The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017533	Mannheimia haemolytica strain 1506, complete genome	2635019	44694	52021	2635019	transposase,tail	Mannheimia_phage(80.0%)	10	NA	NA
WP_006248673.1|44694_44937_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_015483985.1|44937_46998_-|tail	Variable tail fiber protein H	tail	A0A0M3LRW6	Mannheimia_phage	99.9	0.0e+00
WP_006253441.1|46994_47552_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|47500_48496_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|48548_48737_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48766_49135_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|49134_49509_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|49998_50802_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50846_51125_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|51301_52021_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017533	Mannheimia haemolytica strain 1506, complete genome	2635019	534728	645543	2635019	tail,protease,plate,tRNA,transposase	Burkholderia_phage(15.79%)	109	NA	NA
WP_006253631.1|534728_535889_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_006251771.1|535929_536277_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	51.8	8.3e-21
WP_006251772.1|536260_536512_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	52.9	5.8e-16
WP_006251773.1|536731_537286_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_006249721.1|537285_539610_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_006249720.1|539680_540244_-	nitroreductase	NA	NA	NA	NA	NA
WP_006249718.1|540346_542203_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_006251776.1|542243_542420_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_080542704.1|542427_542637_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_006249715.1|542675_543848_-	putative hydroxymethylpyrimidine transporter CytX	NA	NA	NA	NA	NA
WP_006249714.1|543840_545370_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_006249713.1|545669_546983_-	MFS transporter	NA	NA	NA	NA	NA
WP_006249712.1|546975_547794_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_006249710.1|548003_549785_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A060AN10	Cronobacter_phage	59.0	1.0e-207
WP_006249709.1|549781_550255_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	NA	NA	NA	NA
WP_006249708.1|550467_550686_-	acetolactate synthase 2 small subunit	NA	NA	NA	NA	NA
WP_006249707.1|550695_552348_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	33.3	2.5e-62
WP_006249706.1|552689_554192_+	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_006249705.1|554210_554867_+	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_006249704.1|554866_555544_+	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_006249703.1|555543_556491_+	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_006249702.1|556760_558665_+	heme lyase NrfEFG subunit NrfE	NA	NA	NA	NA	NA
WP_006249701.1|558661_559195_+	redoxin family protein	NA	NA	NA	NA	NA
WP_006249700.1|559184_559637_+	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_006249699.1|559623_560385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249698.1|560436_561831_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.8	7.5e-28
WP_006249696.1|562055_562859_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	33.7	6.4e-24
WP_006249695.1|562851_563628_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_006249694.1|563648_564173_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_006249693.1|564218_564854_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_006249692.1|564865_565189_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_006249691.1|565221_565482_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006249690.1|565591_566872_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_006249689.1|566937_567516_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	33.3	3.8e-10
WP_006249688.1|567582_568110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249687.1|568239_568980_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006249686.1|568992_569433_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_006249685.1|569568_570444_-	DMT family transporter	NA	NA	NA	NA	NA
WP_147037075.1|570551_571388_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_015484421.1|571462_574315_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_006249683.1|574362_575040_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
WP_006253637.1|575253_575472_+	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_006249681.1|575481_577452_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	44.1	4.3e-146
WP_006253638.1|577631_578120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249653.1|579559_580486_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249652.1|580554_580836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|580835_581270_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249650.1|581275_581773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249649.1|581857_583243_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249648.1|583253_583769_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249647.1|583864_584179_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080542703.1|584175_584328_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249646.1|584306_584609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249645.1|584656_587314_+|tail	phage tail tape measure protein	tail	Q19UR0	Mannheimia_phage	47.4	1.4e-14
WP_006249644.1|587323_588247_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	29.1	3.6e-18
WP_006249643.1|588230_588458_+	membrane protein	NA	A4JWL2	Burkholderia_virus	47.8	7.1e-13
WP_006249642.1|588450_589515_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	41.6	5.6e-68
WP_006249641.1|589501_590038_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_006249640.1|590092_590455_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_006249639.1|590464_591568_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_006249638.1|591560_592127_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249637.1|592136_594416_+|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249636.1|594416_595019_+	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249635.1|595002_595278_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249634.1|595277_595565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249632.1|595731_596436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249630.1|596883_597672_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_006249629.1|597708_600147_-	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249628.1|600466_602233_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249627.1|602387_603299_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006253685.1|603421_604504_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006253684.1|604591_605461_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253683.1|605514_606009_-	DedA family protein	NA	NA	NA	NA	NA
WP_006249873.1|606209_607034_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_006249872.1|607123_609448_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_147008890.1|609682_610708_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	53.9	1.7e-90
WP_006250031.1|610956_611697_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250032.1|611827_613894_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250033.1|614015_615173_+	chorismate mutase	NA	NA	NA	NA	NA
WP_006250034.1|615231_615447_-	YdcH family protein	NA	NA	NA	NA	NA
WP_006250035.1|615636_616452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250036.1|616513_617158_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006253681.1|617269_618973_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006253680.1|619007_619406_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_015484415.1|619433_620570_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_015484414.1|620566_621382_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005624547.1|621381_622263_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006250037.1|622259_622928_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_006250039.1|623271_624555_-	MFS transporter	NA	NA	NA	NA	NA
WP_006250041.1|624720_628437_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250042.1|628544_630548_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_006253679.1|630646_632005_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006251873.1|632028_632763_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006253678.1|632765_633401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249329.1|633668_634406_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006249330.1|634402_635371_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006253677.1|635551_635887_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249042.1|635870_636194_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006249043.1|636183_638070_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249044.1|638117_638900_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249045.1|638948_640109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249046.1|640168_641185_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249047.1|641272_641434_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249048.1|641411_642413_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249049.1|642414_642819_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249050.1|642953_643136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249051.1|643139_643469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249052.1|643504_644257_-	Fic family protein	NA	NA	NA	NA	NA
WP_006249053.1|644295_645543_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
>prophage 3
NZ_CP017533	Mannheimia haemolytica strain 1506, complete genome	2635019	1043702	1050487	2635019		Mycobacterium_phage(16.67%)	9	NA	NA
WP_006253612.1|1043702_1044485_+	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
WP_006248948.1|1044494_1045223_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006248949.1|1045358_1046378_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248950.1|1046379_1046982_+	DedA family protein	NA	NA	NA	NA	NA
WP_006248951.1|1047110_1047266_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248952.1|1047343_1047925_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248953.1|1047939_1048587_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	4.7e-33
WP_006248954.1|1048690_1049320_+	amino acid transporter	NA	NA	NA	NA	NA
WP_006248955.1|1049434_1050487_+	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
>prophage 4
NZ_CP017533	Mannheimia haemolytica strain 1506, complete genome	2635019	1446956	1573526	2635019	portal,tail,capsid,terminase,head,plate,tRNA,integrase,transposase,holin	Mannheimia_phage(93.65%)	155	1565573:1565591	1582342:1582360
WP_006248143.1|1446956_1449584_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
WP_006248145.1|1449778_1450204_-	universal stress protein	NA	NA	NA	NA	NA
WP_006251533.1|1450434_1451208_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248147.1|1451351_1452143_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1452195_1452492_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248149.1|1452516_1452795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248151.1|1452954_1454931_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_006248152.1|1455022_1455823_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_006248153.1|1456190_1457189_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	100.0	1.1e-185
WP_006248154.1|1457466_1457649_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	100.0	2.7e-23
WP_006248155.1|1457918_1458209_-	hypothetical protein	NA	A0A0M3LQ35	Mannheimia_phage	100.0	3.2e-50
WP_006248156.1|1458183_1458453_-	hypothetical protein	NA	A0A0M3LQ12	Mannheimia_phage	100.0	1.1e-44
WP_006248157.1|1458442_1458775_-	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	100.0	2.3e-60
WP_006248158.1|1458785_1459238_-	single-stranded DNA-binding protein	NA	A0A0M3LP44	Mannheimia_phage	100.0	1.7e-77
WP_006248159.1|1459237_1459570_-	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	100.0	2.5e-59
WP_006248160.1|1459582_1461943_-	replication endonuclease	NA	Q19US8	Mannheimia_phage	100.0	0.0e+00
WP_006248161.1|1461939_1462272_-	hypothetical protein	NA	Q19US9	Mannheimia_phage	100.0	1.6e-61
WP_006248162.1|1462268_1462511_-	hypothetical protein	NA	Q19UT0	Mannheimia_phage	100.0	9.5e-40
WP_006248164.1|1462662_1462956_-	hypothetical protein	NA	Q19UT1	Mannheimia_phage	100.0	4.1e-53
WP_006248165.1|1462968_1463301_-	hypothetical protein	NA	Q19UT2	Mannheimia_phage	100.0	4.8e-50
WP_006248166.1|1463383_1463656_-	hypothetical protein	NA	Q19UN6	Mannheimia_phage	100.0	4.5e-46
WP_006253660.1|1463788_1464034_+	hypothetical protein	NA	A0A0M3LNP3	Mannheimia_phage	100.0	3.8e-36
WP_006248168.1|1464132_1464345_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1464468_1465155_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248170.1|1465158_1465677_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1465694_1466105_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248172.1|1466204_1466465_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006248173.1|1466499_1467306_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248174.1|1467488_1468727_-	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_006248175.1|1468726_1469164_-|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	100.0	2.5e-75
WP_006253663.1|1469165_1469513_-	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_075270712.1|1469576_1469693_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
WP_006248177.1|1469716_1470031_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006248178.1|1470109_1470616_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248179.1|1470624_1471806_-|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_006248181.1|1472183_1472426_-	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_015981653.1|1472426_1474706_-|tail	variable tail fiber protein H	tail	Q19UW4	Mannheimia_virus	100.0	0.0e+00
WP_006248185.1|1474708_1475341_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	100.0	1.0e-101
WP_006248186.1|1475327_1476245_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248187.1|1476241_1476577_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248188.1|1476576_1477182_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006250779.1|1477310_1477598_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_006250778.1|1477590_1477770_-	hypothetical protein	NA	A0A0M3LP21	Mannheimia_phage	100.0	7.5e-26
WP_006248190.1|1477831_1480744_-	hypothetical protein	NA	Q19UR0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1480782_1481061_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248192.1|1481111_1481570_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248193.1|1481562_1482048_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_006248194.1|1482044_1482266_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1482414_1482870_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006250773.1|1482866_1483433_-	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1483425_1483632_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1483637_1483850_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1483846_1484362_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1484473_1485163_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248197.1|1485172_1486201_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006248198.1|1486214_1487042_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1487155_1488994_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248200.1|1489002_1490043_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006248201.1|1490818_1491823_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1492047_1492443_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248203.1|1492529_1493612_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248204.1|1493741_1493972_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248205.1|1493980_1495033_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248206.1|1495103_1495997_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248207.1|1495983_1496949_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006253548.1|1496951_1498703_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248209.1|1498695_1499655_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006249151.1|1499963_1500545_+	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006249152.1|1500585_1501038_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249153.1|1501041_1501362_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249154.1|1501358_1501958_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249155.1|1502000_1502519_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015587056.1|1502569_1504261_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_006249157.1|1504263_1505082_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_031192872.1|1505169_1506018_-	OmpA family protein	NA	NA	NA	NA	NA
WP_006249159.1|1506145_1507867_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_006249160.1|1507951_1508635_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249161.1|1508644_1510174_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_095578364.1|1510398_1511145_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_147008904.1|1511309_1514123_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_006249164.1|1514225_1515455_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249165.1|1515747_1516908_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249166.1|1516916_1517786_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249167.1|1517856_1519302_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249168.1|1519406_1520393_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249169.1|1520383_1521022_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249171.1|1522205_1522796_+	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249172.1|1522865_1523384_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_006249173.1|1523530_1523842_-	hypothetical protein	NA	A0A0M3LSF7	Mannheimia_phage	100.0	5.0e-49
WP_006253545.1|1524217_1524511_-	hypothetical protein	NA	A0A0M3LR47	Mannheimia_phage	100.0	3.4e-47
WP_147037084.1|1524633_1531692_-	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	96.5	0.0e+00
WP_006249176.1|1531701_1532331_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	100.0	1.0e-109
WP_147010038.1|1532599_1533331_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	98.8	4.6e-146
WP_147037086.1|1533334_1534051_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	99.6	2.8e-135
WP_006251214.1|1534058_1534529_-|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251215.1|1534528_1534858_-|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251216.1|1534861_1537357_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251218.1|1537901_1538360_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_020824316.1|1538528_1538762_+	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251220.1|1538776_1539448_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_006251221.1|1539543_1539720_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251222.1|1539775_1540192_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251223.1|1540231_1540714_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251224.1|1540717_1541098_-	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	100.0	7.1e-66
WP_006251225.1|1541094_1541463_-	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_006251226.1|1541464_1541809_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251227.1|1541808_1542186_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251229.1|1542505_1543495_-	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_006251230.1|1543509_1543944_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_015587048.1|1543936_1545307_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_015587047.1|1545293_1546232_-	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_006251233.1|1546185_1547562_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	100.0	4.3e-262
WP_015484276.1|1547558_1548779_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LQ32	Mannheimia_phage	100.0	8.3e-241
WP_020849856.1|1548762_1549287_-|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	100.0	2.2e-89
WP_020824300.1|1549678_1549912_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	87.8	1.2e-31
WP_006250100.1|1549856_1550207_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250099.1|1550179_1550749_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250098.1|1550741_1550987_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006251707.1|1551325_1551511_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250094.1|1551830_1552304_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006250093.1|1552293_1552863_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	100.0	3.2e-102
WP_006250091.1|1552990_1553185_-	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250090.1|1553230_1553443_-	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250089.1|1553492_1553999_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250088.1|1553982_1554198_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250086.1|1554288_1554825_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250085.1|1554821_1556183_-	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250084.1|1556179_1557049_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006253537.1|1557357_1557618_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250080.1|1557638_1557845_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006250079.1|1557974_1558634_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006248823.1|1558684_1559065_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824298.1|1559057_1559555_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	100.0	2.4e-45
WP_015586954.1|1559664_1560705_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
WP_006253368.1|1560842_1561148_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250986.1|1561156_1561432_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250250.1|1561723_1561954_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250251.1|1562335_1562572_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250253.1|1563140_1563647_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250254.1|1563650_1564010_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250255.1|1564006_1564486_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250256.1|1564619_1564832_+	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006253370.1|1564844_1565795_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
1565573:1565591	attL	AGCCAAAGCGATTACTGAT	NA	NA	NA	NA
WP_006250257.1|1565835_1566630_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006250258.1|1566626_1567262_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_015484282.1|1567471_1567924_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	100.0	6.3e-85
WP_006250261.1|1568001_1568529_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250262.1|1568525_1568729_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|1568712_1569177_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006253371.1|1569180_1569369_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006247827.1|1569830_1570046_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253375.1|1570590_1571292_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006247824.1|1571809_1572193_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	100.0	2.4e-69
WP_006247823.1|1572242_1572464_+	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006247822.1|1572485_1573526_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
1582342:1582360	attR	ATCAGTAATCGCTTTGGCT	NA	NA	NA	NA
>prophage 5
NZ_CP017533	Mannheimia haemolytica strain 1506, complete genome	2635019	1579099	1623089	2635019	transposase,tRNA,integrase	Mannheimia_phage(42.86%)	41	1580678:1580696	1604486:1604504
WP_006247813.1|1579099_1581958_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
1580678:1580696	attL	TAAACAAGCGGTCAAATTT	NA	NA	NA	NA
WP_006247812.1|1582242_1582536_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_015484247.1|1582679_1583069_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1583040_1583340_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247808.1|1583516_1584203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248825.1|1584604_1584805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006248824.1|1584935_1585619_+	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248823.1|1585693_1586074_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006250077.1|1586066_1586564_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006250075.1|1586695_1586878_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250074.1|1586916_1587336_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
WP_006253274.1|1587671_1588316_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_041447883.1|1588453_1589494_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.4	9.4e-201
WP_006253513.1|1589560_1590967_-	YdgA family protein	NA	NA	NA	NA	NA
WP_006248821.1|1591016_1591823_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_006248820.1|1591824_1593015_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_006248819.1|1593026_1593779_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006253512.1|1594004_1595537_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_006248816.1|1595973_1596375_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_006248815.1|1596444_1597284_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_006248814.1|1597320_1598004_-	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_006248812.1|1598271_1599345_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006248119.1|1599422_1600925_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.7	1.3e-86
WP_006248118.1|1601078_1602554_-	ribonuclease G	NA	NA	NA	NA	NA
WP_006248114.1|1604163_1604457_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_006248113.1|1604523_1605537_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
1604486:1604504	attR	TAAACAAGCGGTCAAATTT	NA	NA	NA	NA
WP_134916814.1|1605639_1605933_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248111.1|1605933_1606854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253509.1|1606880_1607555_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_006248109.1|1607554_1608418_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_031192850.1|1608427_1610209_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_006248107.1|1610230_1610908_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_006253505.1|1611816_1612233_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006253506.1|1612279_1613416_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_134983790.1|1613574_1614036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253506.1|1615329_1616466_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_006253505.1|1616512_1616929_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006248103.1|1616990_1617584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248102.1|1617714_1620003_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006253504.1|1620266_1622030_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248100.1|1622126_1623089_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP017533	Mannheimia haemolytica strain 1506, complete genome	2635019	1670130	1720917	2635019	portal,tail,terminase,integrase,transposase,holin	Mannheimia_phage(59.09%)	66	1689829:1689845	1730280:1730296
WP_147008909.1|1670130_1671063_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	96.7	1.4e-166
WP_006252769.1|1671304_1671745_+	DoxX family protein	NA	NA	NA	NA	NA
WP_006248065.1|1671770_1672058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248064.1|1672158_1673082_+	DUF692 family protein	NA	NA	NA	NA	NA
WP_006248063.1|1673071_1673812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248062.1|1674612_1674783_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_006247812.1|1675050_1675344_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_147037088.1|1675466_1682525_-	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	95.9	0.0e+00
WP_147037090.1|1682534_1683164_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	99.5	1.0e-109
WP_147037092.1|1683432_1684164_-|tail	phage tail protein	tail	A0A0M3LP75	Mannheimia_phage	99.6	1.6e-146
WP_006249178.1|1684167_1684884_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	98.3	2.3e-134
WP_006249179.1|1684883_1685213_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	38.9	4.1e-17
WP_006249180.1|1685212_1688779_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	34.3	2.3e-33
WP_006249181.1|1688832_1689060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249183.1|1689122_1689353_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006249184.1|1689397_1689799_-	hypothetical protein	NA	NA	NA	NA	NA
1689829:1689845	attL	AAAAAGACCGCTTGTTA	NA	NA	NA	NA
WP_006249185.1|1689882_1690524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249186.1|1690551_1690947_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249187.1|1690943_1691468_-|tail	tail protein	tail	M9NZH5	Enterobacteria_phage	37.0	1.9e-16
WP_006249188.1|1691471_1691774_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006249189.1|1691766_1692090_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	38.3	4.9e-15
WP_006249190.1|1692163_1694125_-	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	55.0	3.3e-199
WP_006249191.1|1694136_1695636_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	56.8	4.4e-159
WP_006249192.1|1695635_1695860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249193.1|1695856_1697968_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	67.7	2.0e-274
WP_006249194.1|1697967_1698444_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	54.7	9.3e-39
WP_006249195.1|1698591_1698990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147010045.1|1699125_1699359_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	85.1	3.5e-31
WP_006249197.1|1699303_1699654_-	DUF2570 domain-containing protein	NA	A0A0M3LPB1	Mannheimia_phage	88.8	1.5e-22
WP_015484172.1|1699654_1700251_-	glycoside hydrolase family 19 protein	NA	A0A0M3LPP0	Mannheimia_phage	84.7	4.1e-92
WP_006249199.1|1700240_1700588_-|holin	phage holin, lambda family	holin	A0A0M3LNX1	Mannheimia_phage	89.9	2.5e-49
WP_015587037.1|1700751_1701558_-	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_015484169.1|1701637_1701997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249418.1|1701986_1702346_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	2.3e-13
WP_015587038.1|1702338_1703367_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	2.8e-48
WP_015484167.1|1703436_1704009_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	96.8	3.1e-105
WP_006249422.1|1704005_1704641_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	56.3	1.5e-55
WP_006249423.1|1704628_1705420_-	helix-turn-helix domain-containing protein	NA	D0UIL5	Aggregatibacter_phage	76.1	7.7e-30
WP_006249424.1|1705416_1706178_-	hypothetical protein	NA	A0A2I7R415	Vibrio_phage	33.3	6.5e-26
WP_006249425.1|1706226_1706451_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	65.6	2.6e-15
WP_006249426.1|1706577_1707309_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	39.8	7.4e-43
WP_006249427.1|1707313_1707817_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_015484164.1|1707813_1708926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484163.1|1709189_1709420_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	98.7	2.5e-37
WP_006248786.1|1709872_1710124_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	85.2	1.7e-31
WP_006248787.1|1710126_1710402_-	hypothetical protein	NA	A0A1J0MFQ1	Staphylococcus_phage	30.4	1.2e-06
WP_006248788.1|1710615_1710801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248789.1|1710784_1710982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248790.1|1710984_1711443_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	48.0	6.0e-35
WP_006248791.1|1711478_1711838_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_006248792.1|1711907_1712711_+	YfdQ family protein	NA	I3PUY7	Vibrio_phage	40.1	1.1e-50
WP_006248793.1|1712820_1713339_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	82.3	1.4e-77
WP_006248794.1|1713335_1713536_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	67.2	1.9e-17
WP_006248795.1|1713519_1714017_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	45.9	3.5e-28
WP_015484162.1|1714020_1714209_-	hypothetical protein	NA	A0A0M3LPW7	Mannheimia_phage	93.5	5.0e-28
WP_006248797.1|1714340_1714718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248800.1|1714947_1715787_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.9	1.6e-73
WP_006248801.1|1716034_1716712_+	phage repressor protein/antirepressor Ant	NA	A0A0M3LQ72	Mannheimia_phage	91.3	2.0e-58
WP_006248804.1|1716950_1717388_+	hypothetical protein	NA	Q19US5	Mannheimia_phage	38.5	4.7e-05
WP_006248805.1|1717380_1717674_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	37.9	1.1e-05
WP_006248806.1|1717676_1717886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248807.1|1718032_1718158_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006248808.1|1718204_1719047_+	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	4.0e-109
WP_006248809.1|1719109_1719601_+	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	96.9	1.1e-95
WP_006248810.1|1719626_1719902_+	DUF4224 domain-containing protein	NA	A0A0M3LNT7	Mannheimia_phage	98.9	4.5e-46
WP_006248811.1|1719861_1720917_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	99.7	1.0e-199
1730280:1730296	attR	TAACAAGCGGTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP017533	Mannheimia haemolytica strain 1506, complete genome	2635019	1767836	1817613	2635019	transposase,protease,tRNA,tail	Mannheimia_phage(47.06%)	60	NA	NA
WP_015586954.1|1767836_1768877_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
WP_006250724.1|1769009_1769408_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_006249305.1|1769494_1772221_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_006249304.1|1772279_1772600_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_006249303.1|1772720_1773023_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_006249302.1|1773047_1773422_+	copper resistance protein NlpE	NA	NA	NA	NA	NA
WP_006253343.1|1773778_1774090_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_006250721.1|1774181_1774769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253344.1|1775094_1775385_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006247901.1|1775444_1776176_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_006247900.1|1776175_1776736_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_006247899.1|1776735_1777161_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_006247898.1|1777207_1778260_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006247896.1|1778644_1780012_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_006247895.1|1780055_1780724_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	1.7e-30
WP_006250714.1|1782811_1783729_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006250713.1|1783725_1784073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253346.1|1784745_1785396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075270689.1|1785385_1785724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249206.1|1786410_1786614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249207.1|1786625_1786874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251851.1|1787308_1787494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251853.1|1788053_1788272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249213.1|1788876_1790073_+	cysteine desulfurase	NA	A0A1V0SL42	Klosneuvirus	25.9	6.2e-23
WP_006251855.1|1790179_1791154_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_006249214.1|1791221_1791929_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_006249215.1|1791973_1793425_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_006249216.1|1793538_1794399_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.2	2.0e-31
WP_006249218.1|1794832_1795807_-	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
WP_006249219.1|1795809_1796007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1795990_1796176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1796821_1797418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1797453_1798191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247790.1|1798342_1798717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006247791.1|1798728_1799385_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247792.1|1799509_1799698_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247793.1|1799755_1800439_+	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247794.1|1800435_1801482_+	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247795.1|1801492_1802086_+	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006253316.1|1804195_1804519_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006253314.1|1804599_1804767_-	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006247798.1|1804774_1805149_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
WP_006247799.1|1805550_1805946_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006247800.1|1805977_1806619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247801.1|1806701_1807103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247802.1|1807147_1807378_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_006247803.1|1807445_1807712_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_006247804.1|1807715_1807985_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_006247805.1|1808059_1808323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253312.1|1808382_1809093_+	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
WP_006247806.1|1809350_1810070_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006247807.1|1810291_1810918_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_147010781.1|1810966_1811578_+|tail	phage tail protein	tail	A0A0M3LQG1	Mannheimia_phage	62.4	4.1e-55
WP_006247808.1|1811688_1812375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1812551_1812851_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247811.1|1812822_1813212_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006250050.1|1813355_1813649_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_006250049.1|1814027_1815326_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250047.1|1815499_1816387_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006250046.1|1816389_1817613_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 8
NZ_CP017533	Mannheimia haemolytica strain 1506, complete genome	2635019	2248498	2256653	2635019	terminase,integrase	Synechococcus_phage(16.67%)	12	2251704:2251763	2257069:2257142
WP_006250276.1|2248498_2249038_+	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
WP_006250894.1|2249175_2249466_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250278.1|2249437_2249740_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006253765.1|2249757_2250051_-	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_015484067.1|2250001_2250214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250280.1|2250216_2251176_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
2251704:2251763	attL	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTT	NA	NA	NA	NA
WP_006250282.1|2251982_2253209_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006253767.1|2253483_2253702_+	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250284.1|2253814_2254138_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006250286.1|2254532_2255219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250289.1|2255538_2255964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250290.1|2255960_2256653_+|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
2257069:2257142	attR	CACCAAATTATAATCCTATACGGTTCAACCGATACCTAAAAAGCCTTGAAAATCAATGTTTCAAGGCTTTTTTA	NA	NA	NA	NA
