The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041649	Klebsiella pneumoniae strain NKU_KlebA1 chromosome, complete genome	5250274	5148	13925	5250274	integrase	Salmonella_phage(50.0%)	11	4722:4735	15607:15620
4722:4735	attL	TTTGTACTCTTCCA	NA	NA	NA	NA
WP_023279535.1|5148_6132_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.8	1.2e-45
WP_014907826.1|6183_6738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012542199.1|6740_6956_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_012542200.1|7057_7447_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_104510925.1|8061_8280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016160636.1|8289_8484_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|8526_8871_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_117077010.1|9012_11151_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.3	3.6e-98
WP_012542206.1|11203_11449_+	excisionase	NA	NA	NA	NA	NA
WP_117077009.1|11429_12557_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|12674_13925_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
15607:15620	attR	TGGAAGAGTACAAA	NA	NA	NA	NA
>prophage 2
NZ_CP041649	Klebsiella pneumoniae strain NKU_KlebA1 chromosome, complete genome	5250274	133101	205280	5250274	tail,integrase,protease,portal,head,plate,capsid,terminase	Enterobacteria_phage(46.67%)	69	128321:128340	207822:207841
128321:128340	attL	CTGTCGACGCTGTTTGGCGG	NA	NA	NA	NA
WP_023279565.1|133101_133347_+	hypothetical protein	NA	A0A0A7NPW2	Enterobacteria_phage	56.8	4.2e-19
WP_085834699.1|133347_133563_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_019724745.1|133591_133840_-	Late control protein ogr	NA	NA	NA	NA	NA
WP_085834698.1|133884_135039_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	1.1e-178
WP_085834697.1|135191_136373_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.8	1.6e-156
WP_085834696.1|136372_136888_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	2.2e-57
WP_085834695.1|136942_137242_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	76.8	1.3e-33
WP_102005025.1|137238_137415_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
WP_151362728.1|137404_137992_+	hypothetical protein	NA	B9A7B3	Serratia_phage	50.3	9.7e-38
WP_151362729.1|137991_139272_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	61.8	4.3e-107
WP_151362730.1|139364_140114_+	hypothetical protein	NA	A0A0A7NRZ9	Enterobacteria_phage	37.9	8.4e-34
WP_087638598.1|140123_140612_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	60.5	6.8e-53
WP_151362731.1|140740_141898_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.3	1.5e-45
WP_085834691.1|142013_142247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151362732.1|142263_143676_-	hypothetical protein	NA	X4YDU4	Salmonella_phage	42.7	3.5e-09
WP_064169234.1|144444_145344_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	59.9	3.2e-88
WP_064169233.1|145330_145699_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.1	1.0e-29
WP_085834720.1|145695_146280_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.9	1.1e-62
WP_085834718.1|146913_147372_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	49.0	5.6e-33
WP_129902296.1|147516_147912_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032424784.1|148455_148737_-	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	8.2e-19
WP_102004937.1|148727_148928_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	2.3e-15
WP_102004936.1|148927_149425_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	70.3	4.5e-60
WP_102004935.1|149527_150454_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	76.4	2.8e-87
WP_102004934.1|150501_151551_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	1.3e-104
WP_102004933.1|151575_152409_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.2	2.9e-96
WP_102004932.1|152569_154291_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.0	9.0e-225
WP_087638602.1|154290_155343_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.6	2.5e-140
WP_102004931.1|155791_156250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117027739.1|157306_158065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102004929.1|158902_161212_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.9	1.7e-202
WP_102004928.1|161210_161588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102004927.1|162071_163040_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	50.8	1.6e-77
WP_023279602.1|163624_163849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032415217.1|163917_164190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201494.1|164192_164432_-	DUF4754 domain-containing protein	NA	NA	NA	NA	NA
WP_087638608.1|164443_164623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040150881.1|165258_165561_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	51.0	1.9e-21
WP_063106262.1|165648_166656_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.5	4.0e-100
WP_004183618.1|166752_168000_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_004141456.1|168152_168602_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002898602.1|169525_169747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898600.1|170003_170126_+	small membrane protein	NA	NA	NA	NA	NA
WP_002898595.1|171987_173409_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_004176617.1|173622_174387_+	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_002898590.1|174412_174970_+	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_023302080.1|175290_176778_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_002898582.1|178056_178998_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012068535.1|179101_180187_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_002898571.1|182284_183409_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_021462870.1|183427_184876_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_064159653.1|184933_185899_+	oxidoreductase	NA	NA	NA	NA	NA
WP_004176625.1|186320_186608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023316649.1|186586_187207_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002898458.1|189484_190144_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
WP_002898457.1|190232_190562_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_004150835.1|190558_190840_-	acylphosphatase	NA	NA	NA	NA	NA
WP_032424766.1|190888_191677_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_143928273.1|192438_193641_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_002898441.1|193700_194018_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002898432.1|194614_195073_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_009308304.1|195084_197139_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
WP_002898422.1|197726_199862_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_004150836.1|199875_200472_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_071531182.1|200562_200802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002898418.1|200820_201330_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002898408.1|201682_202753_+	porin OmpA	NA	NA	NA	NA	NA
WP_065519824.1|202884_203337_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_048265355.1|203522_205280_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
207822:207841	attR	CCGCCAAACAGCGTCGACAG	NA	NA	NA	NA
>prophage 3
NZ_CP041649	Klebsiella pneumoniae strain NKU_KlebA1 chromosome, complete genome	5250274	2744293	2781093	5250274	integrase,tail,plate,capsid,tRNA,terminase,lysis,holin	Escherichia_phage(30.77%)	44	2744256:2744272	2745980:2745996
2744256:2744272	attL	TTTGCCAATATTTGCCA	NA	NA	NA	NA
WP_047718525.1|2744293_2745310_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	96.7	9.8e-195
WP_143928270.1|2745309_2745897_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	94.2	2.2e-98
WP_047718526.1|2746305_2746815_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	97.0	4.0e-88
2745980:2745996	attR	TGGCAAATATTGGCAAA	NA	NA	NA	NA
WP_047719163.1|2746822_2747023_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	3.3e-30
WP_032454119.1|2746986_2747325_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
WP_032454118.1|2747393_2747621_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	74.7	4.6e-20
WP_151362748.1|2747620_2747908_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	87.5	2.0e-28
WP_047718529.1|2747841_2748123_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
WP_151362749.1|2748115_2750317_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	91.5	0.0e+00
WP_104456310.1|2750458_2750899_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	82.5	4.4e-59
WP_064388417.1|2750981_2751713_+	hypothetical protein	NA	Q37850	Escherichia_phage	89.3	4.7e-122
WP_023327792.1|2751842_2752643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102004973.1|2752730_2752940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143928267.1|2754026_2754704_-|terminase	terminase-like family protein	terminase	S4TT96	Salmonella_phage	31.0	8.7e-22
WP_102004971.1|2756635_2757490_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	2.1e-126
WP_020316749.1|2757563_2758622_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	84.1	2.2e-165
WP_143928269.1|2758625_2759369_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	80.1	3.0e-100
WP_004175163.1|2759970_2760174_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	80.6	4.2e-25
WP_004195910.1|2760178_2760469_+|holin	holin	holin	O80308	Escherichia_phage	85.7	5.3e-37
WP_102004969.1|2760455_2760953_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	86.7	1.1e-79
WP_101863058.1|2760949_2761381_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	67.6	9.6e-43
WP_117059804.1|2761262_2761514_+|holin	holin	holin	S4TNY4	Salmonella_phage	71.2	9.9e-24
WP_102004968.1|2761476_2761944_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	76.1	6.3e-64
WP_070544311.1|2761936_2762386_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.7	2.5e-49
WP_102004967.1|2762454_2763096_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.9	5.2e-93
WP_102004966.1|2763092_2763440_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	3.7e-45
WP_102004965.1|2763444_2764353_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.9	7.1e-112
WP_102004964.1|2764345_2764942_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	54.7	4.3e-49
WP_151362750.1|2764946_2766536_+	hypothetical protein	NA	X4YDU4	Salmonella_phage	34.2	8.9e-09
WP_143928313.1|2766554_2766788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151362751.1|2766903_2768061_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.3	4.3e-45
WP_102005027.1|2768170_2769352_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
WP_014343412.1|2769365_2769881_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_004195711.1|2769940_2770216_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_015959005.1|2770230_2770368_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
WP_143928286.1|2770360_2772799_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	71.7	8.1e-288
WP_032420037.1|2772815_2773295_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.7	6.9e-66
WP_048288857.1|2773294_2774461_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	81.7	4.7e-177
WP_032420109.1|2774528_2774747_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_002917636.1|2775104_2775611_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|2775709_2777551_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_023342604.1|2777769_2779515_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|2779626_2779842_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004900709.1|2780079_2781093_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
>prophage 4
NZ_CP041649	Klebsiella pneumoniae strain NKU_KlebA1 chromosome, complete genome	5250274	4718825	4725254	5250274		Escherichia_phage(100.0%)	7	NA	NA
WP_001620097.1|4718825_4719914_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|4720000_4720261_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|4720558_4721419_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_071785981.1|4722190_4722424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903955.1|4722461_4723364_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004183946.1|4723375_4724641_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|4724633_4725254_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP041649	Klebsiella pneumoniae strain NKU_KlebA1 chromosome, complete genome	5250274	4992066	5041314	5250274	tail,integrase,transposase,terminase,holin	Klebsiella_phage(22.92%)	61	4983589:4983604	5038621:5038636
4983589:4983604	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_117071669.1|4992066_4995135_-	kinase	NA	A0A286S259	Klebsiella_phage	92.4	0.0e+00
WP_064179058.1|4995131_4995512_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	92.1	4.9e-67
WP_117071670.1|4995522_4996005_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	89.4	3.0e-77
WP_117071671.1|4996185_4996650_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	66.4	1.4e-55
WP_023327998.1|4996964_4997300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032416165.1|4997383_5000281_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	3.5e-104
WP_077255553.1|5000354_5000837_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	43.6	1.1e-18
WP_004217333.1|5000833_5001190_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_016831940.1|5001266_5001473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032416161.1|5002145_5003318_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|5003341_5003734_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_032416160.1|5003730_5004282_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	40.5	2.0e-29
WP_004217344.1|5004283_5004667_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|5004653_5004887_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004190649.1|5004896_5005151_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_008807837.1|5005152_5005548_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_004190653.1|5005869_5006823_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_016946679.1|5006833_5007619_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_032416159.1|5007703_5008816_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.5	5.6e-111
WP_032416157.1|5010198_5011506_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.1	6.1e-149
WP_004218556.1|5011483_5012488_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004244013.1|5013035_5013221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218558.1|5013349_5013595_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_019405025.1|5014408_5014603_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
WP_004190672.1|5014553_5014829_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|5014825_5015170_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_008807831.1|5015166_5015706_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	1.5e-101
WP_123229826.1|5015702_5016002_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	9.9e-47
WP_094686393.1|5016757_5017904_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	91.5	1.6e-145
WP_072032791.1|5018947_5019394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047694602.1|5019299_5019557_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	97.6	2.4e-41
WP_023287514.1|5019891_5020713_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_020804605.1|5020828_5021185_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	3.3e-41
WP_020804598.1|5021181_5021478_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_072032790.1|5021480_5021687_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	74.2	2.8e-24
WP_022631485.1|5021686_5022286_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.9	1.7e-90
WP_022631486.1|5022343_5022565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631487.1|5022642_5022876_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	67.5	7.0e-24
WP_022631188.1|5023476_5024319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086538002.1|5024308_5025352_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_022631186.1|5025605_5025842_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	92.1	2.4e-32
WP_022631185.1|5025834_5026038_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	3.7e-29
WP_022631184.1|5026034_5026403_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	44.3	6.4e-11
WP_135728351.1|5026410_5027160_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	80.3	3.0e-116
WP_022631181.1|5028066_5028861_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.3	6.3e-64
WP_022631179.1|5028989_5029526_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	69.5	4.4e-61
WP_071784508.1|5029528_5029792_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071836339.1|5029888_5030245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631177.1|5030471_5030780_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
WP_022631176.1|5030871_5030970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179600.1|5031076_5031268_+	YebW family protein	NA	NA	NA	NA	NA
WP_023282477.1|5031276_5031432_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_143928259.1|5031568_5034664_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.6	2.4e-292
WP_135728349.1|5034675_5035785_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	85.6	1.6e-182
WP_072201173.1|5035828_5036485_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	63.1	9.1e-69
WP_016160778.1|5036481_5036790_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	3.2e-24
WP_004892750.1|5036797_5037037_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_072031515.1|5037046_5037361_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	2.1e-10
WP_096903177.1|5037257_5038445_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	8.4e-121
WP_023285021.1|5038621_5039512_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
5038621:5038636	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140269.1|5040504_5041314_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 6
NZ_CP041649	Klebsiella pneumoniae strain NKU_KlebA1 chromosome, complete genome	5250274	5156945	5250265	5250274	tail,protease,portal,head,plate,capsid,terminase,holin	Enterobacteria_phage(45.61%)	95	NA	NA
WP_072000001.1|5156945_5157197_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	4.5e-08
WP_032424846.1|5157240_5158380_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_117053929.1|5158534_5159707_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.0	2.1e-156
WP_009486472.1|5159706_5160222_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.8e-57
WP_004131585.1|5160266_5160584_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_071993210.1|5160604_5160742_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_125346246.1|5160728_5163704_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.2	4.9e-218
WP_125346245.1|5163719_5164187_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	65.4	9.1e-55
WP_143928256.1|5164401_5165091_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_151362764.1|5165419_5166244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105491132.1|5166473_5167571_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	3.4e-07
WP_009486478.1|5167570_5167783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143928255.1|5167779_5170806_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_143928254.1|5170795_5171719_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_017898624.1|5171720_5172071_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
WP_110540605.1|5172067_5172652_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	57.8	8.7e-55
WP_031593577.1|5172648_5173284_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	2.3e-56
WP_023328065.1|5173280_5173748_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	5.4e-47
WP_050594805.1|5173748_5174024_-	hypothetical protein	NA	B6SD31	Bacteriophage	34.1	6.6e-05
WP_031593580.1|5173929_5174259_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_023339943.1|5174270_5174816_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|5174812_5175097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|5175087_5175288_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_143928253.1|5175287_5175803_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_125346239.1|5175907_5176774_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	57.4	4.0e-72
WP_004213107.1|5176823_5177858_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
WP_040181436.1|5177867_5178707_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_143928252.1|5178863_5180591_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.7	6.7e-228
WP_143928251.1|5180584_5181646_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	5.9e-142
WP_143928250.1|5182344_5184528_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_143928249.1|5184505_5186554_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_032425456.1|5189866_5190094_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	50.0	7.1e-05
WP_032424826.1|5190102_5190669_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	1.6e-13
WP_023328079.1|5190966_5191230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112070298.1|5191245_5191623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131515.1|5191638_5191857_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
WP_004131514.1|5191877_5192156_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.8	5.3e-42
WP_004213095.1|5192276_5192576_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_032417006.1|5193939_5194953_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|5195010_5195112_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|5195111_5195186_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|5195302_5195428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|5195486_5195750_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|5195880_5196519_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|5196608_5197523_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004140494.1|5199528_5200737_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_049186422.1|5200810_5202595_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	4.5e-17
WP_021313530.1|5202601_5203492_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|5203612_5205121_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|5205431_5206118_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_074422711.1|5206155_5206473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140501.1|5206515_5206695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|5206734_5207367_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|5207933_5208131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|5208246_5209257_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004179357.1|5210714_5211602_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|5211618_5212125_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|5212151_5212646_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|5212736_5212922_-	general stress protein	NA	NA	NA	NA	NA
WP_004213087.1|5213141_5213477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140529.1|5213544_5214738_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|5214850_5215078_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_032424496.1|5215098_5215284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077265841.1|5215231_5215531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150797.1|5215527_5215851_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|5215843_5216236_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004892953.1|5217217_5217370_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_110540609.1|5219081_5228018_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	44.7	0.0e+00
WP_016530340.1|5228080_5228671_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.0	2.5e-81
WP_023342884.1|5228702_5229413_-	hypothetical protein	NA	Q6UAW4	Klebsiella_phage	90.7	1.1e-136
WP_016530342.1|5229414_5230170_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.1	1.3e-130
WP_023342885.1|5230166_5230514_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	67.8	4.7e-40
WP_101992312.1|5230518_5233662_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	73.2	0.0e+00
WP_071609142.1|5233645_5233960_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	75.0	5.0e-41
WP_072216832.1|5233980_5234409_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.0	2.7e-37
WP_016530349.1|5234419_5235163_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	83.0	1.7e-111
WP_016530350.1|5235171_5235573_-|tail	minor tail family protein	tail	K7PHM6	Enterobacterial_phage	75.6	2.7e-55
WP_016530351.1|5235569_5236148_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	81.2	1.7e-79
WP_023342887.1|5236151_5236427_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	57.1	1.1e-23
WP_016530353.1|5236419_5236746_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.7	8.1e-34
WP_101992313.1|5236829_5238857_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	81.9	0.0e+00
WP_023342889.1|5238801_5240304_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.0	2.8e-246
WP_023342890.1|5240303_5240516_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	80.0	2.9e-24
WP_101992314.1|5240512_5242615_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	82.4	0.0e+00
WP_023342892.1|5242614_5243103_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	87.7	1.3e-72
WP_077269580.1|5243334_5243757_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	7.5e-40
WP_069345829.1|5243753_5244071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898990.1|5244022_5244385_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
WP_017898989.1|5244538_5244760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898988.1|5244866_5245055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017898986.1|5246134_5246485_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
WP_023279523.1|5246481_5246979_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
WP_017880269.1|5246978_5247194_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_004147997.1|5248168_5248372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143928246.1|5249233_5250265_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.3	1.1e-95
>prophage 1
NZ_CP041648	Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence	164805	7010	74735	164805	transposase,integrase	Escherichia_phage(25.93%)	62	11352:11411	64280:64938
WP_001067858.1|7010_7715_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_074150773.1|7750_8095_+	resolvase	NA	A0A219YB42	Aeromonas_phage	44.6	9.8e-14
WP_001516695.1|8413_9070_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|11241_11946_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
11352:11411	attL	TGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCA	NA	NA	NA	NA
WP_001330846.1|12681_12927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|12932_13124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|13605_14148_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|14160_15021_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|15731_16436_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_074150773.1|16471_16816_+	resolvase	NA	A0A219YB42	Aeromonas_phage	44.6	9.8e-14
WP_001516695.1|17134_17791_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001143760.1|19243_22249_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|22412_22970_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|23152_24013_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_025714822.1|24253_24970_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000677445.1|25004_25640_-	type 3 fimbria minor subunit MrkF	NA	NA	NA	NA	NA
WP_124053727.1|26638_29125_-	type 3 fimbria usher protein MrkC	NA	NA	NA	NA	NA
WP_143928310.1|29932_30541_-	type 3 fimbria major subunit MrkA	NA	NA	NA	NA	NA
WP_040120302.1|30881_31805_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	7.1e-176
WP_071885288.1|32059_32488_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_116967863.1|34282_35116_-	oxidoreductase	NA	NA	NA	NA	NA
WP_012540028.1|35220_36141_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_116967864.1|36436_37870_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_130951664.1|39625_39955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116967867.1|40168_40258_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_116967868.1|40257_41943_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_116967869.1|41961_44004_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.6	3.9e-33
WP_116967870.1|44014_44590_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_116967871.1|44599_47302_+	two-component system sensor histidine kinase KdbD	NA	W8CYF6	Bacillus_phage	25.4	1.2e-16
WP_116967872.1|47298_47967_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.3	4.4e-26
WP_117030206.1|48447_48660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029497506.1|48779_48968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409241.1|48964_49222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309890.1|49273_50131_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_012539968.1|50123_50195_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_009309889.1|50423_50675_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_048338015.1|50811_51291_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.0	3.1e-18
WP_048338014.1|51274_54229_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.6	0.0e+00
WP_000427623.1|54493_55498_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|55576_56134_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|56127_56499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|56495_56996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|56992_57319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|57573_57930_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|58263_58968_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|59141_59906_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001297012.1|59993_60107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|60412_60913_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|61039_61879_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001261740.1|62382_63174_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_015057121.1|63319_64279_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|64169_64874_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004118534.1|65629_66004_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
64280:64938	attR	TGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
WP_001549953.1|66532_67729_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|67800_68628_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|68646_70125_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|70608_70962_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|71057_72341_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|72390_72819_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_004118521.1|72876_73599_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
WP_001549890.1|73595_73928_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009309887.1|74423_74735_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.0	2.1e-15
>prophage 2
NZ_CP041648	Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence	164805	133314	141256	164805	integrase	Escherichia_phage(50.0%)	7	136793:136806	141728:141741
WP_032425559.1|133314_134286_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.4e-73
WP_001568036.1|134519_134951_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_101978616.1|136302_137280_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.5	1.4e-86
136793:136806	attL	TTAAATCCGGACTC	NA	NA	NA	NA
WP_011977818.1|137276_138482_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_151362723.1|138526_138760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568031.1|139183_139939_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
WP_020277927.1|140473_141256_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.5	1.9e-52
141728:141741	attR	TTAAATCCGGACTC	NA	NA	NA	NA
