The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042615	Escherichia coli strain NCYU-26-73 chromosome, complete genome	5087415	375305	469980	5087415	lysis,capsid,tRNA,tail,plate,integrase,terminase,portal,holin	Escherichia_phage(40.0%)	70	439460:439487	471546:471573
WP_000968208.1|375305_376001_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001295452.1|375997_376396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151293678.1|376634_377582_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|377954_378038_-	protein YohP	NA	NA	NA	NA	NA
WP_151293679.1|378261_379698_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_151293680.1|379750_380512_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001295454.1|381388_381976_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_000097369.1|383119_384835_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_151293681.1|385030_387328_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_151293682.1|387476_388394_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_151293683.1|388400_389558_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569342.1|389550_390477_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783137.1|390481_391213_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|391193_391301_-	protein YohO	NA	NA	NA	NA	NA
WP_151293684.1|391360_392092_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	8.2e-111
WP_001295430.1|394762_395233_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|395274_395736_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_151293685.1|395860_397861_-	dipeptidase	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_096251368.1|397857_398994_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	7.2e-162
WP_151293686.1|400491_400962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151293687.1|401275_402364_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001559439.1|402938_403244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151293688.1|413023_414133_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001308761.1|414395_414677_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830475.1|414971_415514_+	fimbrial protein	NA	NA	NA	NA	NA
WP_096251657.1|415595_416270_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_151293689.1|419897_420236_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_096251654.1|420454_421279_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|421399_421672_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_151293690.1|422680_423481_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_096251652.1|423545_424364_+	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	38.9	2.3e-24
WP_000434044.1|424415_425162_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042097399.1|426095_427100_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	5.8e-14
WP_151293691.1|427096_428374_-	MFS transporter	NA	NA	NA	NA	NA
WP_096251648.1|430792_432055_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000823282.1|432546_432831_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_151293692.1|432834_434190_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_151293693.1|435377_436157_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
439460:439487	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|439566_440580_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|440695_440995_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|441109_441385_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217679.1|441564_442065_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557703.1|442128_442353_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277961.1|442352_442655_+	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_001113264.1|442654_442879_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027668.1|442875_443151_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
WP_096252005.1|443140_445426_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.2	0.0e+00
WP_096252006.1|445425_445869_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	91.1	4.1e-73
WP_151293694.1|446022_446784_-	hypothetical protein	NA	P79670	Escherichia_phage	82.2	3.5e-112
WP_096251702.1|448892_449132_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	82.0	1.3e-12
WP_000038182.1|449108_450143_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
WP_097335615.1|450142_451915_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001248551.1|453001_454075_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.1e-201
WP_000203434.1|454078_454822_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.4	3.6e-122
WP_000846409.1|455428_455632_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123124.1|455635_455917_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_096251703.1|455916_456414_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	98.8	5.8e-92
WP_151293695.1|456428_456854_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	94.3	4.4e-56
WP_096251705.1|456841_457267_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	97.2	3.6e-66
WP_001440152.1|457238_457412_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917171.1|457374_457842_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	7.4e-81
WP_063118410.1|458352_458988_+|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	98.6	1.5e-113
WP_001393127.1|458984_459332_+	lysozyme family protein	NA	A0A0F7LDQ1	Escherichia_phage	98.3	2.2e-58
WP_001121485.1|459336_460245_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.7	1.2e-162
WP_069904677.1|460237_460768_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	8.6e-102
WP_021517188.1|463098_463626_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	1.4e-91
WP_001251408.1|466043_466562_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_151293696.1|466619_466895_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	1.8e-39
WP_000785970.1|466927_467047_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000978903.1|469500_469980_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.1	9.6e-84
471546:471573	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
>prophage 2
NZ_CP042615	Escherichia coli strain NCYU-26-73 chromosome, complete genome	5087415	618578	628093	5087415		Escherichia_phage(54.55%)	14	NA	NA
WP_001315544.1|618578_618734_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_000787424.1|618936_619344_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_000912290.1|619420_619648_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_151293716.1|620154_621195_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	84.0	1.7e-85
WP_024189964.1|621226_621649_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_151293717.1|621833_622442_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	85.6	1.5e-86
WP_151293718.1|623240_624014_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_122997306.1|624496_624616_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.1e-08
WP_063102597.1|624660_624873_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	8.6e-29
WP_000980984.1|625089_625341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032194507.1|625407_625686_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001409109.1|625687_626746_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	6.4e-88
WP_099481749.1|626746_627085_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	9.9e-35
WP_000917767.1|627895_628093_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
>prophage 3
NZ_CP042615	Escherichia coli strain NCYU-26-73 chromosome, complete genome	5087415	1043581	1141885	5087415	protease,tail,integrase,transposase,portal,holin	Enterobacteria_phage(37.21%)	84	1032394:1032410	1064826:1064842
1032394:1032410	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_096251744.1|1043581_1044601_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001389342.1|1044658_1044787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151293810.1|1044788_1046069_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.5e-155
WP_122989168.1|1046103_1046340_-	excisionase family protein	NA	S4TND0	Salmonella_phage	49.3	1.8e-14
WP_151293811.1|1046427_1048899_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.6	2.7e-57
WP_001083276.1|1048992_1049184_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|1049180_1049369_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_151293812.1|1049855_1050431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1050432_1050588_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|1050780_1051188_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|1051265_1051493_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001375679.1|1051537_1051999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151293813.1|1051979_1052945_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.0	1.8e-52
WP_001151189.1|1052985_1053387_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_096252019.1|1053821_1055171_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	1.5e-259
WP_001328008.1|1055495_1055699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546200.1|1055705_1055813_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887491.1|1055857_1056070_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_151293814.1|1056286_1056538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012775982.1|1056604_1056883_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_096251138.1|1056884_1057898_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.5	1.1e-105
WP_085947598.1|1057911_1059074_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001204787.1|1059213_1059591_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|1059746_1060271_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_032201951.1|1061829_1062543_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839588.1|1062732_1062948_+|holin	holin	holin	A5LH82	Enterobacteria_phage	91.5	1.2e-30
WP_151293815.1|1062952_1063504_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	51.1	2.9e-36
WP_001557934.1|1063451_1063712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|1063825_1064359_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_000066495.1|1065217_1065430_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
1064826:1064842	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_071528545.1|1065440_1065629_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|1065776_1065932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|1066104_1066278_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_151293816.1|1066628_1066778_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	89.8	1.5e-16
WP_000421823.1|1067328_1067868_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
WP_001072975.1|1069970_1070183_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_151293817.1|1070182_1071691_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	1.6e-286
WP_151293818.1|1071635_1073663_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.1	0.0e+00
WP_001097045.1|1073748_1074072_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|1074064_1074340_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_151295252.1|1076151_1076538_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	99.2	1.6e-65
WP_001161009.1|1076546_1076876_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000447256.1|1079901_1080231_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.9e-60
WP_151293819.1|1080240_1080939_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	4.4e-130
WP_151293820.1|1081583_1082231_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.5e-111
WP_151293821.1|1082257_1082617_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_000654143.1|1088140_1088422_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_151293822.1|1088431_1089472_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.0	1.2e-123
WP_000355601.1|1089514_1089808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096252091.1|1090035_1090626_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.9	4.0e-23
WP_042966590.1|1090942_1091176_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	1.9e-32
WP_120795384.1|1091244_1091358_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_096251989.1|1093332_1094793_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.4	5.1e-43
WP_000214712.1|1094828_1095032_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_151293823.1|1095207_1095894_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151293824.1|1095982_1096729_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_151293825.1|1096865_1098911_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_096252022.1|1099274_1099667_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_151293826.1|1099921_1100812_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	36.4	1.5e-18
WP_000901367.1|1101030_1101126_-	protein MgtS	NA	NA	NA	NA	NA
WP_059328086.1|1101252_1102440_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_151293827.1|1102634_1103534_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_151293828.1|1103578_1104049_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151292997.1|1104045_1104276_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000722571.1|1104474_1104786_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_151293829.1|1108311_1109751_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.7	1.6e-28
WP_000803518.1|1109807_1110026_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|1110057_1110441_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_151293830.1|1110460_1110895_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_151293831.1|1111107_1111773_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_000210785.1|1111797_1112988_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_151293832.1|1113138_1114254_-	putative protein YneK	NA	NA	NA	NA	NA
WP_000366507.1|1114337_1115213_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096251301.1|1116762_1117689_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191032.1|1117688_1118048_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_096251298.1|1121476_1122391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774178.1|1123521_1124397_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_151293833.1|1124423_1125446_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222721.1|1125457_1126450_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_001551132.1|1126449_1127478_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_151293834.1|1127471_1127735_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.7e-05
WP_151293835.1|1138304_1139627_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_151295253.1|1139820_1140453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151293836.1|1140481_1141885_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP042615	Escherichia coli strain NCYU-26-73 chromosome, complete genome	5087415	1339047	1354295	5087415	holin	Escherichia_phage(60.0%)	19	NA	NA
WP_151293876.1|1339047_1339305_-	hypothetical protein	NA	A0A1B1INL5	uncultured_Mediterranean_phage	57.7	4.9e-18
WP_151293877.1|1339301_1339589_-	hypothetical protein	NA	K4HZA5	Acidithiobacillus_phage	54.5	7.4e-07
WP_151293878.1|1339557_1339833_-	hypothetical protein	NA	A0A0R6PD10	Moraxella_phage	54.9	1.9e-20
WP_001305859.1|1340141_1340255_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	89.2	2.5e-11
WP_096251529.1|1340474_1341020_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.6	2.1e-90
WP_096251547.1|1341288_1341681_-|holin	holin	holin	Q8W636	Enterobacteria_phage	96.2	6.5e-54
WP_151293879.1|1341954_1342266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096252102.1|1343764_1344364_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.9e-105
WP_151293880.1|1347019_1348174_-	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_071998695.1|1348149_1348371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096251802.1|1348367_1348799_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	4.6e-61
WP_151293881.1|1348814_1349423_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	85.1	1.1e-87
WP_151293882.1|1349597_1350344_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	79.3	4.5e-112
WP_069903275.1|1351633_1351888_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|1351967_1352387_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000233807.1|1352675_1352810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312793.1|1352973_1353462_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|1353903_1354125_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|1354124_1354295_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
>prophage 5
NZ_CP042615	Escherichia coli strain NCYU-26-73 chromosome, complete genome	5087415	1947129	2032466	5087415	coat,integrase,terminase,head,transposase,portal,holin	Enterobacteria_phage(41.94%)	86	1949286:1949301	2044335:2044350
WP_039026397.1|1947129_1947951_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000100800.1|1948088_1948592_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_151293990.1|1948995_1949742_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
1949286:1949301	attL	TAAAAAAGCGATCGAT	NA	NA	NA	NA
WP_151293991.1|1949881_1950541_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_151293992.1|1950537_1951260_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.3	7.3e-35
WP_151293993.1|1954795_1955056_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_096251718.1|1955320_1957603_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|1957644_1958322_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146357.1|1958395_1958662_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_096251717.1|1960641_1961604_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_096251716.1|1961631_1963782_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.8	6.3e-42
WP_151293994.1|1969765_1970437_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_151293995.1|1971426_1973163_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_151293996.1|1973155_1974289_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|1975368_1975779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096251881.1|1975911_1976673_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_151293997.1|1976669_1977911_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_151293998.1|1977910_1978867_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_151294000.1|1978902_1979292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373624.1|1979495_1980200_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852278.1|1980336_1980789_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_001208766.1|1980790_1981009_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_001295301.1|1982046_1983036_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_151294002.1|1983431_1984340_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.1e-27
WP_000042533.1|1984377_1986399_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_151294004.1|1988387_1989542_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_151294006.1|1989538_1990579_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000767411.1|1992014_1992491_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_151295262.1|1992741_1993041_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001210981.1|1996534_1996756_-	hypothetical protein	NA	I6RSG6	Salmonella_phage	100.0	1.9e-34
WP_001161119.1|1996752_1996911_-	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	100.0	7.6e-22
WP_052869845.1|1996998_1997253_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	68.4	7.7e-24
WP_000820796.1|1997249_1997567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151196.1|1997576_1997762_-	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
WP_000454769.1|1997903_1998107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091997.1|1998150_1998573_-	hypothetical protein	NA	I6S1K6	Salmonella_phage	57.7	1.2e-32
WP_151294007.1|1999397_1999787_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	98.4	1.3e-67
WP_151294010.1|2003117_2003810_-	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	98.3	3.6e-116
WP_151294012.1|2003812_2004268_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	98.0	3.3e-86
WP_151294014.1|2004267_2005221_-	hypothetical protein	NA	Q716G6	Shigella_phage	84.5	1.6e-93
WP_151294016.1|2005220_2006639_-	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	98.9	1.5e-273
WP_001140510.1|2006648_2007110_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_151294018.1|2007321_2008575_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.3	8.3e-236
WP_151294020.1|2008593_2009487_-	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	90.2	1.0e-123
WP_151295263.1|2009577_2011779_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	96.6	0.0e+00
WP_001549451.1|2011778_2013275_-|terminase	large terminase	terminase	A0A2D1GLW6	Escherichia_phage	93.8	8.2e-283
WP_000729920.1|2013252_2013741_-	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_000807792.1|2013776_2014019_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	2.9e-36
WP_001059339.1|2014319_2014844_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001139676.1|2015045_2015198_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	100.0	1.2e-21
WP_151294022.1|2015226_2015433_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	92.6	7.1e-28
WP_151294024.1|2015649_2016126_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	99.4	2.2e-88
WP_000783734.1|2016109_2016433_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_016063210.1|2017404_2017599_-	NinH protein	NA	K7PMJ0	Enterobacteria_phage	100.0	6.0e-29
WP_151294026.1|2017595_2017958_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	98.3	2.3e-61
WP_000002244.1|2017954_2018245_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_151294028.1|2018244_2018967_-	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	96.7	2.1e-127
WP_000566866.1|2018959_2019130_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_001254257.1|2019126_2019309_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_096251958.1|2019305_2019833_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	2.1e-100
WP_151294031.1|2019829_2020270_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	5.9e-80
WP_096251957.1|2020250_2020463_-	hypothetical protein	NA	A0A1V0E5J7	Salmonella_phage	97.1	1.8e-34
WP_000158285.1|2020449_2020548_-	hypothetical protein	NA	Q9MCP6	Enterobacteria_phage	100.0	7.5e-12
WP_000131492.1|2020547_2021984_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_151294033.1|2021973_2022873_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	99.0	5.1e-163
WP_000166207.1|2022865_2023012_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_033546449.1|2023044_2023338_-	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	99.0	1.4e-45
WP_001054987.1|2023447_2023672_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_000092875.1|2023816_2024491_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	84.4	5.3e-104
WP_000394871.1|2024531_2024828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151294035.1|2025261_2025534_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	94.4	2.0e-25
WP_021549877.1|2025592_2025781_+	hypothetical protein	NA	K7PMF8	Enterobacteria_phage	90.9	1.1e-16
WP_000167595.1|2025859_2026330_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_014532157.1|2026419_2026695_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_151294037.1|2026951_2027557_+	recombinase	NA	Q9MCQ9	Enterobacteria_phage	99.0	4.6e-107
WP_096251947.1|2027556_2027940_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	98.4	1.9e-66
WP_047668784.1|2027963_2028260_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	5.0e-51
WP_096251948.1|2028430_2028961_+	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	64.4	2.2e-44
WP_096251949.1|2028957_2029272_+	hypothetical protein	NA	B1GS43	Salmonella_phage	83.9	8.9e-38
WP_052433760.1|2029258_2029660_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	50.5	3.5e-31
WP_024187529.1|2029656_2029980_+	carboxylate--amine ligase	NA	A0A222YZB4	Escherichia_phage	89.2	1.9e-43
WP_151294039.1|2029976_2030636_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	82.1	2.5e-34
WP_096251950.1|2030635_2030920_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	96.8	3.5e-49
WP_001593197.1|2030992_2031160_+	hypothetical protein	NA	K7P728	Enterobacteria_phage	98.2	3.7e-27
WP_001303849.1|2031199_2031418_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_151294041.1|2031395_2032466_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.2	2.1e-200
2044335:2044350	attR	ATCGATCGCTTTTTTA	NA	NA	NA	NA
>prophage 6
NZ_CP042615	Escherichia coli strain NCYU-26-73 chromosome, complete genome	5087415	2852461	3012120	5087415	protease,tRNA,tail,transposase,lysis	Enterobacteria_phage(40.43%)	114	NA	NA
WP_151294361.1|2852461_2853916_-|tRNA	class I tRNA ligase family protein	tRNA	A0A2P1ELB8	Moumouvirus	27.3	8.6e-27
WP_151294363.1|2853801_2855277_-|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	6.9e-40
WP_000767329.1|2855319_2856261_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001300728.1|2856268_2856487_-	DUF2575 domain-containing protein	NA	NA	NA	NA	NA
WP_001274021.1|2856589_2856853_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_151294365.1|2857336_2858779_+	type III secretion system effector EspX1	NA	NA	NA	NA	NA
WP_000759929.1|2859835_2860369_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001306194.1|2860418_2861102_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_151294367.1|2866954_2868199_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_151294369.1|2869641_2869821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033870199.1|2869840_2870602_-	membrane protein	NA	NA	NA	NA	NA
WP_001181672.1|2871158_2871368_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_000843579.1|2874983_2875388_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_151294371.1|2875413_2876127_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528541.1|2876275_2876842_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001600972.1|2876876_2877464_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000906178.1|2880310_2881087_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_151294373.1|2881126_2881423_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_151294375.1|2881637_2882924_-	threonine synthase	NA	NA	NA	NA	NA
WP_001386572.1|2886402_2886468_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_151294377.1|2886680_2887367_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|2887766_2887907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151294379.1|2888002_2888719_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920350.1|2888778_2890131_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_151294381.1|2891611_2892301_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	33.9	1.4e-27
WP_151294383.1|2892313_2892787_-	protein CreA	NA	NA	NA	NA	NA
WP_151294385.1|2892997_2893867_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|2893863_2894511_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_151294387.1|2894562_2895078_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068678.1|2895071_2895398_-	trp operon repressor	NA	NA	NA	NA	NA
WP_151294388.1|2901507_2902305_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_151294390.1|2902330_2902747_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000848792.1|2902904_2903117_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_071779356.1|2903165_2903351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151294392.1|2904831_2906214_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001577677.1|2907335_2907977_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_151294394.1|2909051_2909315_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224877.1|2909475_2910195_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000477811.1|2911526_2912849_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|2912926_2913706_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_151294396.1|2913963_2915514_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_096251787.1|2916381_2917161_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_151294398.1|2917157_2918231_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|2918352_2918514_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_151294400.1|2918640_2919246_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_061335757.1|2922193_2924077_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_151294402.1|2924552_2924846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096252090.1|2924871_2925561_-	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_061158085.1|2925570_2925852_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	51.1	6.3e-19
WP_151294404.1|2925851_2928224_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_151294406.1|2931742_2932375_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	88.6	5.1e-93
WP_151294408.1|2932311_2933055_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.3e-148
WP_001152632.1|2933060_2933759_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_000847321.1|2933758_2934088_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
WP_151294410.1|2935204_2935555_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	60.3	1.2e-11
WP_001161009.1|2937129_2937459_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_151295269.1|2937467_2937854_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	99.2	2.8e-65
WP_151294412.1|2937914_2938658_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.6	3.5e-133
WP_054575898.1|2939666_2939942_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	6.6e-45
WP_001097050.1|2939934_2940258_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_151294414.1|2940344_2942372_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
WP_001072975.1|2943823_2944036_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_151294416.1|2945927_2946137_-	hypothetical protein	NA	K7PH40	Enterobacteria_phage	100.0	2.1e-27
WP_000373425.1|2946136_2946631_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000745291.1|2947016_2947208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001680321.1|2947338_2947491_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	6.8e-20
WP_000092310.1|2947478_2947916_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.9	2.5e-70
WP_000839561.1|2948410_2948626_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_000115362.1|2949440_2949866_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	98.6	1.0e-73
WP_151294418.1|2950147_2950900_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	3.5e-133
WP_014639527.1|2950913_2951903_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.1e-193
WP_001061422.1|2951910_2952753_-	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
WP_000767113.1|2952772_2953162_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000066917.1|2953480_2954134_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_151294420.1|2954133_2954628_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.9	3.1e-85
WP_000620696.1|2955439_2955664_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_096251738.1|2955660_2956812_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	98.4	5.3e-213
WP_096251739.1|2957351_2957612_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	95.3	7.3e-38
WP_071594161.1|2957583_2957736_-	amino acid permease	NA	NA	NA	NA	NA
WP_151294422.1|2957709_2958402_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_151294424.1|2959125_2959488_+	hypothetical protein	NA	U5P4J6	Shigella_phage	97.5	1.4e-58
WP_151294426.1|2959554_2960379_+	DUF2303 family protein	NA	A5LH63	Enterobacteria_phage	99.6	1.7e-149
WP_000008174.1|2960506_2961043_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_151294428.1|2961033_2961396_+	DUF551 domain-containing protein	NA	A5LH61	Enterobacteria_phage	98.3	4.0e-66
WP_001061366.1|2962016_2962211_+	hypothetical protein	NA	A5LH59	Enterobacteria_phage	100.0	3.4e-32
WP_151294430.1|2966020_2966122_-	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_151294432.1|2966874_2967321_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000204018.1|2967289_2967703_-	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001272308.1|2967805_2968837_+	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_001445803.1|2969274_2969511_-	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_000331573.1|2969651_2970440_+	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001300509.1|2970477_2971155_-	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_151294434.1|2971112_2971787_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001346517.1|2972459_2973230_+	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_000538191.1|2973220_2973694_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_151294436.1|2973800_2974340_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_151294438.1|2974342_2975080_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.4	7.1e-62
WP_151295270.1|2975128_2975623_+	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_151294440.1|2980592_2981954_+	MFS transporter	NA	NA	NA	NA	NA
WP_151294442.1|2982002_2983667_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000543916.1|2983785_2984232_-	homoprotocatechuate degradation operon regulator HpaR	NA	NA	NA	NA	NA
WP_001577661.1|2984503_2985793_+	4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase	NA	NA	NA	NA	NA
WP_151294444.1|2985811_2987257_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000459750.1|2988567_2989371_+	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
WP_151294447.1|2989381_2990170_+	4-hydroxy-2-oxoheptanedioate aldolase	NA	NA	NA	NA	NA
WP_151294449.1|2990287_2991664_+	4-hydroxyphenylacetate permease	NA	NA	NA	NA	NA
WP_151294450.1|2992813_2994376_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_001175455.1|2994393_2994906_+	4-hydroxyphenylacetate 3-monooxygenase reductase subunit	NA	NA	NA	NA	NA
WP_000467859.1|2997496_2997700_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_001418369.1|3000104_3000389_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_151294453.1|3003164_3004634_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	27.3	1.3e-33
WP_001589603.1|3006601_3006943_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_000394263.1|3009180_3009345_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_096251899.1|3011175_3012120_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.7e-60
>prophage 1
NZ_CP042616	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence	269463	169714	232227	269463	protease,transposase,integrase	Escherichia_phage(41.67%)	44	163094:163108	219920:219934
163094:163108	attL	AACAAAAAATAATTT	NA	NA	NA	NA
WP_047745010.1|169714_170890_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|171060_171273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295355.1|171633_172716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295328.1|172881_174381_-	kinase	NA	NA	NA	NA	NA
WP_151295329.1|174405_176043_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_151295330.1|176042_177083_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_151295356.1|177168_177807_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_024182867.1|178469_179108_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|179572_180040_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506889.1|180057_181266_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_151295331.1|181276_182233_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_151295332.1|182232_183312_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.5	8.9e-37
WP_151295333.1|183313_184087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151295334.1|184079_185222_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_000254137.1|186607_187189_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_032489711.1|187319_188345_+	TerA	NA	NA	NA	NA	NA
WP_000007449.1|188367_188823_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_151295335.1|188845_189886_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	47.7	6.5e-77
WP_000116680.1|189934_190513_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|190581_191157_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_000398479.1|193611_193803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|195214_195469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211824.1|197508_198495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695443.1|199786_200098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123906519.1|201161_201344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|201324_201822_+	membrane protein	NA	NA	NA	NA	NA
WP_012477377.1|203612_203906_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000134171.1|205296_205503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295336.1|205603_206014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278471.1|207095_207521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295337.1|208069_208378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001162012.1|211623_212181_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001083725.1|213643_214141_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|214252_214543_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_000679427.1|215504_215852_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001993321.1|216616_216796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151295338.1|217284_218277_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_151295339.1|218787_219471_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.3e-131
WP_001447541.1|223736_224621_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
219920:219934	attR	AAATTATTTTTTGTT	NA	NA	NA	NA
WP_001255015.1|226078_226384_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021545039.1|226745_227771_+|transposase	IS21-like element ISEc57 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.1	6.6e-74
WP_001053381.1|227770_228544_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.4	5.5e-73
WP_151295340.1|228618_229893_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000602738.1|231474_232227_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
>prophage 1
NZ_CP042617	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence	128115	47	56294	128115	holin,head,portal,tail,integrase,transposase	Escherichia_phage(42.42%)	49	8:67	31607:31780
8:67	attL	TTATGAAAAAATGGTGAGTAGAGTTTCAGGGTAACAGGGGATGTTTATGTCGGTTTTCCA	NA	NA	NA	NA
WP_151295360.1|47_1262_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	3.6e-34
WP_001288435.1|1295_2729_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_151295361.1|3176_3860_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	4.6e-132
WP_011264039.1|3952_4192_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_151292569.1|4337_5201_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|5238_5484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|5952_6744_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_104772209.1|7598_7862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|7923_8256_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_151295362.1|9202_10570_-	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	5.3e-26
WP_001206356.1|10831_11623_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|11628_11919_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_151292574.1|12030_12528_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.1	4.1e-21
WP_151295363.1|12672_13686_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.8e-71
WP_081316080.1|13654_14239_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|14364_14925_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000565612.1|20123_20207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295364.1|21385_22048_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	24.8	1.3e-06
WP_001185482.1|22145_22427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295365.1|22451_23429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000456533.1|23425_23782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050931.1|24404_25241_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001532157.1|25179_25410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121743.1|26474_26726_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220560.1|26715_26997_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_000734776.1|27808_28123_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_001452736.1|28158_28470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084745.1|30222_30615_+	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_151295366.1|30745_31429_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.6	4.3e-130
WP_151292568.1|32528_33212_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	3.0e-131
31607:31780	attR	TGGAAAACCGACATAAACATCCCCTGTTACCCTGAAACTCTACTCACCATTTTTTCATAATTATATACAAACAGCCAGAAAGGCTGTTACAGGCGATTTGATCTGCAACCTATTGGTTAAATTAATGTATCAAAAACGATGGTTTCTGTGACACATCCCTATAAGCAGTTGCCT	NA	NA	NA	NA
WP_001189832.1|34146_34983_+	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_151295367.1|35061_35496_+|tail	phage tail protein	tail	A0A077SLL3	Escherichia_phage	98.6	1.6e-74
WP_071852594.1|38308_38788_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	54.4	3.2e-39
WP_000367945.1|38793_39405_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
WP_097331545.1|39404_39845_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.5	4.6e-40
WP_001165547.1|41389_41962_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_000145199.1|42397_42661_+	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_000887652.1|42735_43065_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|43061_43505_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_001345482.1|43491_44094_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_151295368.1|46014_46380_+	ddrA	NA	Q1MVM8	Enterobacteria_phage	98.3	5.1e-45
WP_151295369.1|46946_47345_-	hypothetical protein	NA	Q71TE5	Escherichia_phage	97.7	4.7e-60
WP_151295370.1|47322_47805_+	hypothetical protein	NA	Q71TE6	Escherichia_phage	76.7	8.8e-53
WP_001165937.1|49370_49679_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	94.1	2.4e-48
WP_151295371.1|52065_52554_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	98.1	1.6e-86
WP_151295395.1|52723_53281_+	lysozyme	NA	Q71TF3	Escherichia_phage	98.9	3.0e-105
WP_071833043.1|53416_53569_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	88.0	4.4e-19
WP_151295372.1|53572_54592_-|head	head processing protein	head	Q71TR6	Escherichia_phage	98.5	1.1e-182
WP_151295373.1|54584_56294_-|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
>prophage 2
NZ_CP042617	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence	128115	63169	90048	128115	tail	Escherichia_phage(74.07%)	28	NA	NA
WP_000224043.1|63169_63610_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_151295374.1|63606_63855_+	modulator protein	NA	Q71TG0	Escherichia_phage	98.8	4.0e-41
WP_074403646.1|65258_65900_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	98.6	5.3e-114
WP_151295375.1|66088_66649_-	recombinase	NA	Q71TG3	Escherichia_phage	95.7	9.8e-96
WP_024245510.1|66893_67205_-	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	6.3e-44
WP_000542336.1|68293_68515_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_001312283.1|68926_69040_+	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
WP_012817944.1|69058_69154_+	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_032305379.1|69119_69329_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	98.6	1.4e-31
WP_151295376.1|69439_70291_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	98.9	1.5e-156
WP_151295377.1|72823_72991_-	winged helix-turn-helix domain-containing protein	NA	Q71T62	Escherichia_phage	90.7	2.2e-19
WP_001326849.1|73076_73529_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_000648833.1|73617_74661_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.7	1.1e-206
WP_151295378.1|74688_74868_-	PdcA protein	NA	A0A077SLR6	Escherichia_phage	98.3	2.7e-23
WP_151295379.1|74872_75253_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	98.4	9.7e-63
WP_151295380.1|75252_75474_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	4.3e-31
WP_151295396.1|75656_77213_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	5.5e-104
WP_151295381.1|78179_78371_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096106393.1|78492_81609_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	1.7e-27
WP_000021766.1|81873_82380_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	100.0	4.8e-94
WP_000267620.1|83717_83936_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_001354545.1|84715_85393_-	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000484110.1|85389_86016_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_151295382.1|85913_86576_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	98.6	4.7e-121
WP_000096174.1|86517_86673_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_151295383.1|86739_87282_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	96.6	2.6e-93
WP_000235786.1|87712_88090_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_151295384.1|89319_90048_+|tail	phage tail protein	tail	A0A077SK19	Escherichia_phage	99.6	7.9e-138
>prophage 3
NZ_CP042617	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence	128115	93507	96891	128115		Escherichia_phage(83.33%)	6	NA	NA
WP_001276603.1|93507_94872_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_151295385.1|95345_95510_-	DUF3927 domain-containing protein	NA	Q71T96	Escherichia_phage	98.1	1.7e-16
WP_151295386.1|95509_95935_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	98.6	9.1e-70
WP_001068935.1|96126_96318_+	hypothetical protein	NA	Q71T98	Escherichia_phage	100.0	6.0e-29
WP_151295387.1|96328_96562_-	hypothetical protein	NA	A0A1B0VAL9	Salmonella_phage	97.1	2.4e-11
WP_024134673.1|96705_96891_+	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
>prophage 4
NZ_CP042617	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence	128115	107427	115168	128115	plate	Escherichia_phage(33.33%)	9	NA	NA
WP_151295388.1|107427_109134_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_029401366.1|110793_111609_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	9.8e-113
WP_151295397.1|111994_112225_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	2.0e-34
WP_151295389.1|112236_112746_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	3.9e-91
WP_001313475.1|112862_113018_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_151295390.1|113177_113444_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	47.4	1.7e-13
WP_000205060.1|113493_113763_-	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.9	2.4e-44
WP_151295391.1|113759_114338_-	MarR family transcriptional regulator	NA	Q71TB9	Escherichia_phage	99.4	1.2e-91
WP_001187876.1|114367_115168_-	protein kilA	NA	A0A077SL47	Escherichia_phage	100.0	1.4e-148
>prophage 1
NZ_CP042618	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence	122478	5464	62796	122478	transposase,integrase	Escherichia_phage(31.25%)	43	19035:19094	26794:27451
WP_151085593.1|5464_6169_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	7.6e-138
WP_021536379.1|9549_10227_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351729.1|12558_12951_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001352149.1|16456_17206_+	molecular chaperone	NA	NA	NA	NA	NA
WP_001269817.1|17207_18272_+	fimbrial protein	NA	NA	NA	NA	NA
WP_151295398.1|18314_18515_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
19035:19094	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_151295393.1|19097_19781_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	6.7e-131
WP_001288435.1|21343_22777_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	1.4e-106
WP_151295399.1|25025_26195_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	9.2e-72
WP_151295400.1|26085_26790_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.3	1.4e-136
WP_151295401.1|26780_27371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239529.1|28359_28635_-	hypothetical protein	NA	NA	NA	NA	NA
26794:27451	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTACAGCTTACACCGAAGGTTACAGGCGAGCTGCTGATATTCTGATTAACCACATTGATGAATCCGGGCGGGACCAGGATTTTCTGGTTTATCCGGTGTTGTTTCTCTACCGACATCACTTGGAGCTCCTTATCAAACAAATTATCGGACTGGCCCTTGCACTGGCAGAAGACCCGGATAAACACCAGTACAAAAAAGATGACCATAACCTGAATAATCTATGGCCGCTGGCACAAAAGCTGATCCCGGAAGTTGATGACAGCTACCGGCCTTCCGATTTTAAAATCGTCAAAGAGGTGGTTAAAGCTCTTCACCAAGCGGATGAACGGGCGACAGATTTCCGATATGCCGGGAGAAATGACGGCACCCGGAGCCTTGAAGGAATTCATTACGTCAACACCCGCCGCTTTGGGGAAAAAATGGGAGAGGCTTCCGATTTACTTGACGGGGTCGACAATGGCCTCCGGTACCTGCTGGACTGTAAAGCCGAATGGAATCAAATTCTGGACAGCTTCTGACAGCCAGAAACGGCGCGAAAAATCCATCAGACTTACCTGAACAACTAATGATACTGAGATACCGATCATGACTGGCCTCA	NA	NA	NA	NA
WP_151295402.1|28628_29273_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	7.4e-39
WP_001103690.1|29503_30475_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|30479_30872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295403.1|30876_32148_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	7.1e-142
WP_151295404.1|32147_32585_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	1.1e-25
WP_000618110.1|32581_32830_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_032072581.1|32940_33210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295427.1|33247_34150_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_001104881.1|35220_35442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274500.1|35455_35890_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_077249901.1|37247_37550_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271744.1|37596_38019_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001027495.1|38015_38207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001367801.1|38772_38979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276107.1|38975_39503_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	3.5e-47
WP_151295405.1|39560_39794_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	7.3e-05
WP_001145485.1|39852_41811_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
WP_000117626.1|44069_44570_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	26.5	7.1e-05
WP_024131422.1|44708_45008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348083.1|45029_45275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218858.1|45297_45732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000804663.1|45824_46091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150314.1|47616_47823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151295406.1|49623_49947_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001283947.1|50179_50512_+	IncI1-type relaxosome accessory protein NikA	NA	NA	NA	NA	NA
WP_151295407.1|55541_56015_-	DsbC family protein	NA	NA	NA	NA	NA
WP_151295408.1|56147_56612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151295409.1|56630_57839_-	IncI1-type conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_000118520.1|59123_59441_+	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
WP_001221666.1|59437_59971_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000608644.1|61533_62796_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 1
NZ_CP042619	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence	100041	0	2054	100041		Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_001066942.1|1313_2054_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
>prophage 2
NZ_CP042619	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence	100041	17834	19307	100041		Cedratvirus(100.0%)	1	NA	NA
WP_151295436.1|17834_19307_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	30.1	2.0e-07
>prophage 3
NZ_CP042619	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence	100041	31455	32566	100041	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_096251089.1|31455_32566_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
>prophage 4
NZ_CP042619	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence	100041	37866	38894	100041		Vibrio_virus(100.0%)	2	NA	NA
WP_001423743.1|37866_38523_+	enterotoxin	NA	A0A023W6A1	Vibrio_virus	81.7	7.9e-105
WP_015675362.1|38519_38894_+	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	79.8	1.1e-50
>prophage 5
NZ_CP042619	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence	100041	42198	42753	100041		Vibrio_phage(100.0%)	1	NA	NA
WP_151295463.1|42198_42753_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.6	1.4e-22
>prophage 6
NZ_CP042619	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence	100041	67760	75715	100041		Yersinia_phage(25.0%)	9	NA	NA
WP_140435897.1|67760_68582_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	1.3e-43
WP_000547969.1|69011_69218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151295456.1|69462_69660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302184.1|69843_70002_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_151295457.1|70276_70996_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001603646.1|71480_73439_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	8.6e-22
WP_151295458.1|73792_74326_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	2.6e-45
WP_000547969.1|74351_74558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012775864.1|75151_75715_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	42.1	2.6e-19
>prophage 7
NZ_CP042619	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence	100041	81413	82097	100041		Vibrio_phage(100.0%)	1	NA	NA
WP_151295461.1|81413_82097_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
>prophage 8
NZ_CP042619	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence	100041	90819	91982	100041	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947598.1|90819_91982_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 1
NZ_CP042620	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-5, complete sequence	93655	2575	23213	93655	transposase,lysis,holin,tail,head	Escherichia_phage(94.44%)	19	NA	NA
WP_151295468.1|2575_3421_+|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	90.4	9.1e-146
WP_001396839.1|3813_3963_+	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
WP_151295469.1|7120_7723_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	1.4e-95
WP_151295470.1|7694_8108_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	95.6	7.5e-69
WP_151295471.1|8359_9572_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	2.9e-169
WP_151295472.1|10173_10500_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	93.5	8.3e-47
WP_110459104.1|10499_10946_+|lysis	lysis protein	lysis	A0A222YXP5	Escherichia_phage	98.6	1.0e-79
WP_151295473.1|10935_11553_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	96.6	3.6e-75
WP_151295474.1|11549_13499_+|head	head protein	head	A0A222YWA3	Escherichia_phage	86.7	1.8e-285
WP_151295475.1|15303_16668_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	98.9	2.8e-245
WP_000094097.1|16793_17351_+	DUF4145 domain-containing protein	NA	A0A222YYQ2	Escherichia_phage	99.5	2.3e-97
WP_001244352.1|17395_17728_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	99.1	2.6e-56
WP_151295476.1|18262_18760_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	97.0	1.0e-88
WP_151295477.1|18769_19495_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	97.9	7.9e-130
WP_151295478.1|21194_21671_+	replication protein RepL	NA	A0A222YXV1	Escherichia_phage	97.5	8.3e-80
WP_071587727.1|21926_22082_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_151295479.1|22084_22309_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	98.6	6.3e-38
WP_151295480.1|22308_23016_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	99.1	2.2e-129
WP_001344836.1|23015_23213_+	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	100.0	3.1e-33
>prophage 2
NZ_CP042620	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-5, complete sequence	93655	44563	78572	93655	tail,plate	Escherichia_phage(77.27%)	45	NA	NA
WP_072756863.1|44563_45058_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	96.9	3.9e-88
WP_151295486.1|45072_45735_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	79.6	2.1e-97
WP_151295487.1|46630_47011_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	90.2	6.7e-56
WP_151295380.1|47010_47232_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	4.3e-31
WP_000506726.1|47304_47694_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_151295488.1|47789_48068_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	100.0	6.0e-38
WP_071779389.1|48241_48451_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	97.1	1.4e-31
WP_151295489.1|48704_49211_-	hypothetical protein	NA	A0A077SK55	Escherichia_phage	61.5	9.5e-66
WP_000267999.1|49442_49736_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	95.9	2.0e-47
WP_105459169.1|49722_50022_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	94.5	8.4e-46
WP_001716797.1|50021_50282_-	hypothetical protein	NA	A0A1B0V7L4	Salmonella_phage	95.3	6.0e-40
WP_151295490.1|50278_51229_-	DUF551 domain-containing protein	NA	A0A222YWE8	Escherichia_phage	95.1	3.2e-131
WP_000951706.1|51225_51435_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_151295491.1|51958_52414_-	DUF4014 domain-containing protein	NA	A0A222YXP4	Escherichia_phage	97.4	2.2e-77
WP_033816870.1|52415_52607_-	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	53.6	1.2e-08
WP_151295492.1|52766_53444_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	61.3	3.4e-66
WP_116986855.1|53430_53697_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	96.5	6.6e-42
WP_151295493.1|53693_54281_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	81.8	3.0e-87
WP_151295494.1|54285_55281_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	96.1	2.1e-189
WP_000613619.1|55378_56071_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	99.1	7.0e-136
WP_151295495.1|56067_56379_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	98.1	1.3e-57
WP_032342045.1|56375_56600_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	93.2	3.2e-34
WP_151295496.1|56577_56871_-	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	93.3	2.0e-39
WP_119743278.1|56867_57116_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	86.1	1.6e-29
WP_151295497.1|57112_57865_-	hypothetical protein	NA	A0A088CQ73	Enterobacteria_phage	88.7	1.2e-53
WP_047648367.1|57873_58284_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	75.7	1.1e-32
WP_000834210.1|58280_58769_-	hypothetical protein	NA	A0A0U2QW67	Escherichia_phage	65.2	7.8e-41
WP_151295498.1|58758_59043_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	91.5	3.1e-42
WP_151295499.1|59970_60549_+	recombinase	NA	A0A222YXV2	Escherichia_phage	95.8	1.2e-72
WP_151295500.1|60795_61047_+	hypothetical protein	NA	A0A222YWH9	Escherichia_phage	100.0	1.7e-23
WP_151295501.1|61338_61554_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	97.1	7.4e-36
WP_151295502.1|62552_62864_+	transcriptional regulator	NA	A0A222YY28	Escherichia_phage	81.8	2.2e-33
WP_000509541.1|62860_63058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151295503.1|64165_64819_+	maturation control protein	NA	A0A222YZ79	Escherichia_phage	98.6	5.4e-114
WP_151295504.1|65148_65478_+|plate	baseplate protein	plate	A0A222YYR0	Escherichia_phage	94.5	2.2e-55
WP_021551809.1|67499_67859_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	98.3	3.5e-62
WP_021551810.1|67862_68165_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	1.3e-17
WP_151295505.1|68350_69103_+|tail	phage tail protein	tail	A0A222YXU3	Escherichia_phage	90.0	4.0e-129
WP_151295506.1|69185_69866_+|plate	baseplate	plate	A0A222YWF4	Escherichia_phage	89.4	8.5e-110
WP_151295507.1|71561_72467_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	94.0	3.6e-156
WP_151295508.1|72450_73131_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	99.1	1.1e-133
WP_151295509.1|74172_74457_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	75.8	1.2e-30
WP_151295510.1|74449_75091_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	93.0	8.8e-109
WP_151295511.1|75380_75719_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	97.3	3.7e-50
WP_151295512.1|78113_78572_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	94.7	6.2e-64
>prophage 1
NZ_CP042622	Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence	46850	33952	40587	46850	holin	Escherichia_phage(62.5%)	12	NA	NA
WP_000412080.1|33952_34363_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	78.6	6.1e-39
WP_000636451.1|34559_34772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141358.1|34749_35049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151295541.1|35123_35321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000867916.1|35320_35590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000147213.1|36966_37245_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	53.9	4.0e-18
WP_024180651.1|37241_37787_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	84.0	3.0e-89
WP_151295537.1|37770_38067_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	62.6	4.3e-26
WP_151295538.1|38053_38449_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	80.8	6.7e-51
WP_134347180.1|39248_39458_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	91.3	1.7e-32
WP_094316884.1|39459_39996_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	97.9	3.7e-52
WP_001521425.1|40221_40587_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	55.9	3.1e-10
