068885_1070232_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_147646511.1|1070626_1071094_+	ester cyclase	NA	NA	NA	NA	NA
WP_147646512.1|1071985_1072519_-	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_147646513.1|1072515_1073397_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_147646514.1|1073580_1075017_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_147646515.1|1075017_1075338_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_147646516.1|1075337_1075640_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_147646517.1|1075642_1076200_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_147646518.1|1076234_1076444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147646519.1|1076835_1078578_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_147646520.1|1078712_1079411_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_147646521.1|1079638_1080589_+	catalase	NA	NA	NA	NA	NA
WP_147646522.1|1080780_1082931_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_147646523.1|1083468_1084710_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
WP_147646524.1|1084774_1085368_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_147646525.1|1085806_1086517_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_147646526.1|1086585_1087197_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_147646527.1|1087336_1087714_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_147646528.1|1088441_1092908_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0K9	Chrysochromulina_ericina_virus	32.5	5.9e-26
WP_147646529.1|1093055_1097246_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.8	2.2e-75
WP_147650460.1|1097422_1097899_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_147646530.1|1098068_1100291_+	DUF4139 domain-containing protein	NA	NA	NA	NA	NA
WP_147646531.1|1100619_1100976_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_147646532.1|1101301_1101670_-	VOC family protein	NA	NA	NA	NA	NA
WP_147646533.1|1101756_1102050_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_147646534.1|1102391_1105061_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.8	2.0e-106
WP_147646535.1|1105442_1106003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147646536.1|1106023_1107610_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_147646537.1|1107778_1108522_+	TIGR03435 family protein	NA	NA	NA	NA	NA
WP_147646538.1|1108794_1109253_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_147646539.1|1109468_1109807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147646540.1|1110218_1110440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147646541.1|1110759_1111410_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_147646542.1|1111550_1112435_+	ROK family protein	NA	NA	NA	NA	NA
WP_147650433.1|1112924_1113977_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP042806	Terriglobus albidus strain ORNL chromosome, complete genome	6405582	2264853	2311621	6405582	tRNA,integrase,transposase	Synechococcus_phage(40.0%)	37	2295900:2295931	2323022:2323053
WP_147647338.1|2264853_2265906_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_147647339.1|2266574_2272151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147647340.1|2272780_2273662_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.9	3.9e-30
WP_147647341.1|2273808_2274057_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_147650553.1|2274433_2274718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147647342.1|2274843_2275044_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_147647343.1|2275040_2275424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147647344.1|2275619_2278148_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_147645765.1|2278548_2279601_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_147647345.1|2279969_2280323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147647346.1|2280670_2282272_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	27.9	2.2e-23
WP_147647347.1|2282449_2284288_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_147645765.1|2284512_2285565_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_147647348.1|2285827_2286169_-	BcpO-related WXXGXW repeat protein	NA	NA	NA	NA	NA
WP_147647349.1|2286272_2287265_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_147647350.1|2287519_2288695_+	chorismate synthase	NA	NA	NA	NA	NA
WP_147647351.1|2288806_2289316_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.9	1.8e-16
WP_147647352.1|2289320_2290247_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_147647353.1|2290243_2290870_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_147647354.1|2291263_2291752_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_147647355.1|2291784_2291985_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_147647356.1|2292315_2292942_+	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	33.9	9.5e-15
WP_147647357.1|2292941_2293775_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_147650554.1|2293797_2294841_+	segregation protein B	NA	NA	NA	NA	NA
WP_147647358.1|2294844_2295831_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
2295900:2295931	attL	CGTGGGGGTTCGACCCCCCCTCCCGGCACCAA	NA	NA	NA	NA
WP_147647359.1|2296264_2300224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147647360.1|2300251_2300896_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_147647361.1|2300896_2302063_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_147647362.1|2302063_2303200_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_147647363.1|2303412_2303754_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_147647364.1|2303755_2304355_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_147647365.1|2304547_2305096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147647366.1|2305713_2306913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147647367.1|2307170_2307671_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_147647368.1|2308046_2308958_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_147647369.1|2309002_2310205_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_147647370.1|2310607_2311621_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A096VKD7	Synechococcus_phage	25.9	2.4e-07
2323022:2323053	attR	CGTGGGGGTTCGACCCCCCCTCCCGGCACCAA	NA	NA	NA	NA
>prophage 3
NZ_CP042806	Terriglobus albidus strain ORNL chromosome, complete genome	6405582	4463353	4473826	6405582	tail,plate	Streptomyces_phage(50.0%)	12	NA	NA
WP_147648862.1|4463353_4466314_-|plate	putative baseplate assembly protein	plate	A0A1J0GW37	Streptomyces_phage	40.0	1.3e-08
WP_147648864.1|4466310_4466700_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_147648866.1|4466709_4467108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147650711.1|4467148_4467721_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_147648868.1|4467783_4468854_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_147648870.1|4468858_4469647_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_147648871.1|4469637_4470171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147648874.1|4470162_4470519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147650712.1|4471151_4471607_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_147648876.1|4471863_4472229_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_147648878.1|4472225_4472663_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_147648880.1|4472668_4473826_-|tail	phage tail sheath family protein	tail	M4SK14	Cyanophage	28.3	1.5e-05
>prophage 4
NZ_CP042806	Terriglobus albidus strain ORNL chromosome, complete genome	6405582	5717530	5833051	6405582	transposase	Planktothrix_phage(11.11%)	93	NA	NA
WP_147649897.1|5717530_5718682_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_147649898.1|5718847_5719588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649899.1|5719607_5720798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147649900.1|5720870_5721320_-	DUF1569 domain-containing protein	NA	NA	NA	NA	NA
WP_147649901.1|5721428_5722106_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_147645881.1|5722613_5723690_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_147649902.1|5724012_5724723_+	CerR family C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_147649903.1|5724725_5725850_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_147650801.1|5725887_5726589_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.3	1.4e-38
WP_147649904.1|5726702_5727767_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_147649905.1|5728171_5728840_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_147649906.1|5729000_5730125_+	TIGR03118 family protein	NA	A0A1V0S9B1	Catovirus	31.7	7.1e-37
WP_147649907.1|5730508_5731201_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_147649908.1|5731951_5732878_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_147649909.1|5733010_5733715_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_147649910.1|5733888_5735151_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_147649911.1|5735276_5735630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649912.1|5735830_5736250_+	YciI family protein	NA	NA	NA	NA	NA
WP_147649913.1|5736271_5736790_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_147649914.1|5737048_5737756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147649915.1|5737959_5740851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147649916.1|5741306_5741846_-	DinB family protein	NA	NA	NA	NA	NA
WP_147649917.1|5741995_5742916_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	1.0e-12
WP_147649918.1|5742963_5744259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147649919.1|5744255_5745716_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_147649920.1|5746547_5746883_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_147649921.1|5746931_5747456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147650802.1|5747787_5748261_-	S24 family peptidase	NA	C8CLH0	Xylella_phage	44.4	2.7e-30
WP_147649922.1|5748579_5748759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649923.1|5748762_5749152_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_147649924.1|5749152_5750235_+	hypothetical protein	NA	I3PUZ7	Vibrio_phage	65.1	5.2e-37
WP_147649925.1|5750359_5751010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147649926.1|5751502_5752561_+	type III polyketide synthase	NA	NA	NA	NA	NA
WP_147649927.1|5752550_5753261_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_147649928.1|5753257_5754424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147650803.1|5754447_5754720_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_147649929.1|5754716_5755931_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_147649930.1|5755938_5756370_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_147649931.1|5756751_5757201_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_147645881.1|5757339_5758416_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_147645759.1|5758558_5759710_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_147649932.1|5760042_5760483_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_147645881.1|5760620_5761697_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_147645759.1|5762094_5763246_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_147649933.1|5763406_5764045_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_147649934.1|5764072_5765293_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_147649935.1|5765396_5766164_+	DUF899 family protein	NA	NA	NA	NA	NA
WP_147649936.1|5766520_5766754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649937.1|5766755_5767214_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_147649938.1|5767670_5768786_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	50.8	3.9e-11
WP_147649939.1|5768782_5771503_+	methionine synthase	NA	NA	NA	NA	NA
WP_147649897.1|5771866_5773018_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_147649940.1|5773428_5774493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147649941.1|5774658_5775168_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_147649942.1|5775160_5775493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649943.1|5775581_5775869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147650804.1|5775906_5776821_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_147649944.1|5776867_5777350_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_147649945.1|5777972_5778746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147649946.1|5778961_5779288_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_147649947.1|5780221_5781280_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_147650805.1|5781715_5782642_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_147649948.1|5782638_5783976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649949.1|5784459_5789784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649950.1|5789790_5790324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649951.1|5790391_5792389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649952.1|5792414_5792663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649953.1|5792785_5793109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147649954.1|5793594_5794971_-	ethanolamine permease	NA	NA	NA	NA	NA
WP_147649955.1|5795419_5797129_+	esterase	NA	NA	NA	NA	NA
WP_147649956.1|5797321_5797762_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_147645881.1|5797937_5799014_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_147649957.1|5799248_5800139_-	transaldolase	NA	R9S7J6	Prochlorococcus_phage	32.6	6.4e-25
WP_147649958.1|5800521_5801460_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_147649959.1|5801475_5802129_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_147649960.1|5802605_5803151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147649961.1|5803153_5803399_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_147649962.1|5803395_5804181_+	response regulator	NA	NA	NA	NA	NA
WP_147645759.1|5804634_5805786_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_147649963.1|5805939_5807328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147649964.1|5807449_5809033_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_147649965.1|5809051_5812279_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_147645759.1|5812965_5814117_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_147649966.1|5814328_5815861_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.2	1.3e-17
WP_147645759.1|5816231_5817383_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_147649967.1|5817810_5818299_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	34.9	1.0e-11
WP_147649968.1|5818285_5820568_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_147649969.1|5821216_5824120_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_147649970.1|5824415_5826497_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_147649897.1|5826736_5827888_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_147649971.1|5828069_5828561_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_147649972.1|5829031_5831746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147645759.1|5831899_5833051_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP042806	Terriglobus albidus strain ORNL chromosome, complete genome	6405582	6034601	6098156	6405582	protease,transposase,tRNA	Hokovirus(18.18%)	48	NA	NA
WP_147650109.1|6034601_6035084_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_147646881.1|6035035_6035635_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_147650110.1|6036224_6038270_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	32.8	2.7e-87
WP_147650111.1|6038452_6039751_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_147650112.1|6039843_6041064_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_147650113.1|6041623_6042766_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_147650114.1|6042798_6043182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147650115.1|6043186_6043891_-	UMP kinase	NA	NA	NA	NA	NA
WP_147650116.1|6044479_6045478_-	NAD-dependent epimerase/dehydratase family protein	NA	E3SLH0	Synechococcus_phage	62.1	2.3e-119
WP_147650117.1|6052218_6053118_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_147650118.1|6053258_6054200_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_147650119.1|6054601_6055606_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_147650120.1|6055771_6056287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147650121.1|6056496_6057444_+	Ku protein	NA	NA	NA	NA	NA
WP_147650122.1|6057491_6057863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147650123.1|6058167_6060930_+	DNA ligase D	NA	A0A291AUV6	Sinorhizobium_phage	38.0	8.9e-49
WP_147650124.1|6061417_6062470_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_147650125.1|6062500_6063784_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_147650126.1|6063937_6065245_+	MFS transporter	NA	NA	NA	NA	NA
WP_147650127.1|6065318_6066074_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_147650128.1|6066415_6068548_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	31.4	4.1e-78
WP_147650129.1|6068547_6069375_+	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_147650130.1|6069657_6070158_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_147650131.1|6070274_6070562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147650132.1|6070579_6071569_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_147650133.1|6071983_6074476_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_147650134.1|6074758_6075760_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_147650135.1|6075808_6076078_-	integration host factor subunit beta	NA	A0A2H5BNA5	Klebsiella_phage	37.2	2.5e-09
WP_147650136.1|6076257_6076812_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	64.5	7.2e-67
WP_147650137.1|6076696_6077566_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_147650138.1|6077868_6078561_+	lipid-binding SYLF domain-containing protein	NA	NA	NA	NA	NA
WP_147650139.1|6078624_6080232_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	22.7	8.7e-12
WP_147650140.1|6080372_6081302_+	lysophospholipid acyltransferase family protein	NA	A0A1W6JP29	Morganella_phage	28.7	6.1e-18
WP_147650141.1|6081432_6082368_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_147650142.1|6082371_6083016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147650143.1|6083138_6084587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147650144.1|6084723_6086595_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_147650145.1|6086609_6086828_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_147650146.1|6086929_6087625_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_147650147.1|6087875_6088136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147650814.1|6088135_6089113_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.1	3.5e-64
WP_147650148.1|6089220_6090519_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_147650149.1|6090697_6092026_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_147650150.1|6092210_6093560_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.4	7.8e-14
WP_147650151.1|6093631_6094774_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_147650152.1|6094975_6095491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147650153.1|6095818_6096175_-	DUF4260 family protein	NA	NA	NA	NA	NA
WP_147650154.1|6096239_6098156_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	40.1	6.7e-112
