The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042627	Escherichia coli strain NCYU-25-82 chromosome, complete genome	4976035	355265	453773	4976035	capsid,tail,tRNA,holin,plate,terminase,lysis,portal	Escherichia_phage(42.11%)	68	NA	NA
WP_000968208.1|355265_355961_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001295452.1|355957_356356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316710.1|356594_357542_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|357913_357997_-	protein YohP	NA	NA	NA	NA	NA
WP_151316712.1|358220_359657_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_151316715.1|359709_360471_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001295454.1|361347_361935_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_151316717.1|363078_364794_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_151316719.1|364917_365904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221805.1|368535_369693_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569329.1|369685_370612_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	7.4e-24
WP_001216961.1|371327_371435_-	protein YohO	NA	NA	NA	NA	NA
WP_151316721.1|371494_372226_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_151316723.1|374128_374848_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|374894_375365_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|375404_375866_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|375990_377991_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_094318115.1|377987_379124_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	1.2e-161
WP_151316725.1|381407_382496_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636923.1|383736_384054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316727.1|397685_398750_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001403727.1|399012_399294_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|399592_400135_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|400222_400897_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_151293689.1|404522_404861_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_151316729.1|405079_405904_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_094318109.1|407304_408105_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_044861718.1|408169_408988_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000434038.1|409039_409786_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094318108.1|410719_411724_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	9.9e-14
WP_151316731.1|411740_412997_-	MFS transporter	NA	NA	NA	NA	NA
WP_151317760.1|414614_415469_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853886.1|415498_416761_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000823272.1|417252_417537_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_151293693.1|420082_420862_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|420943_421843_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|422248_422566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032185246.1|422553_422769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001306384.1|423959_424259_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_151316733.1|424373_424649_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	98.9	1.1e-47
WP_000217682.1|424826_425327_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_000557701.1|425389_425614_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277958.1|425613_425916_+	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113263.1|425915_426140_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_001607702.1|426136_426412_+	hypothetical protein	NA	Q858T5	Yersinia_virus	98.9	1.5e-44
WP_151316735.1|432109_433144_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	1.8e-199
WP_021539399.1|433143_434916_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_151316737.1|435089_435944_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.4	1.6e-137
WP_001248553.1|436002_437076_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	6.7e-202
WP_151316739.1|437079_437823_+|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	97.6	5.1e-124
WP_063078357.1|438428_438632_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	98.5	1.2e-30
WP_000123123.1|438635_438917_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|438916_439414_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_151316741.1|439428_439854_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.7	2.5e-59
WP_151316743.1|439841_440267_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	95.7	1.5e-64
WP_000917188.1|440373_440841_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_113897885.1|440833_441292_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.1	1.2e-43
WP_001534994.1|443108_444017_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_151316745.1|444009_444621_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	96.6	3.0e-114
WP_113705978.1|446812_446923_-	hypothetical protein	NA	M1SNQ2	Escherichia_phage	83.3	1.0e-09
WP_001485155.1|446941_447148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251408.1|448373_448892_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_151293696.1|448948_449224_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	1.8e-39
WP_000785970.1|449256_449376_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_151317761.1|449654_451817_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	98.3	0.0e+00
WP_097477420.1|451831_452311_+|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	99.4	4.3e-84
WP_151316747.1|452310_453474_+	phage late control D family protein	NA	A0A0F7LDR0	Escherichia_phage	98.7	4.7e-201
WP_000468308.1|453554_453773_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
>prophage 2
NZ_CP042627	Escherichia coli strain NCYU-25-82 chromosome, complete genome	4976035	606895	663569	4976035	head,capsid,tail,protease,holin,plate,terminase,portal	Escherichia_phage(34.38%)	60	NA	NA
WP_151316804.1|606895_608755_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_077039690.1|610570_610825_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.2	4.2e-14
WP_077039691.1|610975_611248_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_077039692.1|613411_613615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151316806.1|614323_615586_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.8	7.6e-72
WP_000096344.1|617984_618188_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_151317763.1|618246_618771_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	5.4e-56
WP_151316808.1|620059_620689_-	hypothetical protein	NA	A0A088CD28	Shigella_phage	53.3	1.0e-45
WP_001070255.1|620782_620974_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|620970_621159_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|621558_621723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151316810.1|621726_621945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092153.1|622037_622238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317764.1|624858_625281_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.9	6.5e-76
WP_151316812.1|625465_625930_+	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_039005578.1|626430_626619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122998651.1|626600_626732_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	69.4	3.0e-08
WP_040073344.1|626776_626989_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	9.9e-25
WP_000975572.1|627206_627470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151316813.1|627536_627815_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	2.8e-11
WP_024188444.1|627816_628872_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
WP_000139992.1|628872_629238_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	7.1e-39
WP_151316814.1|629234_629924_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	3.1e-59
WP_000839572.1|630719_630935_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_151316815.1|631309_631843_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	2.5e-101
WP_032172123.1|632059_632245_+	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.7	3.2e-19
WP_001114684.1|632485_632971_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000671995.1|633215_633416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140101.1|633423_633774_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	2.3e-63
WP_151316816.1|633755_633992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312917.1|633921_634404_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_000614825.1|636802_637024_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_151316817.1|637087_637363_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001038671.1|637424_638003_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	63.6	9.2e-57
WP_151316818.1|638343_638556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316819.1|638613_638811_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	43.1	7.3e-06
WP_151316820.1|638869_639220_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_151316821.1|639212_639422_+	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_151316822.1|639414_639627_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	42.4	2.3e-05
WP_151316823.1|639616_639835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151316824.1|639841_640156_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_151316825.1|642482_642908_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_151316826.1|642923_643217_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_151316827.1|643536_644010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316828.1|644304_645450_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	67.7	2.2e-142
WP_032082971.1|645499_646060_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.4	5.7e-88
WP_151316829.1|646102_647275_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.7	4.6e-204
WP_001288063.1|647267_647567_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	6.1e-28
WP_001145897.1|647566_648007_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_130532866.1|647996_648176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151316830.1|648154_648334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151316831.1|648278_648653_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.0	1.1e-47
WP_071533699.1|650385_650565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316832.1|653632_654838_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.0	8.5e-222
WP_151316833.1|655089_655395_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	98.0	9.2e-40
WP_001147820.1|655403_655742_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_001209399.1|656183_656528_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_151316834.1|657307_657979_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.8	3.2e-77
WP_151316835.1|662286_663030_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	7.3e-147
WP_151316836.1|662966_663569_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	7.6e-86
>prophage 3
NZ_CP042627	Escherichia coli strain NCYU-25-82 chromosome, complete genome	4976035	1215516	1307829	4976035	head,capsid,tail,holin,transposase,plate,terminase	Escherichia_phage(44.44%)	67	NA	NA
WP_001339197.1|1215516_1216725_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_151316951.1|1216823_1217351_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|1217595_1217769_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_151316952.1|1217803_1217989_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_151316953.1|1218419_1220027_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_151316954.1|1220064_1220988_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151316955.1|1221204_1222548_+	VOC family protein	NA	NA	NA	NA	NA
WP_097762132.1|1224567_1224795_+	hypothetical protein	NA	A9CR10	Bovine_papillomavirus	94.9	1.0e-11
WP_001339197.1|1224734_1225943_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_151316956.1|1227207_1228647_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_085008035.1|1228843_1229644_-	YdcF family protein	NA	NA	NA	NA	NA
WP_151316957.1|1234013_1234619_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_151316958.1|1237747_1238269_-	cytidylyltransferase	NA	NA	NA	NA	NA
WP_151316959.1|1238235_1238640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094318189.1|1238639_1239245_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000039881.1|1241206_1242157_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_151316960.1|1242257_1243571_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206188.1|1243597_1244803_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_151316961.1|1245213_1246641_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_151316962.1|1246642_1247431_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_151317773.1|1247430_1248198_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001189193.1|1249272_1249770_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000073393.1|1250538_1250826_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_151317774.1|1252072_1254094_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_151316963.1|1254341_1256615_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_151316964.1|1258405_1259311_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001296730.1|1259482_1259809_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|1259816_1260002_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000762229.1|1262842_1263832_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001298828.1|1263942_1264365_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1264361_1264628_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_151316965.1|1264901_1268426_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_151316966.1|1268791_1269925_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	7.0e-117
WP_001082294.1|1270065_1270500_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_151317775.1|1271038_1271602_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	90.9	8.3e-95
WP_151316967.1|1273621_1274710_-	late control protein	NA	R9TNM7	Vibrio_phage	28.9	9.6e-31
WP_001107808.1|1274700_1274919_-|tail	tail protein	tail	A0A077K8R0	Ralstonia_phage	49.3	3.2e-10
WP_000228002.1|1274893_1275382_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	1.1e-13
WP_151317776.1|1280109_1281228_-|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	48.9	6.1e-65
WP_063082228.1|1282079_1282994_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	42.9	1.4e-59
WP_000579229.1|1282968_1283325_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	45.5	6.1e-19
WP_151316968.1|1283966_1284518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316969.1|1284529_1285252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151317777.1|1285232_1285634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372342.1|1285636_1286002_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_151316970.1|1286052_1287081_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.7	2.9e-109
WP_000598335.1|1287150_1287486_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.3	2.3e-20
WP_000263126.1|1290695_1290905_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	49.2	1.4e-10
WP_151316971.1|1292140_1292869_-|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	72.4	2.2e-95
WP_151317778.1|1292798_1293230_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	97.0	2.7e-45
WP_000415836.1|1293648_1294044_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	96.9	7.0e-48
WP_001305859.1|1294396_1294510_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	89.2	2.5e-11
WP_001294583.1|1295636_1296029_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	89.2	5.7e-50
WP_000823297.1|1296086_1296512_-	subtilase	NA	NA	NA	NA	NA
WP_000940341.1|1298520_1299120_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	2.7e-107
WP_097410589.1|1299631_1299844_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.8	2.2e-16
WP_151316972.1|1300473_1301004_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	89.0	2.0e-37
WP_151316973.1|1301005_1301224_-	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	94.4	4.7e-30
WP_151316974.1|1301883_1302183_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	98.0	2.5e-50
WP_151316975.1|1302503_1303082_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	82.7	4.6e-72
WP_151316976.1|1303256_1304003_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	81.3	3.3e-115
WP_001383993.1|1304009_1304804_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.5	1.5e-41
WP_000171139.1|1305289_1305565_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_001253183.1|1305669_1306134_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	70.2	1.2e-54
WP_001169150.1|1306515_1306668_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
WP_000560223.1|1307088_1307310_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001372690.1|1307553_1307829_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	97.8	4.7e-43
>prophage 4
NZ_CP042627	Escherichia coli strain NCYU-25-82 chromosome, complete genome	4976035	1458043	1569171	4976035	head,tail,protease,tRNA,holin,terminase,portal	Escherichia_phage(32.26%)	78	NA	NA
WP_001299679.1|1458043_1459300_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000823885.1|1463939_1464218_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|1464495_1465080_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_151317006.1|1473344_1473977_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_151317007.1|1473987_1475406_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000576838.1|1481325_1482180_+	ModD protein	NA	NA	NA	NA	NA
WP_000511313.1|1484223_1484478_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_151317008.1|1484678_1485413_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_085008895.1|1486126_1487041_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_151317009.1|1487135_1488872_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_151317010.1|1491095_1492166_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_151317011.1|1492175_1493480_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190854.1|1493803_1495336_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|1495387_1496107_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_151317012.1|1496369_1497872_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|1498017_1498548_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000897378.1|1499860_1500280_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_004152765.1|1500357_1501842_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|1501841_1502093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001306826.1|1502558_1503470_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807622.1|1503676_1504138_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284275.1|1504214_1504874_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000695220.1|1505479_1505881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056840.1|1506000_1506369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001185665.1|1508426_1508693_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|1509171_1509291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324488.1|1509251_1509437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|1509537_1509711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000726974.1|1509712_1510057_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_089617396.1|1510066_1510396_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001299921.1|1513528_1513747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065752.1|1515734_1515983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151317013.1|1516095_1516362_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_151317014.1|1516390_1516663_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554146.1|1516705_1516942_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_151293924.1|1518673_1519405_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.0	2.5e-51
WP_000373101.1|1519625_1520030_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032143442.1|1520082_1520193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317015.1|1521149_1522400_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000476090.1|1523233_1523695_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_151317016.1|1523748_1524855_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1524890_1525532_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_054191721.1|1530447_1531674_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|1531923_1533060_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799406.1|1533043_1533907_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_151317017.1|1534139_1534721_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.1	1.4e-97
WP_104920213.1|1538140_1538740_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	1.6e-107
WP_151317018.1|1538809_1542286_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	90.5	0.0e+00
WP_151317019.1|1542357_1542987_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	83.0	1.4e-61
WP_151317020.1|1543633_1544332_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.1	2.4e-128
WP_151317021.1|1548129_1548612_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	99.2	2.7e-62
WP_151317022.1|1549391_1549736_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	95.6	1.9e-54
WP_000968644.1|1549732_1550182_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_097414130.1|1550178_1550517_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|1550525_1550843_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000999828.1|1552145_1552745_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_151317023.1|1552737_1553964_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	81.9	2.3e-198
WP_151317024.1|1554111_1555869_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_023153903.1|1555868_1556351_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001140101.1|1556497_1556848_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	2.3e-63
WP_151317025.1|1556855_1557056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114684.1|1557300_1557786_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032172123.1|1558026_1558212_-	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.7	3.2e-19
WP_151316815.1|1558428_1558962_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	2.5e-101
WP_000839572.1|1559338_1559554_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_114107272.1|1560213_1560321_-	antiterminator	NA	NA	NA	NA	NA
WP_021526742.1|1560452_1561334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021526743.1|1561349_1561613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024190350.1|1561602_1562001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061091385.1|1562396_1562768_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.7e-35
WP_151317026.1|1562780_1563830_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_024193993.1|1563831_1564110_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013636.1|1564276_1564489_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_151317027.1|1564668_1565334_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_151317028.1|1565508_1565934_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	1.1e-62
WP_021500770.1|1565949_1566504_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	75.9	1.1e-62
WP_151317029.1|1568480_1568906_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|1568889_1569171_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
>prophage 5
NZ_CP042627	Escherichia coli strain NCYU-25-82 chromosome, complete genome	4976035	1662426	1809261	4976035	capsid,tail,protease,integrase,transposase,tRNA	Enterobacteria_phage(43.48%)	76	1673195:1673217	1740623:1740645
WP_085947598.1|1662426_1663588_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_151317047.1|1668005_1670024_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000258765.1|1671806_1672871_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
1673195:1673217	attL	GCCGGATGCGGCGTGAACGCCTT	NA	NA	NA	NA
WP_001199172.1|1673514_1674786_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154396.1|1674791_1675919_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000979516.1|1679135_1679345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000191701.1|1683398_1684037_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|1684323_1685415_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_151317783.1|1685414_1686107_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|1686118_1686505_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_000777653.1|1686512_1687313_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001028095.1|1687921_1688416_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_151317048.1|1688436_1689765_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	1.2e-232
WP_001143120.1|1691007_1691235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317049.1|1695639_1696239_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_094318031.1|1698780_1699953_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120120.1|1700082_1700775_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_151317050.1|1702512_1702815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317784.1|1703011_1704256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151317051.1|1705182_1705539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317052.1|1705540_1706320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089580352.1|1706731_1706881_-|capsid	nucleocapsid protein	capsid	Q9JFR8	Wheat_rosette_stunt_virus	75.8	1.2e-05
WP_151317053.1|1706853_1707438_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.4e-100
WP_151317054.1|1707437_1710797_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_151317055.1|1715557_1716301_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.7	1.0e-140
WP_000847362.1|1717002_1717332_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	1.4e-57
WP_151317056.1|1717328_1719890_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.9	0.0e+00
WP_000459467.1|1719882_1720317_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_151317057.1|1720734_1721475_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	8.6e-132
WP_001761678.1|1722463_1722817_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.7e-61
WP_000158882.1|1722828_1723224_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	3.1e-56
WP_151317058.1|1723457_1723691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317059.1|1723671_1724880_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_151317060.1|1725010_1725196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281200.1|1725426_1725771_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_001303849.1|1725876_1726095_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_040074997.1|1726072_1727146_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.2	5.3e-199
WP_151317061.1|1727240_1729985_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	29.7	1.2e-37
WP_151317062.1|1730025_1731129_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|1731177_1731351_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_094318034.1|1731340_1731571_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|1731545_1731734_-	cold-shock protein	NA	NA	NA	NA	NA
WP_094318035.1|1731744_1731957_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	70.0	5.1e-21
WP_000087763.1|1732242_1732455_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|1732896_1733202_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_151317063.1|1733948_1734695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317064.1|1734694_1736791_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_151292844.1|1736836_1737976_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|1737963_1738410_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000270305.1|1742102_1742195_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
1740623:1740645	attR	GCCGGATGCGGCGTGAACGCCTT	NA	NA	NA	NA
WP_000063978.1|1745888_1746287_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003663.1|1746283_1746871_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|1746867_1747575_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000375136.1|1751221_1751881_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_000904442.1|1751971_1752301_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_151317065.1|1754864_1755527_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|1755622_1756081_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_151317785.1|1756112_1758167_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_001261235.1|1758289_1758736_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_151317066.1|1760869_1761445_-	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000288706.1|1761716_1762226_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_151317067.1|1766760_1766928_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000224273.1|1775042_1776152_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|1776148_1776691_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000919493.1|1778686_1779202_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000730614.1|1779209_1779752_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000845152.1|1783448_1784150_-	molecular chaperone	NA	NA	NA	NA	NA
WP_151317068.1|1784232_1784775_-	fimbrial protein	NA	NA	NA	NA	NA
WP_151317069.1|1785697_1786657_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_151317070.1|1786653_1787799_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_151317071.1|1798503_1799151_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_151317072.1|1799177_1799726_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925997.1|1799906_1801754_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_151317073.1|1806471_1807176_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_151292826.1|1807156_1808479_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_151317074.1|1808475_1809261_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP042627	Escherichia coli strain NCYU-25-82 chromosome, complete genome	4976035	2412653	2521075	4976035	head,capsid,tail,holin,transposase,plate,terminase	Shigella_phage(41.18%)	91	NA	NA
WP_151317185.1|2412653_2414687_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|2414815_2415403_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001159102.1|2416900_2418571_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000370401.1|2419692_2420388_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001102119.1|2421817_2422537_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_151317186.1|2424144_2425470_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.4e-113
WP_001306921.1|2425827_2426421_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_047669952.1|2426580_2427450_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	9.3e-53
WP_151317187.1|2427697_2428555_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151317188.1|2428675_2432929_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_151317189.1|2433493_2434345_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	2.7e-44
WP_094318225.1|2434371_2435361_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_077039280.1|2435391_2436285_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077901644.1|2436484_2437411_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151317190.1|2437567_2438488_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182352.1|2438722_2439865_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000662258.1|2440337_2440439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|2440802_2441066_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|2441065_2441206_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_151317191.1|2441479_2441818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|2442289_2442832_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001624646.1|2442875_2443493_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|2443550_2444219_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_062883179.1|2448367_2449078_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001307600.1|2449390_2449720_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|2449966_2450581_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_151317192.1|2450627_2450837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070694.1|2450998_2451688_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_089518600.1|2451684_2452641_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_001111356.1|2455779_2456190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001107053.1|2456687_2457347_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	29.3	1.3e-11
WP_141094699.1|2457489_2457828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151317193.1|2458627_2459410_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.7	8.7e-34
WP_151317194.1|2459479_2460739_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.5	1.2e-234
WP_000904985.1|2460796_2461351_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	86.7	1.4e-86
WP_094318220.1|2461380_2461761_+	hypothetical protein	NA	I3PGW0	Xanthomonas_phage	30.9	3.0e-08
WP_151317195.1|2463316_2463901_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	2.0e-112
WP_000785329.1|2463891_2464950_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.0	6.8e-199
WP_001532235.1|2465907_2466987_-	hypothetical protein	NA	Q8SBG7	Shigella_phage	98.6	2.9e-205
WP_094317926.1|2466983_2468312_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.4	1.0e-244
WP_000679480.1|2468369_2468900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807179.1|2468992_2470825_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	97.4	5.3e-300
WP_001303047.1|2470811_2471000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107193334.1|2470966_2471236_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	1.0e-42
WP_000090993.1|2471235_2471592_-	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155713.1|2471591_2473088_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.0	4.5e-273
WP_000497751.1|2473071_2473242_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_097492412.1|2473808_2474213_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.2e-71
WP_000927711.1|2474696_2475020_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601365.1|2475022_2475223_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_021578634.1|2475271_2476477_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.0	3.8e-222
WP_000605606.1|2478363_2478546_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_103852454.1|2478557_2480054_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.2	4.8e-299
WP_000929184.1|2480287_2480782_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_104730759.1|2480907_2481258_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	94.0	6.4e-61
WP_151317196.1|2481516_2481867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021574411.1|2481978_2482176_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	87.7	2.4e-25
WP_141094700.1|2482205_2482463_-	peptidase	NA	Q8SBD8	Shigella_phage	71.4	3.4e-27
WP_151317197.1|2482735_2483317_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	98.4	4.1e-105
WP_104730763.1|2483350_2483632_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283162.1|2483618_2484005_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	99.2	9.2e-61
WP_151317791.1|2484150_2484408_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	98.8	1.2e-40
WP_001061438.1|2486321_2487131_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767113.1|2487150_2487540_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_053918604.1|2487536_2487863_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
WP_151317198.1|2487859_2488306_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	93.7	3.5e-72
WP_151317199.1|2488226_2488514_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	98.9	6.6e-48
WP_151317200.1|2488513_2489008_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	8.1e-86
WP_104730765.1|2489934_2490114_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	6.6e-14
WP_000515829.1|2490289_2490847_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000848748.1|2491179_2491854_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000917896.1|2492028_2492325_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000141752.1|2492242_2492488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151317201.1|2493354_2494179_+	DUF2303 family protein	NA	Q8SBF9	Shigella_phage	99.6	2.3e-149
WP_151317202.1|2494306_2494843_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	2.2e-100
WP_059338283.1|2495194_2495500_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	1.5e-50
WP_140427198.1|2495415_2495850_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	97.2	5.1e-76
WP_021556483.1|2499747_2500803_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
WP_000174677.1|2500841_2501243_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_151294242.1|2502635_2503064_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000602112.1|2504869_2505484_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_094317938.1|2506864_2507317_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001408335.1|2508436_2509207_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_151317203.1|2511092_2511413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094317939.1|2511765_2512515_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729709.1|2512724_2512985_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615977.1|2512987_2513266_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|2513421_2514162_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_137553541.1|2515104_2515683_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_094317942.1|2519035_2519806_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001339197.1|2519866_2521075_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 7
NZ_CP042627	Escherichia coli strain NCYU-25-82 chromosome, complete genome	4976035	2913633	2920993	4976035		Enterobacteria_phage(100.0%)	10	NA	NA
WP_044815386.1|2913633_2913828_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_151317296.1|2914791_2915685_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	99.2	3.8e-142
WP_151317297.1|2915596_2916511_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.3	4.1e-168
WP_000856729.1|2916525_2916846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080067034.1|2916981_2917437_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
WP_001244670.1|2917429_2917717_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_011106942.1|2917709_2918114_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	4.8e-60
WP_078167772.1|2918080_2918299_-	Ash domain protein	NA	NA	NA	NA	NA
WP_000638636.1|2919846_2920347_+	transactivation protein	NA	NA	NA	NA	NA
WP_151317298.1|2920420_2920993_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.7	9.3e-94
>prophage 8
NZ_CP042627	Escherichia coli strain NCYU-25-82 chromosome, complete genome	4976035	2932698	3036941	4976035	head,capsid,tail,protease,holin,transposase,plate,terminase,tRNA	Enterobacteria_phage(69.64%)	103	NA	NA
WP_151317300.1|2932698_2933784_+|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0S951	Catovirus	45.3	2.0e-68
WP_151317301.1|2933633_2934158_+|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	35.6	3.7e-20
WP_151317302.1|2934136_2934853_+|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	30.3	2.4e-22
WP_001456866.1|2934864_2935551_+|tRNA	class I tRNA ligase family protein	tRNA	A0A167RAL2	Powai_lake_megavirus	27.2	9.7e-05
WP_001059398.1|2936994_2937498_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_151317303.1|2937543_2937960_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_094317791.1|2938121_2939126_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_151317304.1|2940971_2941424_-	DUF386 domain-containing protein	NA	NA	NA	NA	NA
WP_151317305.1|2941568_2942162_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151317306.1|2942232_2942946_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_151292595.1|2943076_2943472_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|2943754_2943889_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_151317307.1|2943892_2944828_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.4e-51
WP_151317308.1|2944840_2945302_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2945374_2945761_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471889.1|2945966_2948663_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|2948803_2948857_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000187796.1|2953628_2955767_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	6.9e-267
WP_085008114.1|2956431_2956818_-	cytochrome b562	NA	NA	NA	NA	NA
WP_151315626.1|2957000_2958353_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|2958446_2958998_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|2959148_2960522_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_151317797.1|2962708_2963731_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_151317309.1|2963744_2965247_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.8	2.1e-12
WP_000265933.1|2965386_2966343_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055070.1|2966652_2967183_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_151317310.1|2967441_2967633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081178296.1|2968703_2968997_-	helix-turn-helix transcriptional regulator	NA	A0A0A7NPW3	Enterobacteria_phage	72.8	2.2e-30
WP_081178294.1|2969111_2969537_+	hypothetical protein	NA	A0A0A7NPS5	Enterobacteria_phage	98.6	1.3e-76
WP_151317311.1|2969574_2969925_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	96.6	9.5e-57
WP_000514277.1|2970224_2970467_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|2970463_2970577_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_081178288.1|2970670_2971081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985716.1|2971104_2971308_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	1.3e-29
WP_151317312.1|2971304_2971550_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	93.8	5.3e-38
WP_151317313.1|2971546_2971846_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	94.9	6.0e-44
WP_151317314.1|2971857_2972061_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	97.0	2.4e-28
WP_151317315.1|2972057_2972888_+	SPFH/Band 7/PHB domain protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.3	2.8e-131
WP_081178286.1|2972941_2973562_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	44.6	3.5e-09
WP_000599382.1|2973558_2973924_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_151317316.1|2973930_2976753_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_151317317.1|2976829_2977789_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	97.5	1.1e-176
WP_000211254.1|2977793_2978105_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	100.0	5.3e-51
WP_151316786.1|2979794_2980142_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_151317318.1|2980141_2980792_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	41.9	1.4e-16
WP_001163776.1|2980882_2981215_+	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	99.1	5.0e-55
WP_151317319.1|2981211_2981550_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	99.1	3.5e-56
WP_151317320.1|2983088_2984393_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.7	3.4e-240
WP_001437741.1|2984425_2984839_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.5	7.3e-64
WP_151317321.1|2985031_2985829_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	79.2	6.2e-112
WP_001418075.1|2985852_2986044_+|capsid	phage capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	98.3	2.0e-24
WP_151317322.1|2986031_2986904_+|capsid	P2 family phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	99.0	2.2e-163
WP_000063093.1|2987849_2988344_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.6e-89
WP_021520355.1|2988343_2988544_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000104350.1|2988546_2988870_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_097758599.1|2989255_2989663_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	2.2e-65
WP_081178274.1|2990252_2990897_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.2e-114
WP_001271910.1|2990893_2991475_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.6e-101
WP_000213444.1|2991471_2991822_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_151317323.1|2991825_2992722_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.0	4.8e-153
WP_021530511.1|2992714_2993323_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_046077169.1|2994929_2995388_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	2.7e-43
WP_057728534.1|2995387_2995999_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.5	3.8e-85
WP_057728535.1|2996005_2996482_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.2	1.6e-46
WP_001344261.1|2997069_2997402_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	89.0	4.3e-51
WP_151317324.1|2997389_2997668_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	90.8	9.3e-31
WP_151317325.1|2997694_2998186_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	1.3e-83
WP_151317326.1|2998198_3001006_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.1	0.0e+00
WP_000333503.1|3000992_3001148_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651566.1|3001156_3001531_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	1.3e-35
WP_151317798.1|3002097_3003024_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.1	7.1e-176
WP_151317327.1|3003047_3003281_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	3.1e-35
WP_151317328.1|3003438_3004029_+	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	100.0	2.1e-104
WP_151317329.1|3004004_3004547_+	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	88.6	1.7e-81
WP_000488105.1|3004589_3004850_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_094323960.1|3005311_3005545_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_021580365.1|3005537_3005780_-	hypothetical protein	NA	A0A0A7NPW2	Enterobacteria_phage	100.0	7.3e-40
WP_151317330.1|3010072_3011806_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000935042.1|3012974_3014318_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|3014379_3014586_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_151317331.1|3014910_3015468_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|3015457_3016198_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_151317332.1|3016387_3018331_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|3018459_3018840_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151317333.1|3018929_3019790_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_040083513.1|3019897_3020863_+	DMT family transporter	NA	NA	NA	NA	NA
WP_151317334.1|3020970_3021633_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_151294516.1|3021677_3023090_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001324309.1|3024033_3024180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151317799.1|3024238_3024877_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_001308220.1|3025535_3026330_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000135199.1|3026891_3027119_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_094317783.1|3027123_3027438_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|3027444_3027840_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|3028167_3028443_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_151317335.1|3030122_3030773_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_151317336.1|3030786_3031251_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_085008109.1|3031260_3031566_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_151317337.1|3031568_3032978_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_151317338.1|3034504_3035260_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_060616655.1|3035256_3036006_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|3036187_3036517_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_077901634.1|3036665_3036941_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 9
NZ_CP042627	Escherichia coli strain NCYU-25-82 chromosome, complete genome	4976035	3286489	3414566	4976035	head,tail,protease,holin,transposase,plate,terminase,tRNA	Enterobacteria_phage(76.74%)	100	NA	NA
WP_000187022.1|3286489_3287590_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_071703722.1|3287987_3288593_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001440162.1|3288565_3288691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120810.1|3288957_3290358_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_151317384.1|3290340_3291258_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_151317385.1|3291524_3292898_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001362445.1|3292958_3293735_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_151317386.1|3301305_3302157_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323849.1|3302143_3302485_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_038340353.1|3302486_3303365_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_151317387.1|3305680_3306001_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004442.1|3306015_3307095_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_151292509.1|3310587_3311691_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_001297632.1|3312610_3313516_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_151317388.1|3316086_3317010_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000852812.1|3321230_3321548_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_151317389.1|3321731_3322340_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_094191084.1|3322400_3322649_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_151317390.1|3325168_3326194_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000208242.1|3327336_3327867_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000139496.1|3329273_3330200_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001242988.1|3331946_3332249_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_001001394.1|3332344_3332671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813365.1|3332689_3333031_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_149844026.1|3333041_3333320_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	2.0e-33
WP_000514277.1|3333331_3333574_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021654.1|3333570_3333684_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000543037.1|3333777_3334188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001544217.1|3334214_3334418_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	95.5	4.4e-30
WP_032162265.1|3334414_3334633_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	56.9	1.2e-09
WP_151317391.1|3334629_3334842_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	82.1	5.4e-23
WP_071703183.1|3335715_3336336_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	40.0	3.7e-11
WP_151317392.1|3339591_3340551_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	97.8	2.3e-177
WP_001544207.1|3340555_3340867_+	plasmid stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001390707.1|3341231_3341501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317393.1|3343645_3344950_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	5.2e-241
WP_151317394.1|3344990_3345395_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	100.0	4.8e-44
WP_151317395.1|3347508_3348315_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.5	2.6e-118
WP_000063082.1|3348410_3348905_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_151317396.1|3348904_3349105_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	97.0	1.1e-30
WP_000104350.1|3349107_3349431_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_032419535.1|3349427_3349820_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.9e-70
WP_000780572.1|3349816_3350224_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_024132949.1|3350195_3350375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920593.1|3350361_3350829_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356339.1|3350821_3351457_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271944.1|3351453_3352035_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
WP_151317397.1|3352083_3352383_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	1.1e-45
WP_151317398.1|3352386_3353283_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.3e-153
WP_000071724.1|3353275_3353884_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_137594577.1|3356155_3356689_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	85.9	9.0e-83
WP_021578959.1|3356717_3357245_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	96.0	1.1e-91
WP_151317399.1|3358329_3358917_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	99.5	1.2e-104
WP_151317400.1|3358952_3359441_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	5.7e-84
WP_126720720.1|3359453_3362261_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.4	0.0e+00
WP_000763327.1|3362247_3362376_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|3362411_3362777_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|3362831_3363344_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_112045829.1|3363343_3364270_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	4.2e-176
WP_151317327.1|3364293_3364527_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	3.1e-35
WP_151317401.1|3364684_3365785_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.2	1.6e-203
WP_000488103.1|3365827_3366088_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|3366279_3366420_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001519189.1|3366555_3366852_+	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_001353016.1|3367043_3367241_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001296623.1|3368179_3368425_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_151317402.1|3368849_3369701_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.6	1.7e-14
WP_151294659.1|3369718_3371227_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_044794858.1|3371456_3372467_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_151317403.1|3372564_3373311_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_151317404.1|3373315_3373744_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|3373770_3374070_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|3374281_3374722_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_151317405.1|3374841_3375423_+	DUF1454 family protein	NA	NA	NA	NA	NA
WP_001216325.1|3375530_3376298_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000591795.1|3378522_3379485_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_151294668.1|3379665_3380568_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001223800.1|3380715_3381216_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|3381365_3382064_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001166063.1|3384361_3385345_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_151317406.1|3385604_3386225_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	9.3e-63
WP_151317407.1|3386509_3387544_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297062.1|3387540_3388479_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_151317408.1|3388462_3389299_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_151317409.1|3392705_3393494_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619508.1|3393503_3393818_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_151317410.1|3393858_3395253_-	porin	NA	NA	NA	NA	NA
WP_032218862.1|3395730_3396177_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_151317411.1|3396187_3397639_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_151317412.1|3397628_3398699_+	aminopeptidase	NA	NA	NA	NA	NA
WP_151317413.1|3400548_3401604_-	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000753589.1|3401756_3402590_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000331377.1|3405845_3406748_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|3406744_3407380_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_101951903.1|3408436_3408625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151317414.1|3408618_3408861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|3409077_3409296_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303741.1|3409578_3409797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|3411661_3412870_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001339197.1|3413357_3414566_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 10
NZ_CP042627	Escherichia coli strain NCYU-25-82 chromosome, complete genome	4976035	4748227	4879409	4976035	head,capsid,tail,holin,transposase,plate,terminase,tRNA	Enterobacteria_phage(60.87%)	93	NA	NA
WP_000117724.1|4748227_4749034_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.7e-16
WP_151317722.1|4753824_4755651_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.6	1.3e-24
WP_001276460.1|4765627_4765951_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_001144319.1|4766340_4766904_-	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_000857056.1|4766894_4767365_-	prepilin peptidase-dependent protein	NA	NA	NA	NA	NA
WP_151295162.1|4767548_4768343_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.5	3.2e-116
WP_151295161.1|4768349_4769225_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_151317723.1|4771633_4772164_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001453804.1|4772474_4772669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317724.1|4772847_4773537_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_151293321.1|4773605_4774319_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000758655.1|4774456_4774675_+	lipoprotein YgdR	NA	NA	NA	NA	NA
WP_151317725.1|4774782_4775823_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_000899049.1|4777039_4779199_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	NA	NA	NA	NA
WP_000201048.1|4779782_4780814_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_000848664.1|4783124_4783817_-	aspartate/glutamate racemase	NA	NA	NA	NA	NA
WP_151317726.1|4783945_4785364_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	3.0e-24
WP_000383237.1|4786468_4787305_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_151317727.1|4787611_4788772_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_085947598.1|4791329_4792491_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001597763.1|4792711_4792867_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	92.6	2.2e-05
WP_001730411.1|4792926_4793997_+	type II toxin-antitoxin system RnlA family toxin	NA	NA	NA	NA	NA
WP_000461705.1|4793989_4794352_+	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_000429347.1|4794489_4794759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|4795636_4796119_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_151317728.1|4796250_4796727_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4796716_4797007_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4797068_4797410_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001059169.1|4799304_4800183_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|4800305_4800899_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001351298.1|4800953_4802195_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_128999302.1|4802259_4803051_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|4803217_4804579_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_151295206.1|4804715_4804964_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000065253.1|4806369_4806717_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589826.1|4806792_4807275_-	OmpA family protein	NA	NA	NA	NA	NA
WP_001212391.1|4808504_4809023_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_001301878.1|4809172_4809538_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_151317729.1|4809746_4810817_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.6	9.9e-89
WP_000225221.1|4810827_4811949_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|4811991_4813152_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|4813250_4813298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152547.1|4814523_4814826_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_001001394.1|4814921_4815248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024232568.1|4815619_4815907_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	1.0e-32
WP_024232567.1|4816357_4816561_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153674.1|4816557_4816803_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_032419531.1|4816799_4817099_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	9.6e-42
WP_124829034.1|4817110_4817728_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	38.3	2.7e-06
WP_000564227.1|4817724_4818114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317730.1|4818110_4820996_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.7	0.0e+00
WP_024242821.1|4821993_4822305_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	3.2e-48
WP_000970615.1|4823762_4825967_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_072042810.1|4827516_4828821_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.4	4.7e-242
WP_134875591.1|4829033_4829267_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.1	3.7e-33
WP_000180564.1|4829421_4830258_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
WP_151317731.1|4830281_4831334_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	92.0	3.1e-183
WP_000063082.1|4832281_4832776_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_151317396.1|4832775_4832976_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	97.0	1.1e-30
WP_000104350.1|4832978_4833302_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000780572.1|4833686_4834094_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_024132949.1|4834065_4834245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356339.1|4834692_4835328_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271944.1|4835324_4835906_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
WP_151317732.1|4835902_4836253_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	4.6e-59
WP_151317733.1|4836256_4837153_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	2.5e-154
WP_001344261.1|4841421_4841754_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	89.0	4.3e-51
WP_077695075.1|4841741_4842020_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	92.1	2.4e-31
WP_000763327.1|4845341_4845470_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_001603086.1|4845505_4845871_-|tail	phage tail protein E	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.9e-55
WP_112045829.1|4846438_4847365_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	4.2e-176
WP_151317327.1|4847388_4847622_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	3.1e-35
WP_151317734.1|4847780_4848488_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.6	1.5e-125
WP_151317735.1|4848423_4848891_+	hypothetical protein	NA	A0A0A7NQ97	Enterobacteria_phage	85.8	1.9e-60
WP_000488105.1|4848933_4849194_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|4849384_4849525_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001519189.1|4849660_4849957_+	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_072032588.1|4850086_4850293_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000215756.1|4850289_4851096_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_000178456.1|4851246_4851588_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_151317736.1|4851848_4853177_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000079091.1|4854169_4855150_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040150.1|4855146_4855878_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_151293266.1|4856007_4858581_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	5.8e-127
WP_000841103.1|4864354_4865653_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001339197.1|4866083_4867292_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_151317816.1|4867355_4868711_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001098726.1|4872283_4872703_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000627804.1|4874986_4875370_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_060616690.1|4875425_4876013_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|4876115_4876997_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4877205_4878540_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001302911.1|4878671_4879409_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP042628	Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence	209908	18855	92359	209908	transposase	Escherichia_phage(46.67%)	47	NA	NA
WP_151317821.1|18855_19560_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	97.0	1.0e-134
WP_001842401.1|21572_22613_-	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	A0A1S5SF82	Streptococcus_phage	100.0	9.4e-201
WP_151317822.1|23485_23590_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_151317823.1|27321_27516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317824.1|27427_28111_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.9e-130
WP_031613424.1|29799_30150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|30526_30844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|30894_31302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151317825.1|32038_33259_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_001572393.1|33452_33683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024136338.1|33719_34007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|34044_34299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|34344_34578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975182.1|34799_35696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833382.1|36429_37857_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_151317826.1|38107_39427_+	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
WP_000121165.1|39439_39643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317827.1|42103_42538_-	copper-binding protein	NA	NA	NA	NA	NA
WP_151317828.1|42755_44156_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	1.6e-17
WP_020219105.1|45821_46202_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001023257.1|49186_49636_+	copper resistance protein	NA	NA	NA	NA	NA
WP_000843494.1|50694_50892_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000758229.1|53506_53947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151317829.1|57192_58485_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|58598_58952_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000697968.1|60554_61235_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000647571.1|63529_63880_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.5	1.8e-18
WP_075155269.1|65732_65879_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_151317830.1|67095_68022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151292411.1|73185_74028_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_014837933.1|75158_75863_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_151317831.1|76267_76618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001456218.1|76784_77627_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_151317832.1|77722_78331_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_001206316.1|80793_81585_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|81754_82087_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_151317833.1|82226_82406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317834.1|82380_82965_-	hypothetical protein	NA	A0A0K2CZ57	Paenibacillus_phage	41.3	1.3e-34
WP_151317835.1|83258_83954_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.8e-131
WP_077876817.1|83930_84128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151292569.1|84273_85137_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_000034420.1|85890_86682_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_151317836.1|86819_87503_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.1	3.8e-126
WP_151317837.1|87846_88038_+	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_151317838.1|90223_90976_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	3.2e-41
WP_151317839.1|91537_91720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317840.1|91663_92359_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	1.2e-130
>prophage 1
NZ_CP042630	Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-3, complete sequence	138251	7899	54099	138251	transposase,integrase	Escherichia_phage(35.0%)	42	NA	NA
WP_124036660.1|7899_8595_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.2e-132
WP_151317920.1|11497_12181_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.0e-131
WP_001235713.1|12492_13050_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|13232_14093_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000034420.1|14350_15142_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|15610_15856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151292569.1|15893_16757_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|16902_17142_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_151295361.1|17225_17909_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.6e-132
WP_001067855.1|19062_19767_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_104730575.1|19757_19934_+	replication initiator protein	NA	NA	NA	NA	NA
WP_072796249.1|19875_20217_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	97.3	1.1e-54
WP_001351729.1|21900_22293_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_151317921.1|22430_23315_+	EamA family transporter	NA	NA	NA	NA	NA
WP_021536379.1|24623_25301_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_126675515.1|25332_25590_-	relaxase	NA	NA	NA	NA	NA
WP_117109815.1|27210_27915_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_072202717.1|27970_28450_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_001043260.1|29827_30643_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|30729_31032_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|30925_31177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151317940.1|31211_32396_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_151317922.1|32814_33120_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012728215.1|34577_35462_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_046788546.1|37177_37579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000147567.1|40538_41099_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_071830595.1|41224_41575_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_151292574.1|42933_43431_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.1	4.1e-21
WP_001336345.1|43542_43833_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|43838_44630_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_151295362.1|44891_46259_+	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	5.3e-26
WP_001360292.1|46255_47035_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|47204_47537_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_072078461.1|47676_47862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151317923.1|47783_48215_-	hypothetical protein	NA	A0A0K2CZ57	Paenibacillus_phage	36.4	5.5e-14
WP_151317924.1|48081_48417_-	hypothetical protein	NA	A0A0K2CZ57	Paenibacillus_phage	44.3	1.2e-13
WP_151317925.1|48439_48658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011058338.1|48676_48862_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
WP_012386611.1|50896_50983_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_151295361.1|51798_52482_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.6e-132
WP_151317926.1|53112_53238_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_151317927.1|53358_54099_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	5.9e-24
>prophage 1
NZ_CP042632	Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence	94735	0	18668	94735	tail	Escherichia_phage(100.0%)	9	NA	NA
WP_072756847.1|4846_5668_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	99.3	1.3e-157
WP_001077897.1|6056_6812_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_151317971.1|7193_7901_-|tail	phage tail protein	tail	A0A222YY05	Escherichia_phage	99.6	3.0e-126
WP_001112721.1|9025_9598_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	99.5	1.8e-100
WP_112024895.1|12170_12449_-	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	97.8	1.3e-40
WP_151317972.1|14448_14841_+	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	98.5	9.6e-66
WP_121334850.1|15470_15929_-	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	98.7	1.6e-67
WP_151317973.1|17359_18316_+	recombinase	NA	A0A222YXF2	Escherichia_phage	99.4	8.4e-180
WP_151317974.1|18329_18668_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	93.8	3.9e-47
>prophage 2
NZ_CP042632	Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence	94735	21855	52650	94735	integrase,tail	Escherichia_phage(88.0%)	28	34659:34677	61946:61964
WP_151317975.1|21855_22761_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	99.0	7.2e-173
WP_151317976.1|25032_26013_-|tail	tail length tape measure protein	tail	A0A222YXZ0	Escherichia_phage	99.7	4.2e-187
WP_000162415.1|27733_28036_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_001022420.1|28503_28704_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
WP_000542383.1|30674_31004_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_054192267.1|32251_33163_+	hypothetical protein	NA	A0A222YYN1	Escherichia_phage	96.6	1.6e-164
WP_074152145.1|33685_33856_-	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	100.0	1.3e-24
WP_001396852.1|33874_33994_-	hypothetical protein	NA	NA	NA	NA	NA
34659:34677	attL	ATGTTAGAAAACTAATTTA	NA	NA	NA	NA
WP_151295498.1|36161_36446_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	91.5	3.1e-42
WP_109157907.1|37611_37932_+	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	85.8	1.9e-43
WP_068862815.1|38023_38299_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	85.7	5.6e-36
WP_000139733.1|38295_38520_+	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	100.0	9.1e-37
WP_151317977.1|38516_38828_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	96.1	1.6e-55
WP_151317978.1|39613_40609_+	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	98.8	3.3e-195
WP_000158003.1|41388_41592_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_060877083.1|41819_42464_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	52.3	3.0e-48
WP_151317979.1|42460_43213_+	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	76.8	3.5e-96
WP_005025300.1|43390_43600_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	1.1e-33
WP_151317988.1|44538_44739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053272003.1|44741_44993_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	95.2	3.0e-36
WP_151317989.1|45018_45369_+	hypothetical protein	NA	J9Q6E9	Salmonella_phage	64.5	1.5e-33
WP_089477326.1|45992_46415_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	98.6	4.5e-69
WP_151317980.1|47133_47331_+	PdcA protein	NA	A0A222YWI9	Escherichia_phage	90.8	2.5e-22
WP_151317981.1|48807_49302_-	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	93.9	1.4e-85
WP_089477327.1|49298_49775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052936011.1|49771_50080_-	hypothetical protein	NA	Q5QBE7	Escherichia_phage	99.0	4.0e-51
WP_151317982.1|50189_51218_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5XLQ5	Enterobacteria_phage	41.1	7.6e-54
WP_000888609.1|52410_52650_+	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
61946:61964	attR	TAAATTAGTTTTCTAACAT	NA	NA	NA	NA
>prophage 3
NZ_CP042632	Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence	94735	56045	63442	94735		Escherichia_phage(100.0%)	9	NA	NA
WP_001130998.1|56045_56231_-	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
WP_000488304.1|56437_56629_-	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
WP_000579539.1|57662_57827_-	DUF3927 domain-containing protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
WP_000467090.1|57826_58261_-	tellurite resistance TerB family protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
WP_071531510.1|59076_59262_+	hypothetical protein	NA	Q71T99	Escherichia_phage	97.5	3.3e-16
WP_044868367.1|62038_62320_-	hypothetical protein	NA	A0A222YW96	Escherichia_phage	96.8	4.5e-41
WP_001238268.1|62334_62535_-	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
WP_001344838.1|62549_62702_-	hypothetical protein	NA	A0A222YXP1	Escherichia_phage	100.0	7.3e-22
WP_001230915.1|63181_63442_-	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	100.0	1.8e-44
>prophage 4
NZ_CP042632	Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence	94735	71422	71620	94735		Escherichia_phage(100.0%)	1	NA	NA
WP_001344836.1|71422_71620_-	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	100.0	3.1e-33
>prophage 5
NZ_CP042632	Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence	94735	75139	76372	94735	portal	Escherichia_phage(100.0%)	1	NA	NA
WP_151317983.1|75139_76372_-|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	99.0	6.9e-235
>prophage 6
NZ_CP042632	Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence	94735	81267	82040	94735	holin	Escherichia_phage(100.0%)	2	NA	NA
WP_000526264.1|81267_81714_-	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_000457140.1|81713_82040_-|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
>prophage 7
NZ_CP042632	Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence	94735	85621	94643	94735	plate,tail	Enterobacteria_phage(33.33%)	6	NA	NA
WP_151317990.1|85621_86326_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	94.4	4.3e-125
WP_151317984.1|87419_88658_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	64.7	1.5e-144
WP_151317985.1|88696_89242_-	hypothetical protein	NA	A0A1W5P105	Cronobacter_phage	53.0	1.0e-49
WP_151317986.1|89219_89963_-	hypothetical protein	NA	A0A0E3GML4	Enterobacteria_phage	48.9	6.9e-65
WP_001436272.1|91816_91966_-	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	95.9	5.1e-20
WP_151317987.1|93212_94643_-|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	98.5	1.1e-268
>prophage 1
NZ_CP042633	Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence	89339	58846	66127	89339		Stx2-converting_phage(33.33%)	10	NA	NA
WP_042634411.1|58846_59410_+	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	39.3	2.3e-20
WP_000547945.1|60007_60214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151318003.1|60824_61058_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_151317901.1|61121_63080_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.6	2.8e-20
WP_151318004.1|63135_63570_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_151318005.1|63566_64286_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_151318006.1|64285_64465_+	hypothetical protein	NA	Q687G9	Enterobacteria_phage	65.0	9.3e-08
WP_077631319.1|64529_64805_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	67.1	2.3e-26
WP_000993956.1|65129_65780_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_151316786.1|65779_66127_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
