The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042585	Escherichia coli strain LD91-1 chromosome, complete genome	4733770	1041377	1048517	4733770		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1041377_1042016_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_146881414.1|1042012_1043275_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.2	2.8e-135
WP_000847985.1|1043271_1044180_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1044375_1045143_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|1045193_1045850_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|1045955_1048517_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP042585	Escherichia coli strain LD91-1 chromosome, complete genome	4733770	1547943	1603990	4733770	protease,capsid,plate,tail,terminase,holin,head,portal	Shigella_phage(60.78%)	76	NA	NA
WP_000849209.1|1547943_1548432_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000686726.1|1548839_1549334_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|1549323_1549587_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778067.1|1549583_1552070_+	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000091291.1|1552076_1552772_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013506.1|1552758_1553622_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835177.1|1553618_1554068_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|1554077_1554680_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_146881495.1|1554698_1555316_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	3.3e-12
WP_000971730.1|1555312_1555975_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|1556016_1556754_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|1556750_1556960_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026422.1|1556956_1557436_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_096941613.1|1557432_1559376_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000824439.1|1559372_1559930_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211587.1|1559926_1560979_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001113637.1|1561013_1561661_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_024242783.1|1565160_1566030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277823.1|1566238_1567417_-	hypothetical protein	NA	A0A2D1GN00	Marinobacter_phage	31.0	2.5e-32
WP_001096409.1|1567419_1567629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023277822.1|1567690_1567906_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	63.5	2.1e-14
WP_146881419.1|1567902_1568265_-	DUF551 domain-containing protein	NA	K7PH61	Enterobacteria_phage	95.8	7.5e-65
WP_023277821.1|1568255_1568792_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.8	3.4e-98
WP_023277820.1|1568919_1569744_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	4.3e-148
WP_023277819.1|1569809_1570172_-	hypothetical protein	NA	U5P4J6	Shigella_phage	98.3	6.2e-59
WP_077632131.1|1570518_1570722_+	hypothetical protein	NA	U5P0J5	Shigella_phage	95.5	4.0e-31
WP_000016389.1|1570640_1571075_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_023277818.1|1571046_1571253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450738.1|1571500_1572127_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000205494.1|1572224_1572425_+	cell division protein	NA	NA	NA	NA	NA
WP_000515829.1|1572462_1573020_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|1573195_1573375_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_146881420.1|1573364_1574306_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	92.7	1.4e-139
WP_077769804.1|1574302_1574797_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	4.7e-86
WP_023277816.1|1574796_1575051_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	6.7e-36
WP_000210171.1|1575047_1575374_+	LexA family transcriptional regulator	NA	Q8SBE8	Shigella_phage	99.1	9.2e-54
WP_044717961.1|1575370_1575736_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.6e-65
WP_001061445.1|1575779_1576589_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_001603273.1|1576596_1577586_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
WP_023277814.1|1577599_1578352_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	1.4e-137
WP_023277813.1|1578554_1579340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120490.1|1579429_1579756_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_001197757.1|1579759_1580236_+	glycoside hydrolase family 104 protein	NA	U5P0A9	Shigella_phage	98.1	7.0e-87
WP_001353342.1|1580219_1580612_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	84.5	1.0e-51
WP_122997238.1|1580496_1580754_+	hypothetical protein	NA	Q8SBD8	Shigella_phage	73.2	7.0e-25
WP_000582030.1|1580781_1581342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459434.1|1581420_1581969_-	hypothetical protein	NA	S4TR57	Salmonella_phage	37.3	6.3e-23
WP_001141142.1|1582144_1582495_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.8	3.4e-62
WP_135940955.1|1582620_1583115_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	6.6e-88
WP_072011717.1|1583348_1584845_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_097363671.1|1584856_1585039_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	98.3	8.5e-25
WP_000466266.1|1585038_1586280_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	7.6e-242
WP_001193631.1|1586257_1586908_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257492.1|1586922_1588128_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_000601363.1|1588176_1588377_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_097363670.1|1588379_1588703_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	9.7e-56
WP_097363669.1|1588699_1589110_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	90.4	1.2e-66
WP_097363668.1|1589084_1589591_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	8.6e-83
WP_000779281.1|1589587_1590148_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	5.2e-105
WP_000497751.1|1590156_1590327_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_097363667.1|1590310_1591807_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.8	2.2e-272
WP_097363666.1|1591806_1592163_+|tail	phage tail protein	tail	U5P076	Shigella_phage	98.3	2.6e-62
WP_000661054.1|1592162_1592432_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_023147733.1|1592398_1592581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146881421.1|1592573_1594406_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	3.9e-303
WP_000734912.1|1594438_1594885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122986269.1|1594995_1596324_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	97.1	2.5e-243
WP_097363664.1|1596320_1597400_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.2	3.4e-206
WP_074558911.1|1597399_1597948_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.6e-95
WP_000424732.1|1597947_1598373_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_097363663.1|1598359_1599418_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.0	5.2e-199
WP_000383536.1|1599408_1599993_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_146881422.1|1599996_1600923_+	carbohydrate kinase	NA	U5P0I1	Shigella_phage	79.9	4.6e-50
WP_000994391.1|1600922_1601339_+|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	71.6	1.0e-20
WP_000185984.1|1601599_1602667_-	acyltransferase	NA	NA	NA	NA	NA
WP_000355478.1|1603216_1603990_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.9	1.1e-36
>prophage 3
NZ_CP042585	Escherichia coli strain LD91-1 chromosome, complete genome	4733770	1673538	1682980	4733770		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1673538_1674465_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1674469_1675201_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1675181_1675289_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1675348_1676080_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1676301_1677987_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1677983_1678703_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001365803.1|1678749_1679220_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.0e-82
WP_001295429.1|1679260_1679722_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001331478.1|1679846_1681847_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292767.1|1681843_1682980_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 4
NZ_CP042585	Escherichia coli strain LD91-1 chromosome, complete genome	4733770	2238770	2306973	4733770	protease,integrase,tail,terminase,lysis,portal	Enterobacteria_phage(47.17%)	78	2246346:2246361	2276060:2276075
WP_001260849.1|2238770_2239592_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2239691_2239775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2239867_2240203_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091849.1|2240599_2241853_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2241959_2242853_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2242987_2244208_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2244332_2245028_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2244980_2246273_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2246346:2246361	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148710.1|2246432_2247047_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526474.1|2247089_2247944_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2247945_2248563_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2248573_2250997_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_024261729.1|2251057_2253484_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.7e-214
WP_001307224.1|2253682_2253988_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2254095_2254806_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2254808_2255369_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705214.1|2255403_2255745_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2255879_2256206_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2256411_2257626_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2257637_2258657_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|2258714_2258825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2258844_2260125_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2260159_2260396_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048308.1|2260483_2262955_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083282.1|2263048_2263240_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|2263236_2263425_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344942.1|2263911_2264487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2264488_2264644_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000381212.1|2264812_2265220_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921594.1|2265300_2265528_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2265511_2266033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054487.1|2266013_2266979_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_001151189.1|2267019_2267421_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_000340969.1|2267639_2269427_-	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.1	1.2e-14
WP_001546200.1|2269892_2270000_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000884073.1|2270044_2270257_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_000980999.1|2270473_2270725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023140913.1|2270791_2271070_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001385829.1|2271071_2272121_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	3.7e-112
WP_001047131.1|2272134_2272887_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	1.4e-129
WP_000066484.1|2273562_2273778_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2274532_2274748_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|2274752_2275064_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2275060_2275594_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_032191976.1|2275590_2276088_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2276060:2276075	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2276450_2276663_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2276673_2276862_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2276864_2276930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2277009_2277165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2277336_2277510_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|2277661_2278072_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031431.1|2278372_2278579_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000421825.1|2279139_2279679_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507029.1|2279687_2281787_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.0	0.0e+00
WP_001072975.1|2281783_2281996_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_021542121.1|2281995_2283504_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.1e-287
WP_001136588.1|2283448_2285476_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097041.1|2285562_2285886_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001283153.1|2285878_2286154_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677127.1|2286165_2286744_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	3.6e-101
WP_001079398.1|2286740_2287142_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211132.1|2287152_2287896_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|2287956_2288343_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|2288351_2288681_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_146881435.1|2288652_2291718_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.0	0.0e+00
WP_000447251.1|2291717_2292047_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_001152371.1|2292056_2292755_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_146881436.1|2292759_2293503_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	2.0e-144
WP_000741589.1|2293400_2294048_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_146881437.1|2294108_2297606_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	97.3	0.0e+00
WP_001233090.1|2297676_2298276_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_146881438.1|2298340_2301943_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	98.5	0.0e+00
WP_072144121.1|2301997_2302117_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
WP_000086527.1|2302214_2302805_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2303121_2303355_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2303423_2303537_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2304140_2305424_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527797.1|2305512_2306973_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
>prophage 5
NZ_CP042585	Escherichia coli strain LD91-1 chromosome, complete genome	4733770	2721799	2769598	4733770	capsid,tRNA,integrase,terminase,portal,head,tail,lysis	Enterobacteria_phage(64.81%)	64	2742403:2742417	2771267:2771281
WP_039022689.1|2721799_2722384_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	2.8e-101
WP_088167353.1|2722383_2725299_-	hypothetical protein	NA	Q6H9S9	Enterobacteria_phage	99.1	5.0e-58
WP_146881452.1|2725363_2725963_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	2.8e-109
WP_096946093.1|2726029_2729428_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_000090891.1|2729488_2730121_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_039022771.1|2730057_2730801_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_001152612.1|2730805_2731504_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_146881453.1|2731828_2734390_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.3	0.0e+00
WP_039022773.1|2734382_2734817_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	3.4e-64
WP_000479153.1|2734798_2735221_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|2735236_2735977_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|2735984_2736380_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_039022774.1|2736376_2736955_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	6.6e-79
WP_000753007.1|2736966_2737320_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158905.1|2737331_2737730_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_039022776.1|2737771_2738797_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	1.6e-192
WP_001297109.1|2738852_2739185_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_039022777.1|2739194_2740514_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	8.1e-234
WP_032315153.1|2740494_2742096_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	4.9e-310
WP_000198153.1|2742092_2742299_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_039022778.1|2742295_2744221_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
2742403:2742417	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453592.1|2744195_2744741_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.1e-94
WP_001415975.1|2745129_2745324_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|2745683_2745977_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2746067_2746250_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_039022779.1|2746466_2746964_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.7e-89
WP_000839596.1|2746963_2747179_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737283.1|2747767_2748865_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|2749053_2749437_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971055.1|2749522_2749663_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2749659_2750022_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774484.1|2750018_2750309_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_000224916.1|2750301_2750472_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054342.1|2750471_2750927_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_001303586.1|2750923_2751025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146881454.1|2751141_2751939_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001445652.1|2751948_2752500_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|2752964_2754491_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001299444.1|2754548_2754698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|2754745_2755078_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145903.1|2755145_2755448_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	94.6	4.4e-42
WP_000788890.1|2755444_2756146_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_001361484.1|2756142_2757072_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
WP_001182871.1|2757158_2757698_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_000184665.1|2757728_2757956_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712397.1|2758066_2758759_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	1.5e-109
WP_001221207.1|2758839_2759301_+	hypothetical protein	NA	G9L674	Escherichia_phage	98.7	1.1e-76
WP_000957425.1|2759294_2760341_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	96.8	4.4e-198
WP_101677625.1|2760533_2760830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233576.1|2760984_2761191_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_039022786.1|2761266_2761563_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	2.3e-48
WP_039022787.1|2761568_2762354_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	6.9e-148
WP_039022788.1|2762350_2763031_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	3.0e-131
WP_039022789.1|2763027_2763210_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	96.7	2.4e-27
WP_000548513.1|2763182_2763374_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	95.2	4.0e-25
WP_001386642.1|2763384_2763666_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763387.1|2763764_2763983_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
WP_000488406.1|2764030_2764270_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2764409_2764646_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2764635_2765778_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2765891_2767142_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248691.1|2767313_2767967_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2767976_2768438_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|2768491_2769598_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2771267:2771281	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 1
NZ_CP042586	Escherichia coli strain LD91-1 plasmid pLD91-1-146kb, complete sequence	146133	1262	76898	146133	transposase,bacteriocin,protease,integrase	Enterobacteria_phage(26.67%)	58	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_065203495.1|2123_2312_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_000175738.1|2685_3594_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_001324034.1|4824_5109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_032145261.1|6255_6645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513519.1|7012_7276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077248528.1|7425_7608_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000928804.1|10420_11608_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733250.1|11604_13545_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001312828.1|13548_14919_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|15715_16657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324079.1|16666_16855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|18917_20111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324076.1|20525_20750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738422.1|23196_23490_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001324238.1|24005_24188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324233.1|26174_26438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001318220.1|26636_27752_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001312839.1|27765_31551_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_000933675.1|31654_32884_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_064055648.1|32968_33925_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|33969_36147_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001259759.1|37089_37293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014640552.1|37270_37507_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|37970_38252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|38609_39137_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|39380_40196_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|40245_40599_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|40776_41568_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|41564_42254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|42297_42648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064055658.1|43179_47001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000142450.1|47423_47771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311056.1|48072_48555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023154360.1|48671_49520_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	39.0	5.0e-27
WP_000969990.1|49565_49847_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001351729.1|51708_52101_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|52238_53123_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|53154_54354_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|54432_55110_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|55141_55384_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001143760.1|56191_59197_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|59360_59918_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_015058868.1|60100_60961_+	class A broad-spectrum beta-lactamase TEM-135	NA	Q1MVP3	Enterobacteria_phage	99.7	3.0e-160
WP_004201280.1|61702_62176_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_086525284.1|63389_64094_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
WP_001516695.1|65171_65828_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|66607_67999_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|68035_68608_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_000844627.1|70229_70472_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|70503_71181_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|71259_72459_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|72725_73031_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|73058_74273_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001447541.1|74489_75374_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|75404_76898_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP042587	Escherichia coli strain LD91-1 plasmid pLD91-1-MCR1, complete sequence	246716	57775	99927	246716	protease,integrase,transposase	Escherichia_phage(30.77%)	47	52724:52737	65235:65248
52724:52737	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_012478345.1|57775_58750_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_049589868.1|58945_60571_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_112901080.1|60618_61449_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_001805195.1|61384_61729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|61750_62926_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|63096_63309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|63669_64752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|64918_66418_-	kinase	NA	NA	NA	NA	NA
65235:65248	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|66443_68081_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|68080_69121_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|69206_69845_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|69844_70486_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|70508_71147_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|71609_72077_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|72094_73303_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|73313_74270_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|74269_75349_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|75350_76124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|76116_77259_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|77268_78327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|78650_79232_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|79231_80389_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|80411_80867_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_062914744.1|80889_81930_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|81978_82557_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|82624_83200_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|83628_84870_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|85432_85714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|85763_85955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|86046_86418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|86760_87153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624349.1|87131_87443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|87756_88050_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|88054_89380_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|89440_89647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|89748_90159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146881499.1|90171_90987_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_001043843.1|91240_91666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|92214_92523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|92538_93396_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_071940961.1|93457_93706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077250418.1|94244_94670_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	7.6e-08
WP_063120614.1|95369_96503_-	permease	NA	NA	NA	NA	NA
WP_001175593.1|96608_96932_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|97474_98179_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001398202.1|98278_98995_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.6e-138
WP_001389365.1|99162_99927_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
NZ_CP042587	Escherichia coli strain LD91-1 plasmid pLD91-1-MCR1, complete sequence	246716	103265	159089	246716	integrase,transposase	Escherichia_phage(36.0%)	63	103213:103272	152482:153302
103213:103272	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|103265_103970_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071525219.1|103960_104149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105383.1|104236_105673_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000427623.1|106090_107095_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_101780570.1|107313_107580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032193599.1|107667_108372_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067858.1|108401_109106_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_112901131.1|109096_109252_+	replication initiator protein	NA	NA	NA	NA	NA
WP_000193209.1|109915_110734_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|110730_111936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121165.1|111999_112203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|112215_113535_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|113785_115213_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|115427_115943_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|115945_116842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|117063_117297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|117342_117597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136338.1|117634_117922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|117958_118189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|118525_118987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|119016_119424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|119474_119792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|120168_120519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|122208_122913_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001617865.1|123215_124091_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_014839980.1|124702_125119_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|125123_125642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071448054.1|125641_126388_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|126393_127098_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|127211_127988_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000171321.1|128008_128230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|129538_130291_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|132101_132587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|132783_133874_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|133963_134779_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|134865_135168_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|135061_135313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|136237_136942_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_065800308.1|137026_137416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|137680_138685_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_015344976.1|138763_141715_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|141717_142278_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_081316080.1|142403_142988_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|142956_143970_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|144114_144612_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|144723_145014_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|145019_145811_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|146072_147332_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|147424_148216_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|148385_148718_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_072078461.1|148857_149043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|149897_150689_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|151157_151403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|151440_152304_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001067855.1|152534_153239_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|153389_154205_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
152482:153302	attR	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_001067855.1|154394_155099_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|155323_155527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001993321.1|155545_155725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|155654_156494_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_072644484.1|156674_156839_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|158229_158934_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012291484.1|158879_159089_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	89.5	8.9e-10
