The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034363	Pantoea sp. CCBC3-3-1 chromosome, complete genome	5008525	1179949	1187261	5008525	protease	Bacillus_virus(33.33%)	6	NA	NA
WP_147195795.1|1179949_1180573_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.4	3.8e-64
WP_147195797.1|1180656_1181931_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	7.3e-131
WP_147195799.1|1182051_1182639_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	35.4	2.3e-26
WP_147195801.1|1182946_1184221_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	2.8e-130
WP_147195804.1|1184412_1186767_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.3	1.5e-225
WP_147195806.1|1186988_1187261_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	59.6	3.5e-22
>prophage 2
NZ_CP034363	Pantoea sp. CCBC3-3-1 chromosome, complete genome	5008525	1237450	1302472	5008525	protease,terminase,holin,tRNA,integrase,tail,capsid	Edwardsiella_phage(12.07%)	91	1270815:1270839	1305170:1305194
WP_147195895.1|1237450_1238098_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_147195898.1|1238068_1238755_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	27.4	5.5e-08
WP_147195900.1|1238751_1241169_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_147195902.1|1241327_1241987_+	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_147200537.1|1241948_1242692_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_147195904.1|1243113_1244193_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_147195906.1|1244189_1244699_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_147195908.1|1244845_1245571_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_147195910.1|1245570_1246065_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_147195912.1|1246298_1247687_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.7	1.4e-45
WP_147195915.1|1247792_1248005_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_147195918.1|1248004_1248871_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.0	3.1e-32
WP_147195921.1|1249145_1250309_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	79.3	6.6e-187
WP_147195924.1|1250203_1250533_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_147195926.1|1250571_1251120_-	hypothetical protein	NA	R4W375	Alteromonas_phage	29.7	1.4e-14
WP_147195930.1|1251341_1251551_-	hypothetical protein	NA	A0A2H4IYB3	uncultured_Caudovirales_phage	53.0	5.9e-14
WP_147195932.1|1251620_1251863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147195934.1|1252100_1252325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147195936.1|1252439_1253297_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	76.1	1.3e-139
WP_147200538.1|1253336_1254017_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	84.5	1.6e-113
WP_147195938.1|1254016_1254952_-	recombinase RecT	NA	F1C5B8	Cronobacter_phage	75.1	2.8e-135
WP_147195940.1|1254951_1255266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147195942.1|1255369_1255501_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	71.4	4.7e-09
WP_147195944.1|1255630_1255918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147195946.1|1255910_1256183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147195948.1|1256856_1257099_-	hypothetical protein	NA	A0A077KC43	Edwardsiella_phage	44.2	1.2e-05
WP_147195950.1|1257477_1258107_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	37.9	6.6e-32
WP_147195952.1|1258206_1258422_+	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	64.8	2.6e-17
WP_147195953.1|1258531_1258807_+	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	83.7	1.7e-32
WP_147195955.1|1258841_1259672_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	82.4	1.4e-122
WP_147195957.1|1259668_1260487_+	replication protein	NA	K7PGT1	Enterobacteria_phage	61.7	3.6e-62
WP_147195959.1|1260483_1261245_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	59.0	1.1e-84
WP_147195961.1|1261305_1261680_+	DUF4884 domain-containing protein	NA	Q333I1	Escherichia_virus	52.9	4.9e-11
WP_147195963.1|1261676_1261955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147195965.1|1261951_1262131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147195969.1|1262134_1262581_+	hypothetical protein	NA	A0A2I7R9W3	Vibrio_phage	34.2	9.7e-14
WP_147200539.1|1262580_1262955_+	ASCH domain-containing protein	NA	A0A1S6L2Y8	Erwinia_phage	48.4	2.0e-28
WP_147195973.1|1262963_1263551_+	S-adenosylmethionine-binding protein	NA	Q858E6	Salmonella_phage	79.7	4.2e-89
WP_147195975.1|1263547_1263835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147195978.1|1263818_1263989_+	NinE family protein	NA	I6RSI9	Salmonella_phage	57.1	4.7e-09
WP_168199597.1|1263985_1264183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147195982.1|1264377_1264953_+	recombination protein NinG	NA	A0A2R2Z332	Escherichia_phage	44.9	5.2e-36
WP_147195984.1|1265122_1265737_+	hypothetical protein	NA	F1C5D0	Cronobacter_phage	39.2	2.8e-35
WP_147195988.1|1266029_1266236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147195990.1|1266521_1266698_+	addiction module toxin, HicA family	NA	A0A0M3LQ86	Mannheimia_phage	51.7	2.0e-10
WP_147195992.1|1266744_1267152_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	88.1	5.7e-61
WP_147200540.1|1267380_1267731_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_147195994.1|1267717_1268155_+	glycoside hydrolase family protein	NA	Q5G8R3	Enterobacteria_phage	61.4	3.6e-45
WP_168199598.1|1268443_1268740_+	peptidase	NA	A0A1W6JP52	Morganella_phage	44.6	9.3e-05
WP_147196001.1|1268743_1268980_+	hypothetical protein	NA	A0A291LBC4	Klebsiella_phage	67.5	1.1e-24
WP_147196003.1|1269254_1270142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147196005.1|1270149_1270401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147196007.1|1270390_1270771_+	hypothetical protein	NA	NA	NA	NA	NA
1270815:1270839	attL	GCCGCCTCCGGGCGGTTTTTTTATT	NA	NA	NA	NA
WP_147196009.1|1270898_1271345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147196011.1|1271365_1271938_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	72.9	3.8e-63
WP_147196014.1|1271939_1273598_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	73.2	5.4e-243
WP_147196017.1|1273598_1275131_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.6	2.4e-104
WP_147200541.1|1275183_1275870_+|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	56.2	2.4e-64
WP_147196020.1|1275882_1277196_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	41.5	1.6e-67
WP_147196023.1|1277199_1277685_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	49.4	1.3e-32
WP_147196025.1|1277684_1278719_+	DUF2184 domain-containing protein	NA	Q6UJ19	Burkholderia_virus	47.4	4.3e-81
WP_147196028.1|1278722_1279049_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	44.1	8.7e-12
WP_147196030.1|1279051_1279495_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	45.6	5.3e-20
WP_147196032.1|1279497_1280073_+	hypothetical protein	NA	A0A2I7QSG8	Vibrio_phage	31.9	7.9e-16
WP_147196034.1|1280069_1280447_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	45.5	5.1e-24
WP_147200542.1|1280554_1280983_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	34.2	6.3e-10
WP_147196036.1|1280983_1282462_+	DUF3383 family protein	NA	I2GUE7	Acinetobacter_phage	34.8	3.2e-69
WP_147200543.1|1282577_1282919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147196046.1|1282927_1283323_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.3	3.5e-15
WP_147196048.1|1283337_1283535_+	transglycosylase	NA	H9C0W8	Aeromonas_phage	48.9	6.2e-05
WP_147196050.1|1283534_1285385_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	30.9	1.1e-18
WP_147196052.1|1285387_1286191_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	41.0	4.5e-25
WP_147196054.1|1286190_1286502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147196056.1|1286498_1287356_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	38.5	2.1e-49
WP_147196058.1|1287355_1288051_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	38.0	9.2e-35
WP_147196060.1|1288040_1288511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147196061.1|1288622_1288982_+	hypothetical protein	NA	Q6UIX8	Burkholderia_virus	34.7	4.7e-11
WP_147196063.1|1288989_1290228_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.8	4.4e-104
WP_147196066.1|1290224_1290899_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.3	4.1e-40
WP_147196068.1|1292207_1292636_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	55.9	1.1e-09
WP_147196070.1|1292663_1294034_-	DUF2142 domain-containing protein	NA	NA	NA	NA	NA
WP_147196072.1|1294261_1294519_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	53.0	2.7e-16
WP_147196074.1|1294868_1296083_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.4	5.5e-120
WP_147196077.1|1296153_1296876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147196079.1|1297093_1297291_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_147200544.1|1297290_1297710_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	1.0e-28
WP_147196081.1|1297723_1298311_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	59.4	2.2e-58
WP_147200545.1|1298442_1299018_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_147196083.1|1299010_1299343_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_147196085.1|1299339_1299696_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	52.7	4.7e-27
WP_147196087.1|1299688_1302472_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.3	4.6e-287
1305170:1305194	attR	GCCGCCTCCGGGCGGTTTTTTTATT	NA	NA	NA	NA
>prophage 3
NZ_CP034363	Pantoea sp. CCBC3-3-1 chromosome, complete genome	5008525	1964420	1974022	5008525	tRNA	Tupanvirus(14.29%)	10	NA	NA
WP_147197260.1|1964420_1966349_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	3.0e-128
WP_071995442.1|1966352_1966904_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	1.7e-15
WP_004157374.1|1966998_1967196_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_147197262.1|1967237_1967594_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_147197267.1|1967914_1968898_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	2.2e-34
WP_147197269.1|1968913_1971301_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.1	6.6e-08
WP_004157378.1|1971305_1971605_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.5e-13
WP_147197271.1|1971717_1972701_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_147197273.1|1972744_1973290_+	glutathione peroxidase	NA	A0A1S7DLQ4	Molluscum_contagiosum_virus	38.2	2.0e-13
WP_147197275.1|1973290_1974022_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	2.0e-08
>prophage 4
NZ_CP034363	Pantoea sp. CCBC3-3-1 chromosome, complete genome	5008525	2649653	2755307	5008525	protease,portal,terminase,tRNA,lysis,head,plate,integrase,tail,capsid	Erwinia_phage(50.0%)	110	2646285:2646303	2747287:2747305
2646285:2646303	attL	TCTTCACGCACCACGAAAT	NA	NA	NA	NA
WP_147198337.1|2649653_2650355_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_147198339.1|2650421_2652332_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.5	2.6e-92
WP_147198341.1|2652439_2652736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198343.1|2652787_2653207_-	DUF4186 family protein	NA	NA	NA	NA	NA
WP_147198345.1|2653338_2653683_+	RidA family protein	NA	NA	NA	NA	NA
WP_147198347.1|2653696_2654731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198348.1|2654733_2654964_-	YoaH family protein	NA	NA	NA	NA	NA
WP_147198349.1|2655073_2656438_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	32.3	1.6e-43
WP_147198350.1|2656427_2657000_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_147198351.1|2657333_2658698_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_147198352.1|2658949_2660530_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_147198353.1|2660571_2662131_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	3.6e-39
WP_147198354.1|2662438_2663290_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|2663451_2663661_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_147198355.1|2664357_2665356_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_147198356.1|2665377_2665647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198357.1|2665884_2666121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198358.1|2666156_2666948_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_147198359.1|2667135_2668506_+	MFS transporter	NA	NA	NA	NA	NA
WP_147198360.1|2668602_2669484_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_147198361.1|2669754_2671785_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	4.7e-87
WP_147198362.1|2671804_2672485_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_147198363.1|2672581_2673082_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_147198364.1|2673308_2674553_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_147198365.1|2674521_2677155_+	MCE family protein	NA	NA	NA	NA	NA
WP_147198366.1|2677393_2678833_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_147198367.1|2678836_2679484_-	serine/threonine-protein phosphatase	NA	Q8HA16	Enterobacteria_phage	49.8	8.8e-56
WP_147198368.1|2680143_2681340_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_147198369.1|2681536_2682991_-	xylulokinase	NA	NA	NA	NA	NA
WP_147198370.1|2683018_2684338_-	xylose isomerase	NA	NA	NA	NA	NA
WP_147198371.1|2684700_2686191_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
WP_147198372.1|2686255_2686456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198373.1|2686749_2686995_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_147198374.1|2687175_2687565_+	VOC family protein	NA	NA	NA	NA	NA
WP_147198375.1|2687698_2689345_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.8	2.2e-10
WP_147198376.1|2689396_2689870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198377.1|2690943_2691600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198378.1|2692738_2693581_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	49.8	4.0e-77
WP_147198379.1|2693695_2694097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198380.1|2694128_2694518_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	61.9	1.9e-37
WP_147198381.1|2694582_2694789_+	hypothetical protein	NA	F1BUS0	Erwinia_phage	52.9	5.1e-10
WP_147198382.1|2694994_2695186_+	hypothetical protein	NA	F1BUR9	Erwinia_phage	63.5	5.4e-14
WP_147198383.1|2695613_2696714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198384.1|2696716_2697439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198385.1|2697851_2698259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198386.1|2698414_2699095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198387.1|2699128_2700154_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	89.8	3.6e-181
WP_147198388.1|2700146_2700326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198389.1|2700325_2702083_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	96.1	0.0e+00
WP_147198390.1|2702221_2703070_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	78.1	2.1e-113
WP_147198391.1|2703095_2704190_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	85.4	6.0e-174
WP_147198392.1|2704193_2704862_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	78.8	1.3e-91
WP_147198393.1|2704951_2705416_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	77.9	7.6e-62
WP_147198394.1|2705412_2705616_+|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	83.6	7.7e-27
WP_147198395.1|2705621_2705843_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	87.3	1.4e-29
WP_147198396.1|2705829_2706336_+	glycoside hydrolase family protein	NA	A0A218M4K3	Erwinia_phage	67.9	3.0e-59
WP_147198397.1|2706332_2706782_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	73.8	1.3e-50
WP_147198398.1|2706856_2707324_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	81.0	8.8e-66
WP_147198399.1|2707320_2707767_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	74.5	6.9e-52
WP_147198400.1|2707772_2708333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198401.1|2708341_2709670_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_147198402.1|2709764_2710355_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	79.0	2.2e-82
WP_147198403.1|2710354_2710702_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	79.8	8.8e-47
WP_147198404.1|2710703_2711612_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	88.1	1.0e-139
WP_147198405.1|2711604_2712213_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	83.5	1.7e-98
WP_147198406.1|2712209_2713274_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	58.5	1.1e-100
WP_147198407.1|2713273_2713864_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	45.7	5.9e-35
WP_147198408.1|2713935_2715264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198409.1|2715530_2716700_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	90.2	1.6e-201
WP_147198410.1|2716712_2717222_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	81.2	5.4e-77
WP_147198411.1|2717276_2717555_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	75.6	2.7e-30
WP_125287881.1|2717587_2717710_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	68.6	4.8e-08
WP_147198412.1|2717702_2720162_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	58.8	1.6e-166
WP_147198413.1|2720163_2720679_+|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	79.2	2.0e-66
WP_147198414.1|2720675_2721839_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	69.4	4.2e-149
WP_147198415.1|2721932_2722151_+	transcriptional regulator	NA	F1BUT0	Erwinia_phage	86.1	3.9e-32
WP_147198416.1|2722193_2722955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198417.1|2723163_2724213_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	60.2	5.3e-119
WP_147198418.1|2724559_2724898_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_147198419.1|2724950_2725832_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_147198420.1|2725833_2726199_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_147198421.1|2726360_2726591_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.4e-16
WP_147198422.1|2726673_2727417_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_147198423.1|2727444_2728107_+	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_147200615.1|2728103_2730167_-	prolyl oligopeptidase family serine peptidase	NA	F2Y2S5	Organic_Lake_phycodnavirus	23.3	3.1e-14
WP_147198424.1|2730321_2730975_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_147198425.1|2731209_2732049_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_147198426.1|2732186_2732558_-	DNA damage-inducible SOS regulon protein	NA	NA	NA	NA	NA
WP_147198427.1|2732698_2733877_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_147198428.1|2734118_2734760_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_147198429.1|2734979_2736455_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.1	7.1e-77
WP_147200616.1|2736830_2737697_+	transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_147198430.1|2737808_2739251_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_147198431.1|2739377_2740613_+	MdfA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_147198432.1|2740681_2741650_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_147198433.1|2741781_2743113_-	murein DD-endopeptidase MepM	NA	A0A7K9	Microcystis_virus	46.3	9.7e-17
WP_147198434.1|2743125_2744073_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_147198435.1|2744150_2744903_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	4.3e-14
WP_147198436.1|2744899_2745685_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_147198437.1|2745822_2746827_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
WP_147198438.1|2746835_2747453_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
2747287:2747305	attR	TCTTCACGCACCACGAAAT	NA	NA	NA	NA
WP_147198439.1|2747524_2748049_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	33.3	1.0e-09
WP_147198440.1|2748089_2748833_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_147198441.1|2749031_2749466_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_147198442.1|2749465_2751262_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.3	1.1e-10
WP_147198443.1|2751539_2752103_+	hydrolase	NA	NA	NA	NA	NA
WP_147198444.1|2752197_2753022_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	76.4	1.2e-54
WP_147198445.1|2753112_2753508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198446.1|2753601_2754342_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	30.6	1.0e-15
WP_147198447.1|2754338_2755307_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP034363	Pantoea sp. CCBC3-3-1 chromosome, complete genome	5008525	2858483	2887372	5008525	protease,portal,terminase,holin,tail	Enterobacteria_phage(34.62%)	43	NA	NA
WP_147198534.1|2858483_2859263_-|tail	tail fiber domain-containing protein	tail	H8ZJ71	Ostreococcus_tauri_virus	28.9	5.0e-05
WP_147198535.1|2859898_2860747_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	72.4	1.4e-106
WP_147198536.1|2860758_2862063_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.2	1.2e-218
WP_147198537.1|2862062_2863793_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	79.4	7.8e-285
WP_147198538.1|2863792_2864266_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	77.7	1.7e-69
WP_147198539.1|2864440_2864821_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	76.3	1.8e-48
WP_147198540.1|2864876_2865134_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_147198542.1|2865648_2866572_-	hypothetical protein	NA	H2DE35	Erwinia_phage	31.1	1.8e-25
WP_147198543.1|2866612_2866858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168199628.1|2867002_2867176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147200622.1|2867217_2867367_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_147198544.1|2867458_2868034_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	63.2	5.6e-62
WP_147198546.1|2868476_2868911_-	Rz lytic protein	NA	NA	NA	NA	NA
WP_147198547.1|2868907_2869333_-	glycoside hydrolase family protein	NA	A0A0B5KZG2	Acinetobacter_phage	61.1	5.4e-38
WP_147198548.1|2869316_2869670_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_147198549.1|2870682_2871450_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	63.0	4.8e-85
WP_147198550.1|2871446_2872025_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	45.7	2.8e-37
WP_147198551.1|2872017_2872329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198552.1|2872711_2873155_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	62.7	4.9e-50
WP_147198553.1|2873402_2873705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198554.1|2873908_2874115_-	hypothetical protein	NA	A0A2H4J1E7	uncultured_Caudovirales_phage	44.8	1.2e-06
WP_147198555.1|2874111_2874804_-	DNA replication protein	NA	A0A077KCC8	Edwardsiella_phage	54.9	4.3e-61
WP_147198556.1|2874800_2875751_-	replication protein	NA	Q9ZWY3	Enterobacteria_phage	67.7	3.5e-45
WP_147198557.1|2875747_2876578_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	79.6	2.8e-115
WP_147198558.1|2876612_2876885_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	66.2	2.7e-19
WP_147198559.1|2876995_2877199_-	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	49.2	1.6e-08
WP_147198560.1|2877300_2878008_+	helix-turn-helix domain-containing protein	NA	A4KWS0	Enterobacteria_phage	62.1	1.7e-76
WP_147198561.1|2878117_2879242_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_147198562.1|2879238_2879739_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_147198563.1|2879897_2880254_+	hypothetical protein	NA	G0ZNF1	Cronobacter_phage	89.8	2.9e-53
WP_147198564.1|2880644_2880893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198565.1|2880973_2881291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147198566.1|2881535_2881877_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_168199629.1|2882103_2882271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198567.1|2882267_2882555_+	host nuclease inhibitor GamL	NA	NA	NA	NA	NA
WP_147198568.1|2882554_2883373_+	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	81.2	1.4e-135
WP_147198569.1|2883369_2884293_+	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	66.9	2.6e-114
WP_147198570.1|2884475_2884697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198571.1|2884864_2885266_+	hypothetical protein	NA	A0A2P1MXE8	Escherichia_phage	35.7	2.4e-11
WP_147198572.1|2885249_2885480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147198573.1|2885469_2885769_+	hypothetical protein	NA	G8C7K8	Escherichia_phage	64.9	3.1e-32
WP_147198574.1|2885805_2886054_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	49.3	3.5e-13
WP_147198575.1|2886085_2887372_+	DUF3596 domain-containing protein	NA	Q6HA01	Enterobacteria_phage	51.6	1.8e-116
>prophage 6
NZ_CP034363	Pantoea sp. CCBC3-3-1 chromosome, complete genome	5008525	3170403	3186225	5008525		Enterobacteria_phage(22.22%)	11	NA	NA
WP_147198805.1|3170403_3173916_-	glycosyltransferase	NA	Q854P7	Mycobacterium_phage	38.5	5.0e-12
WP_147198806.1|3173912_3175259_-	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.7	3.0e-05
WP_147198807.1|3175248_3176067_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_147198808.1|3176067_3176610_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.7	2.2e-52
WP_147198809.1|3176638_3177511_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	63.1	1.1e-104
WP_147198810.1|3177557_3178442_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.6	3.8e-25
WP_147198811.1|3178441_3179521_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.9	2.2e-99
WP_147198812.1|3180065_3181079_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.0	1.8e-76
WP_147198813.1|3181126_3182023_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.3	7.4e-45
WP_147198814.1|3182448_3183678_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_147198815.1|3184002_3186225_-	amylovoran biosynthesis protein AmsF	NA	W8CZM5	Erwinia_phage	42.2	1.9e-126
>prophage 7
NZ_CP034363	Pantoea sp. CCBC3-3-1 chromosome, complete genome	5008525	3691103	3708337	5008525	tail,lysis,holin	uncultured_Caudovirales_phage(65.0%)	23	NA	NA
WP_147199240.1|3691103_3691934_+	benzoate transporter	NA	A7IXE3	Paramecium_bursaria_Chlorella_virus	32.3	1.1e-26
WP_147199242.1|3691990_3692374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147199244.1|3692375_3693359_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	51.2	6.3e-13
WP_147199246.1|3693361_3693928_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	50.3	1.2e-45
WP_147199248.1|3693924_3695127_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	63.0	5.3e-131
WP_147199250.1|3695126_3695477_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	63.2	1.4e-36
WP_147199252.1|3695473_3696130_-	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	66.3	1.5e-63
WP_147199254.1|3696182_3697205_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	47.0	3.6e-80
WP_147199256.1|3697201_3697510_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	47.4	1.6e-20
WP_147199257.1|3697509_3698067_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.5	3.6e-42
WP_147199260.1|3698066_3699713_-|tail	phage tail tape measure protein	tail	A0A2H4J9N7	uncultured_Caudovirales_phage	56.8	8.9e-04
WP_147199261.1|3699702_3699855_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	80.0	4.1e-17
WP_147199263.1|3699890_3700316_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	64.9	2.9e-39
WP_147199265.1|3700319_3700760_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	63.7	6.8e-44
WP_147199267.1|3700770_3701922_-	DUF3383 family protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	70.0	2.0e-151
WP_147199270.1|3701925_3702471_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	40.9	5.1e-33
WP_147199272.1|3702502_3702946_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	37.7	1.5e-14
WP_147199275.1|3703019_3704843_-	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	42.3	8.3e-136
WP_147199278.1|3704895_3705333_-	glycoside hydrolase family protein	NA	Q5G8R3	Enterobacteria_phage	62.8	3.0e-44
WP_147199281.1|3705322_3705667_-|holin	holin	holin	NA	NA	NA	NA
WP_147199284.1|3705828_3706608_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_147199287.1|3707122_3707497_-	antitermination protein	NA	B6SCZ7	Bacteriophage	53.3	2.1e-30
WP_147199289.1|3707659_3708337_+	helix-turn-helix domain-containing protein	NA	Q9T1U7	Acyrthosiphon_pisum_secondary_endosymbiont_phage	46.4	3.8e-54
>prophage 1
NZ_CP034366	Pantoea sp. CCBC3-3-1 plasmid unnamed3, complete sequence	96304	0	60241	96304	portal,tail,plate,lysis,head	Escherichia_phage(55.88%)	61	NA	NA
WP_147200766.1|239_521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200767.1|529_751_+	hypothetical protein	NA	Q71T91	Escherichia_phage	47.0	2.2e-11
WP_147200768.1|737_1283_+	hypothetical protein	NA	A0A1B0V872	Salmonella_phage	53.7	3.1e-38
WP_147200769.1|1460_1727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200770.1|1726_2641_+	recombination-associated protein RdgC	NA	Q71TA1	Escherichia_phage	51.6	1.8e-78
WP_147200771.1|2650_5284_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	47.9	2.7e-212
WP_147200772.1|5326_6127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200773.1|6139_6733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147200774.1|6782_7265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147200775.1|7400_8204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168199687.1|8203_8488_+	alanine racemase	NA	Q71TL3	Escherichia_phage	59.1	2.2e-27
WP_147200776.1|8490_9252_+	hypothetical protein	NA	Q71TL4	Escherichia_phage	35.5	5.7e-14
WP_147200777.1|9248_9716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200778.1|10120_11830_+	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	59.9	1.0e-199
WP_147200779.1|11885_13484_+	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	60.0	2.6e-178
WP_147200780.1|13494_14220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200781.1|14266_14845_+	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	51.9	1.3e-47
WP_147200782.1|14860_15355_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	59.0	1.6e-49
WP_168199688.1|15494_16004_-	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_147200784.1|16410_16980_+	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	52.7	1.3e-47
WP_147200785.1|16982_17579_+|tail	phage tail protein	tail	Q71TN8	Escherichia_phage	46.4	4.9e-45
WP_147200786.1|17581_18454_+	morphogenetic protein	NA	Q71TC9	Escherichia_phage	44.8	1.8e-64
WP_147200787.1|18542_21905_+	hypothetical protein	NA	A0A222YXR4	Escherichia_phage	38.5	2.6e-74
WP_147200788.1|21913_22258_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	47.7	6.1e-24
WP_147200789.1|22257_23682_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	58.5	1.9e-151
WP_147200790.1|23692_24802_+|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	53.8	1.1e-63
WP_147200791.1|24798_25236_+|tail	phage tail protein	tail	Q71TD4	Escherichia_phage	48.9	1.5e-27
WP_147200862.1|25970_26477_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	50.3	1.5e-31
WP_147200792.1|26476_27082_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	53.6	6.3e-48
WP_147200863.1|27526_27694_+	LydA	NA	NA	NA	NA	NA
WP_147200793.1|27690_28131_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	42.9	2.2e-26
WP_147200794.1|28123_28759_+	odaE	NA	A0A222YXB2	Escherichia_phage	34.4	6.0e-17
WP_147200795.1|28748_31865_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	55.4	9.9e-12
WP_147200796.1|31861_32254_+	ddrA	NA	NA	NA	NA	NA
WP_147200797.1|32305_33913_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	30.1	5.1e-20
WP_147200798.1|33912_34242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200799.1|34272_34599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147200800.1|34804_35290_+	glycoside hydrolase family protein	NA	S4TUB1	Salmonella_phage	66.2	1.7e-56
WP_147200801.1|35613_36501_+	protein RepA	NA	J9Q7H0	Salmonella_phage	49.0	1.0e-70
WP_147200802.1|37162_38425_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_147200803.1|38421_39312_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_147200804.1|39308_40376_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_168199689.1|40383_41502_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_147200864.1|41556_42207_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_168199690.1|42281_43211_-	EamA family transporter	NA	NA	NA	NA	NA
WP_147200807.1|44058_44607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147200808.1|44621_45596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168199691.1|45592_45748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147200809.1|45994_47044_-|head	head processing protein	head	Q71TR6	Escherichia_phage	46.4	1.0e-77
WP_147200810.1|47054_48767_-|portal	phage portal protein	portal	Q71TR7	Escherichia_phage	55.0	3.8e-167
WP_147200811.1|48842_55610_+	N-6 DNA methylase	NA	A0A077SK04	Escherichia_phage	46.7	0.0e+00
WP_147200812.1|55654_56083_+	olxA	NA	A0A222YZ35	Escherichia_phage	49.3	9.3e-30
WP_147200813.1|56093_56357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168199692.1|56538_56709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200814.1|56764_57007_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_147200815.1|57026_57272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200816.1|57255_57846_+	VRR-NUC domain-containing protein	NA	A0A1B0VBR8	Salmonella_phage	52.1	1.2e-32
WP_147200817.1|57983_58388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200818.1|58434_58983_+	norphogenetic protein	NA	Q1MVG9	Enterobacteria_phage	47.8	2.2e-47
WP_147200819.1|58943_59546_+	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	65.9	7.6e-70
WP_147200865.1|59542_60241_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	56.5	2.8e-68
>prophage 2
NZ_CP034366	Pantoea sp. CCBC3-3-1 plasmid unnamed3, complete sequence	96304	65266	85684	96304	terminase,integrase	Escherichia_phage(41.67%)	28	69105:69121	88239:88255
WP_147200826.1|65266_65689_+	hypothetical protein	NA	A9YWV9	Burkholderia_phage	59.5	6.6e-36
WP_168199694.1|65688_65844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200827.1|66200_66599_+	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	39.4	1.8e-11
WP_147200828.1|66583_67354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200866.1|67678_67909_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	68.4	2.5e-21
WP_147200829.1|67924_68152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147200830.1|68148_68934_-	hypothetical protein	NA	NA	NA	NA	NA
69105:69121	attL	TACAAAGGATACTAAAA	NA	NA	NA	NA
WP_147200831.1|69195_70266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200832.1|70265_70475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168199695.1|70555_70714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200833.1|70749_71028_+	hypothetical protein	NA	H6W8B9	Escherichia_phage	39.4	1.4e-05
WP_168199696.1|71030_71204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168199697.1|71203_71374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200834.1|71525_72296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200835.1|72763_73192_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	52.2	1.9e-27
WP_147200867.1|73195_74470_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.9	9.5e-147
WP_147200836.1|74710_74971_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	41.9	1.6e-08
WP_147200837.1|75138_75513_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_147200838.1|75514_76156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147200839.1|76799_77297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147200840.1|77298_78393_-	ParM/StbA family protein	NA	A0A222YXF2	Escherichia_phage	23.6	4.5e-12
WP_147200841.1|78599_79787_+	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	25.8	8.1e-23
WP_147200842.1|79767_81264_+|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	64.2	1.5e-188
WP_147200843.1|81282_82155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168199698.1|83069_83396_+	hypothetical protein	NA	P79672	Haemophilus_phage	32.1	9.3e-06
WP_147200845.1|83940_84198_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_147200846.1|84401_84635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168199699.1|84655_85684_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	42.9	1.6e-75
88239:88255	attR	TACAAAGGATACTAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP034366	Pantoea sp. CCBC3-3-1 plasmid unnamed3, complete sequence	96304	90024	95204	96304	tail	Escherichia_phage(50.0%)	7	NA	NA
WP_147200855.1|90024_90669_+	recombinase	NA	Q5QBN4	Enterobacteria_phage	62.5	2.2e-38
WP_147200856.1|91045_91504_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	32.9	8.5e-05
WP_147200857.1|91497_91824_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_147200858.1|92232_92877_+	maturation control protein	NA	Q71TG2	Escherichia_phage	43.5	9.7e-47
WP_147200868.1|92960_93230_+	hypothetical protein	NA	Q38620	Escherichia_phage	54.9	1.5e-17
WP_147200869.1|93225_94434_+|tail	phage tail protein	tail	Q1MVH4	Enterobacteria_phage	57.7	2.3e-89
WP_147200870.1|94949_95204_+|tail	phage tail protein	tail	Q71TJ9	Escherichia_phage	59.5	2.0e-24
