The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042593	Bacillus sp. FJAT-25496 chromosome, complete genome	4916069	1082228	1124367	4916069	transposase,coat,integrase	Bacillus_phage(20.0%)	37	1080102:1080148	1125518:1125564
1080102:1080148	attL	AGTGGGGGATGAAGGAAAACCCCCACTGATTGAAGTTTCACTTTATA	NA	NA	NA	NA
WP_146846389.1|1082228_1083556_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.3	1.8e-31
WP_146846391.1|1083863_1085048_+	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
WP_057775926.1|1085175_1086408_-	aminopeptidase	NA	NA	NA	NA	NA
WP_057775925.1|1086542_1087823_-	MFS transporter	NA	NA	NA	NA	NA
WP_057775924.1|1088043_1088994_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_057775923.1|1089013_1090630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057775922.1|1090831_1092028_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_057775921.1|1092011_1093115_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_057775920.1|1093130_1094654_-	spore germination protein	NA	NA	NA	NA	NA
WP_057775919.1|1095079_1097269_+	DNA topoisomerase III	NA	A0A2K9V7T1	Bandra_megavirus	26.0	1.8e-23
WP_057775918.1|1097441_1098137_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_057775917.1|1098140_1099076_+	sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	24.6	1.4e-09
WP_057775916.1|1099232_1099688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057775915.1|1100066_1100558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057775914.1|1100691_1101369_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_057775913.1|1101361_1102285_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	2.9e-44
WP_057775911.1|1103142_1104642_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	43.5	1.7e-102
WP_057776053.1|1104682_1104862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057775910.1|1105036_1105411_+	DUF1992 domain-containing protein	NA	NA	NA	NA	NA
WP_057775909.1|1105877_1106975_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_146846393.1|1107113_1107332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057775908.1|1107645_1108440_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_057775907.1|1108432_1109209_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_057775906.1|1109223_1109535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057775905.1|1109571_1110057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057776989.1|1110391_1111666_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_057776980.1|1112102_1112675_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_146846394.1|1112981_1113245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057776982.1|1113540_1114341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057776984.1|1115031_1115652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057776983.1|1115982_1116921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057776985.1|1117178_1117670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057776989.1|1117896_1119171_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_035443795.1|1119848_1120166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057775408.1|1120428_1120902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057775439.1|1120870_1123009_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_057775406.1|1123014_1124367_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1125518:1125564	attR	AGTGGGGGATGAAGGAAAACCCCCACTGATTGAAGTTTCACTTTATA	NA	NA	NA	NA
>prophage 2
NZ_CP042593	Bacillus sp. FJAT-25496 chromosome, complete genome	4916069	3128309	3179542	4916069	coat,protease,tRNA	Bacillus_phage(25.0%)	60	NA	NA
WP_057771338.1|3128309_3129509_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.0	1.7e-41
WP_057771339.1|3129510_3130650_-	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_057771530.1|3130646_3131363_-	bacillithiol biosynthesis deacetylase BshB1	NA	NA	NA	NA	NA
WP_057771340.1|3131355_3131775_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_057771341.1|3131785_3132586_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_057771342.1|3132601_3132931_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_057771343.1|3133130_3133991_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.3	1.4e-69
WP_057771344.1|3134093_3134774_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_057771345.1|3134867_3135662_-	sporulation protein YpjB	NA	NA	NA	NA	NA
WP_057771346.1|3135750_3136347_-	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_057771347.1|3136531_3137305_-	cytochrome C oxidase Cbb3	NA	NA	NA	NA	NA
WP_057771348.1|3137348_3138023_-	cytochrome b6	NA	NA	NA	NA	NA
WP_057771349.1|3138026_3138533_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_057771350.1|3138682_3139147_-	YpiF family protein	NA	NA	NA	NA	NA
WP_057771351.1|3139244_3139787_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	50.6	2.1e-42
WP_057771352.1|3139928_3141185_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_057771353.1|3141204_3142110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057771354.1|3142226_3143513_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_057771355.1|3143555_3144662_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_057771531.1|3144820_3145918_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	29.3	2.3e-24
WP_057771356.1|3145958_3146333_-	chorismate mutase	NA	NA	NA	NA	NA
WP_057771357.1|3146350_3147421_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_057771358.1|3147422_3148595_-	chorismate synthase	NA	NA	NA	NA	NA
WP_057771359.1|3148850_3149624_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_057771360.1|3149958_3150405_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.1	1.1e-28
WP_057771361.1|3150524_3151487_-	heptaprenyl diphosphate synthase component II	NA	NA	NA	NA	NA
WP_057771362.1|3151556_3152264_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_057771363.1|3152266_3153085_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_057771364.1|3153302_3153539_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_057771365.1|3153605_3154172_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.6	2.0e-48
WP_082625227.1|3154464_3154785_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	80.0	1.4e-30
WP_057771367.1|3155128_3156607_-	stage IV sporulation protein A	NA	NA	NA	NA	NA
WP_057771532.1|3156829_3157543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057771368.1|3157634_3157835_-	DUF2768 domain-containing protein	NA	NA	NA	NA	NA
WP_057771369.1|3158353_3159424_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_057771370.1|3159494_3160805_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_057771371.1|3161003_3161612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082625228.1|3161742_3161880_+	YpzI family protein	NA	NA	NA	NA	NA
WP_057771533.1|3161928_3162990_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_057771372.1|3163001_3164141_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_057771373.1|3164310_3164892_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_057771374.1|3164894_3165569_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_057771375.1|3165683_3165863_-	YpfB family protein	NA	NA	NA	NA	NA
WP_057771534.1|3165926_3166589_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_057771376.1|3166755_3168105_-	germination protein YpeB	NA	NA	NA	NA	NA
WP_057771377.1|3168119_3168950_-	spore cortex-lytic enzyme	NA	A0A172JHR8	Bacillus_phage	41.5	1.6e-22
WP_057771378.1|3169070_3169742_-|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_057771379.1|3169951_3170929_+	asparaginase	NA	NA	NA	NA	NA
WP_057771380.1|3170994_3171960_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_057771535.1|3172304_3173579_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_057771381.1|3173849_3174428_-	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_057771382.1|3174539_3175319_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_057771383.1|3175371_3175734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057771384.1|3175784_3176417_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_057771385.1|3176554_3176785_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_057771386.1|3176781_3177042_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_057771387.1|3177085_3177655_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_057771388.1|3177708_3178167_-	YpbF family protein	NA	NA	NA	NA	NA
WP_057771389.1|3178280_3178952_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_057771390.1|3178948_3179542_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP042593	Bacillus sp. FJAT-25496 chromosome, complete genome	4916069	4151597	4156066	4916069		Bacillus_phage(66.67%)	7	NA	NA
WP_146846537.1|4151597_4152158_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	29.9	2.8e-10
WP_057773591.1|4152586_4153276_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N6W8I1	Bacillus_phage	41.1	5.1e-54
WP_057773593.1|4153370_4153610_-	hypothetical protein	NA	A0A0S2SXN3	Bacillus_phage	60.3	2.5e-16
WP_057773595.1|4153624_4153879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057773598.1|4154204_4154663_-	helix-turn-helix domain-containing protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	55.3	1.1e-41
WP_057773599.1|4155172_4155613_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	43.2	1.4e-25
WP_057773601.1|4155631_4156066_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	59.0	2.0e-43
