The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	1000407	1018055	4995982	tail,portal,lysis	Enterobacteria_phage(71.43%)	17	NA	NA
WP_151315258.1|1000407_1000623_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.7e-32
WP_001356335.1|1002326_1002539_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
WP_071526745.1|1002549_1002738_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|1002885_1003041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|1003214_1003388_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_085325852.1|1003739_1003889_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.8	2.4e-17
WP_000421825.1|1004438_1004978_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_151315259.1|1007075_1007759_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	1.4e-72
WP_151315260.1|1007740_1008769_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	3.8e-194
WP_001097050.1|1010860_1011184_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001474292.1|1011176_1011452_+	ATP-binding sugar transporter from pro-phage family protein	NA	K7PH43	Enterobacteria_phage	97.8	3.3e-44
WP_000677108.1|1011463_1012042_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001475283.1|1012452_1013196_+	cell motility protein	NA	A5LH35	Enterobacteria_phage	99.2	5.0e-132
WP_151316054.1|1013256_1013643_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	97.7	1.2e-63
WP_151315261.1|1013953_1017019_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	97.8	0.0e+00
WP_000447253.1|1017018_1017348_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_050487113.1|1017416_1018055_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.8e-122
>prophage 2
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	1022959	1029210	4995982	tail	Enterobacteria_phage(66.67%)	7	NA	NA
WP_001228249.1|1022959_1023559_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_001546830.1|1025994_1026273_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
WP_139546215.1|1026558_1027323_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.1	2.8e-109
WP_151315262.1|1027365_1027659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086527.1|1027887_1028478_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|1028794_1029028_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1029096_1029210_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
>prophage 3
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	1357639	1437303	4995982	capsid,head,tRNA,portal,tail	Escherichia_phage(43.75%)	51	NA	NA
WP_000152928.1|1357639_1358224_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_151293912.1|1358340_1359432_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_151315334.1|1360513_1361119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151315335.1|1361139_1361469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151315336.1|1361465_1362002_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_151316070.1|1361925_1362231_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_151316072.1|1362199_1362421_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_151315337.1|1366475_1367108_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_151315338.1|1370884_1371907_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001261267.1|1371906_1372887_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000576823.1|1374458_1375313_+	ModD protein	NA	NA	NA	NA	NA
WP_042074701.1|1377359_1377554_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_151315339.1|1377813_1378548_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|1378549_1379161_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_151315340.1|1379279_1380176_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000190855.1|1386969_1388502_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|1388552_1389272_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000897378.1|1393026_1393446_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000807626.1|1394937_1395399_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|1395475_1396135_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001376831.1|1396206_1396500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000693756.1|1396740_1397142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056861.1|1397244_1397613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151315341.1|1398852_1399665_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|1399668_1399935_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000120098.1|1401039_1401213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000726974.1|1401214_1401559_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_151315342.1|1401955_1402519_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.2	1.3e-39
WP_151315343.1|1402540_1402777_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	52.1	3.7e-12
WP_001065757.1|1407228_1407477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888778.1|1407589_1407856_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000554146.1|1408198_1408435_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_151315344.1|1410165_1410897_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.0	2.5e-51
WP_000373101.1|1411118_1411523_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032140204.1|1411575_1411686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309448.1|1412226_1412550_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	63.6	1.3e-39
WP_000539892.1|1412652_1412805_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001304451.1|1413276_1414035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151315345.1|1414170_1414455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081570181.1|1414789_1415647_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_151315346.1|1417326_1418184_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000290537.1|1418857_1420879_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.5	3.8e-182
WP_001309445.1|1425050_1425794_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.6e-149
WP_000847364.1|1426495_1426825_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	1.2e-56
WP_000459451.1|1429392_1429827_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
WP_000985123.1|1431384_1431963_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_000158868.1|1432340_1432736_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063217.1|1432777_1433803_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	5.2e-188
WP_001513196.1|1433858_1434191_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_151316074.1|1436692_1437058_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.2	6.9e-34
WP_000198149.1|1437096_1437303_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
>prophage 4
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	1441469	1460603	4995982	integrase,holin	Enterobacteria_phage(50.0%)	28	1452023:1452039	1473847:1473863
WP_000075162.1|1441469_1441967_-	lysozyme	NA	A5LH83	Enterobacteria_phage	98.8	4.9e-91
WP_000839583.1|1441966_1442182_-|holin	holin	holin	M1FN85	Enterobacteria_phage	94.4	4.5e-33
WP_000780585.1|1444553_1445078_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	4.2e-48
WP_001204782.1|1445233_1445611_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	85.0	1.3e-54
WP_000971075.1|1445696_1445837_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_000950953.1|1446214_1446409_-	protein ninF	NA	NA	NA	NA	NA
WP_000386642.1|1446401_1446743_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	95.6	4.7e-61
WP_001254223.1|1446745_1446922_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|1446918_1447446_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|1447442_1447883_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_151315347.1|1447958_1448249_-	protein ren	NA	O48423	Enterobacteria_phage	97.9	1.4e-45
WP_000788877.1|1448245_1448947_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_001180318.1|1450283_1450511_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000076840.1|1451428_1452328_+	hypothetical protein	NA	NA	NA	NA	NA
1452023:1452039	attL	GCTGAAACCATTAAAAA	NA	NA	NA	NA
WP_000971595.1|1452556_1452772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216183.1|1452770_1453079_+	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	70.6	7.9e-31
WP_001066174.1|1453095_1453677_-	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	99.5	3.4e-99
WP_000065374.1|1453937_1454306_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000372937.1|1454510_1454654_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995439.1|1454728_1455025_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100848.1|1455030_1455816_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_151315348.1|1455812_1456493_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.2	1.4e-128
WP_000149538.1|1456489_1456672_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	3.7e-28
WP_000548521.1|1456644_1456836_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	95.2	1.2e-24
WP_151316076.1|1456913_1457129_+	cell division protein ZapA	NA	A0A1I9LJM7	Stx_converting_phage	97.2	1.4e-31
WP_000088653.1|1457870_1458107_+	excisionase	NA	NA	NA	NA	NA
WP_151315349.1|1458096_1459239_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.2	1.2e-204
WP_151315350.1|1459352_1460603_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
1473847:1473863	attR	GCTGAAACCATTAAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	2064295	2126340	4995982	capsid,head,terminase,tRNA,integrase,tail,lysis	Enterobacteria_phage(47.22%)	51	2097859:2097874	2130512:2130527
WP_001547143.1|2064295_2064880_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	4.7e-101
WP_001547141.1|2064879_2068278_-|tail	phage tail fiber assembly protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001230374.1|2068341_2068941_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	1.2e-110
WP_151315464.1|2072485_2073118_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	99.5	1.3e-96
WP_105468245.1|2073054_2073798_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.0e-145
WP_000847379.1|2074500_2074830_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001609728.1|2074826_2077388_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.8	0.0e+00
WP_000459457.1|2077380_2077815_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001349920.1|2078232_2078973_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000752979.1|2079960_2080314_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_151315465.1|2080325_2080724_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	2.0e-63
WP_151315466.1|2081716_2082478_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_001547130.1|2082880_2083156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766228.1|2083167_2083710_-|terminase	terminase	terminase	O64316	Escherichia_phage	47.2	1.9e-35
WP_122993704.1|2083706_2083829_-	ubiquitin--protein ligase	NA	NA	NA	NA	NA
WP_001547129.1|2083911_2084295_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001547128.1|2084306_2084648_-|head	head decoration protein	head	NA	NA	NA	NA
WP_151315467.1|2084658_2085591_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	44.7	1.1e-62
WP_000125507.1|2086333_2086579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261489.1|2088681_2088981_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113142.1|2088987_2089308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001547124.1|2089300_2089666_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_097755506.1|2090052_2090976_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000737989.1|2090963_2091191_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001365132.1|2092558_2092828_-|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
WP_001297109.1|2092889_2093222_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000198149.1|2096127_2096334_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
2097859:2097874	attL	CCAGCGCCAGCAGCGA	NA	NA	NA	NA
WP_000453587.1|2098229_2098775_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_032146712.1|2098890_2099148_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	100.0	6.8e-12
WP_001307652.1|2099163_2099358_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738421.1|2099717_2100011_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135277.1|2100499_2100997_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_151315468.1|2100996_2101212_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001204776.1|2103069_2103453_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_001547119.1|2105282_2105672_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.3e-67
WP_000210176.1|2105668_2105995_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001573323.1|2105994_2106489_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_001250269.1|2107418_2107598_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515828.1|2107773_2108325_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
WP_001535859.1|2108353_2108617_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	50.0	4.2e-09
WP_000357060.1|2111199_2111703_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	47.6	1.2e-31
WP_122985493.1|2111904_2112150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151315469.1|2112593_2113418_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_137572055.1|2114072_2114435_+	DUF551 domain-containing protein	NA	K7PH61	Enterobacteria_phage	97.4	8.3e-64
WP_000206813.1|2114434_2114740_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_151315470.1|2114966_2116130_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	1.2e-196
WP_001309313.1|2117098_2117614_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_151315471.1|2117624_2118632_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000776555.1|2122197_2122740_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729161.1|2123211_2124078_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_151315472.1|2124954_2126340_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	5.1e-45
2130512:2130527	attR	CCAGCGCCAGCAGCGA	NA	NA	NA	NA
>prophage 6
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	2376387	2453359	4995982	holin,transposase	Shigella_phage(25.0%)	42	NA	NA
WP_151315522.1|2376387_2378451_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.5e-21
WP_110914900.1|2378551_2379139_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_151315523.1|2380637_2382308_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.7	2.6e-59
WP_151315524.1|2382518_2383190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000474078.1|2389322_2389559_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|2389570_2390164_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_151316103.1|2394641_2396501_-	adhesin	NA	NA	NA	NA	NA
WP_000910713.1|2399134_2400028_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001305437.1|2400252_2401179_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000182337.1|2402499_2403642_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000662257.1|2404115_2404217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|2404582_2404846_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866438.1|2404845_2405019_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001309278.1|2405306_2405597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001305433.1|2406070_2406613_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_151315525.1|2406687_2407275_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716404.1|2407332_2408001_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_151315526.1|2412150_2412861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019920.1|2413751_2414366_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000070675.1|2414772_2415012_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_151315527.1|2414981_2416117_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.0e-101
WP_000171079.1|2421015_2422143_-	MFS transporter	NA	NA	NA	NA	NA
WP_151315528.1|2426864_2427968_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-61
WP_000749881.1|2428255_2429311_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174684.1|2429349_2429751_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189546.1|2429808_2431053_-	esterase FrsA	NA	NA	NA	NA	NA
WP_151316105.1|2433368_2433611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469791.1|2433627_2434137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151315529.1|2434198_2434813_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000554757.1|2436999_2437293_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_151315530.1|2438468_2439239_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001314494.1|2439198_2440938_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_151315531.1|2441265_2442478_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.2	4.4e-101
WP_151315532.1|2442637_2443135_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_071778835.1|2443080_2443269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151315533.1|2443311_2444061_-	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_001225679.1|2444362_2445103_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_137553541.1|2446045_2446624_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_151315534.1|2449351_2449825_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118007.1|2449978_2450749_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001306803.1|2451020_2451509_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_151315535.1|2452222_2453359_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	2915351	2924619	4995982	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_001619072.1|2915351_2917031_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	5.2e-84
WP_000397144.1|2919459_2920971_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_151315619.1|2921766_2922852_+|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0S951	Catovirus	45.3	8.9e-69
WP_151315620.1|2922701_2923226_+|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	35.6	2.8e-20
WP_151315621.1|2923204_2923921_+|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	29.9	2.7e-21
WP_151315622.1|2923932_2924619_+|tRNA	class I tRNA ligase family protein	tRNA	A0A167RAL2	Powai_lake_megavirus	27.2	9.7e-05
>prophage 8
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	4356002	4403742	4995982	transposase	Shigella_phage(30.0%)	38	NA	NA
WP_001172104.1|4356002_4356287_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.9	1.6e-09
WP_151315894.1|4356311_4356605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016231182.1|4356665_4356887_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	47.9	8.5e-11
WP_151315895.1|4357783_4358996_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.2	4.4e-101
WP_151315896.1|4358989_4359187_-	antirestriction protein	NA	NA	NA	NA	NA
WP_023909039.1|4359241_4360060_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.0e-44
WP_071602470.1|4360080_4360215_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_151316149.1|4360159_4360393_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001341328.1|4360478_4360757_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	1.1e-44
WP_151315897.1|4360878_4361226_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.1e-60
WP_151315898.1|4362933_4363389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021573037.1|4369320_4370193_-	GTPase family protein	NA	NA	NA	NA	NA
WP_064762709.1|4370488_4370683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011076583.1|4371108_4371330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151315899.1|4373134_4373707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528377.1|4374957_4375107_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000035551.1|4375126_4375327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547002.1|4375439_4375637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151315900.1|4375835_4376405_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_151315901.1|4376951_4377140_+	malate transporter	NA	NA	NA	NA	NA
WP_085961182.1|4377142_4378356_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001330662.1|4379184_4379382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031311643.1|4384077_4384659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151315902.1|4384822_4386095_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
WP_001309731.1|4391111_4391384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151315903.1|4391380_4391596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001405924.1|4391599_4391968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751583.1|4391979_4392171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001322946.1|4392258_4392531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075631373.1|4392906_4393086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000922606.1|4395393_4395576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328155.1|4395611_4395797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105955809.1|4395954_4397183_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	2.5e-168
WP_001296373.1|4397891_4398320_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109148.1|4398359_4398920_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|4398961_4399222_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|4401055_4401169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151315904.1|4402569_4403742_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.2	5.0e-227
>prophage 9
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	4944991	4956440	4995982	terminase	Escherichia_phage(47.06%)	17	NA	NA
WP_151316171.1|4944991_4945651_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.0	3.7e-102
WP_001341620.1|4946291_4946543_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_151316010.1|4946700_4946949_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	98.8	1.0e-41
WP_000063818.1|4946998_4947880_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.6	2.6e-159
WP_151316012.1|4948695_4948995_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	96.0	7.1e-45
WP_151316014.1|4949303_4949888_-	LacI family DNA-binding transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	3.5e-104
WP_001282459.1|4950042_4950273_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000402896.1|4950423_4950624_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
WP_001341618.1|4951468_4952254_+	replication P family protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	98.9	1.8e-151
WP_001546933.1|4952776_4953361_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	43.3	4.1e-28
WP_001546932.1|4953357_4953657_+	hypothetical protein	NA	Q716F3	Shigella_phage	99.0	5.6e-58
WP_001546931.1|4953658_4954144_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	90.7	3.1e-45
WP_001546930.1|4954145_4954337_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	3.6e-26
WP_001546929.1|4954339_4955044_+	DUF551 domain-containing protein	NA	A0A0N7C063	Escherichia_phage	69.9	9.5e-48
WP_024193957.1|4955043_4955394_+	DUF2591 domain-containing protein	NA	G9L6B5	Escherichia_phage	74.1	1.3e-42
WP_001129692.1|4955386_4955725_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	5.4e-57
WP_024193956.1|4955765_4956440_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	2.0e-119
>prophage 10
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	4959449	4968634	4995982		Escherichia_phage(62.5%)	8	NA	NA
WP_000335899.1|4959449_4959656_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_151316016.1|4961645_4962341_+	peptidase	NA	G9L6C4	Escherichia_phage	99.6	4.3e-93
WP_001546921.1|4963390_4963828_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.2	1.4e-70
WP_001546919.1|4963838_4964174_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	8.5e-55
WP_000424495.1|4964224_4964548_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_001546918.1|4964547_4965153_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	6.2e-112
WP_151316173.1|4967624_4968089_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.1	2.1e-83
WP_001546915.1|4968088_4968634_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	97.8	2.1e-90
>prophage 11
NZ_CP042599	Escherichia coli strain NCYU-29-69 chromosome, complete genome	4995982	4977961	4985477	4995982	holin	Escherichia_phage(71.43%)	7	NA	NA
WP_001546908.1|4977961_4978219_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
WP_001546906.1|4981194_4981599_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	94.8	2.3e-62
WP_001546697.1|4981585_4981894_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
WP_151316022.1|4982025_4982511_+	hypothetical protein	NA	G9L6E8	Escherichia_phage	97.9	4.5e-49
WP_151316024.1|4982507_4982990_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	92.5	2.2e-72
WP_151316175.1|4984475_4985012_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	97.6	4.8e-60
WP_001344399.1|4985303_4985477_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 1
NZ_CP042600	Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-1, complete sequence	121754	1314	50638	121754	integrase,transposase	Escherichia_phage(42.86%)	43	2673:2732	38989:39807
WP_151316179.1|1314_2055_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	5.9e-24
WP_151316224.1|2175_2331_-	transcriptional regulator	NA	NA	NA	NA	NA
2673:2732	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_151292566.1|2735_3419_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.3e-131
WP_151316181.1|4234_4339_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_011058338.1|6354_6540_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
WP_104772209.1|7354_7618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|7679_8012_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001360292.1|8181_8961_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_151295362.1|8957_10325_-	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	5.3e-26
WP_001336345.1|11384_11675_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_151292574.1|11786_12284_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.1	4.1e-21
WP_151316183.1|12428_13442_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	3.0e-71
WP_071830595.1|13643_13994_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|14119_14680_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_046788546.1|17644_18046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|18130_18835_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_151316185.1|18892_19729_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012728215.1|19759_20644_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001255015.1|22102_22408_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151316187.1|22519_24013_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|24043_24295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|24188_24491_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|24577_25393_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_072202717.1|26770_27250_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_124036771.1|27350_28010_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.7e-126
WP_052945622.1|29662_29890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021536379.1|29921_30599_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151316189.1|31907_32792_-	EamA family transporter	NA	NA	NA	NA	NA
WP_151316226.1|34991_35345_+	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	99.1	2.6e-54
WP_104730575.1|35286_35463_-	replication initiator protein	NA	NA	NA	NA	NA
WP_001067855.1|35453_36158_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000939727.1|38077_38899_+	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_151292566.1|39051_39735_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.3e-131
WP_001235713.1|40046_40604_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
38989:39807	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCGGGCCTCAGCATTTTATTATGGTGATCCCCGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_151316191.1|40769_41429_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	2.4e-125
WP_000587837.1|43022_43565_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|44101_44806_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_151292586.1|44995_45811_-	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	99.3	3.9e-162
WP_151316193.1|45961_46666_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
WP_011264039.1|46729_46969_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001354008.1|48014_48260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|48728_49520_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000027057.1|49777_50638_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 1
NZ_CP042601	Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence	78117	4446	53958	78117	transposase	Escherichia_phage(55.56%)	44	NA	NA
WP_151316232.1|4446_5151_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000224416.1|5706_6012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316234.1|6041_7034_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_000836682.1|10796_11144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316236.1|11171_11387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151293719.1|11371_12645_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000549587.1|12805_13282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315561.1|14142_14511_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_001444176.1|14449_15037_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_001230772.1|16457_17186_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399780.1|17172_17739_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_114213570.1|17761_18073_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001098992.1|18087_18447_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000089263.1|18479_18707_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_001425359.1|18843_19095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096127601.1|19142_19514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001354030.1|19707_20091_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_151316238.1|21624_22131_-	DUF945 domain-containing protein	NA	A0A1S6UA20	Serratia_phage	40.7	1.1e-21
WP_151316240.1|22241_22538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316242.1|22600_22828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|23451_23610_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_151316244.1|24606_25041_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001127499.1|28035_28155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316246.1|28074_28311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021537720.1|28603_28852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059007.1|28851_29415_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
WP_000218642.1|30874_31105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023147596.1|31328_31448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027493.1|34483_34675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271762.1|34671_35094_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|35140_35443_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001104881.1|37260_37482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072109530.1|38122_38302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032146011.1|38242_38536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959884.1|38682_39645_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_000361389.1|39647_39998_+	protein stbB	NA	NA	NA	NA	NA
WP_001333089.1|40120_40402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151316191.1|42345_43005_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	2.4e-125
WP_001067855.1|45277_45982_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|46139_47000_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_151316248.1|48002_48551_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_151316250.1|49189_50722_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001470701.1|50978_51347_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_151292566.1|53274_53958_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.3e-131
