The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017530	Mannheimia haemolytica strain 1532 chromosome, complete genome	2644838	43764	51272	2644838	tail,transposase	Mannheimia_phage(81.82%)	11	NA	NA
WP_095578351.1|43764_43959_-	hypothetical protein	NA	A0A0M3LSS2	Mannheimia_phage	94.1	1.9e-06
WP_006248673.1|43945_44188_-	hypothetical protein	NA	A0A0M3LSI9	Mannheimia_phage	100.0	4.4e-45
WP_015483985.1|44188_46249_-|tail	Variable tail fiber protein H	tail	A0A0M3LRW6	Mannheimia_phage	99.9	0.0e+00
WP_006253441.1|46245_46803_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	98.9	3.9e-105
WP_006253442.1|46751_47747_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.6	1.5e-99
WP_006251296.1|47799_47988_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	100.0	2.2e-28
WP_006253443.1|48017_48386_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	100.0	1.6e-62
WP_006253444.1|48385_48760_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	100.0	1.5e-63
WP_006253446.1|49249_50053_-|transposase	transposase	transposase	A0A0M3LPN5	Mannheimia_phage	35.9	2.4e-31
WP_006248972.1|50097_50376_-	DNA-binding protein	NA	F6MII4	Haemophilus_phage	57.5	1.0e-16
WP_006248970.1|50552_51272_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	60.0	4.4e-64
>prophage 2
NZ_CP017530	Mannheimia haemolytica strain 1532 chromosome, complete genome	2644838	633924	642079	2644838	integrase,terminase	Acinetobacter_phage(16.67%)	12	633436:633495	638801:638874
633436:633495	attL	TAAAAAAGCCTTGAAACATTGATTTTCAAGGCTTTTTAGGTATCGGTTGAACCGTATAGG	NA	NA	NA	NA
WP_006250290.1|633924_634617_-|terminase	terminase small subunit	terminase	A0A1X9SFE5	Acinetobacter_phage	58.8	7.5e-29
WP_006250289.1|634613_635039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250286.1|635358_636045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250284.1|636439_636763_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.5	3.0e-12
WP_006253767.1|636875_637094_-	addiction module killer protein	NA	NA	NA	NA	NA
WP_006250282.1|637368_638595_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	39.9	4.3e-80
WP_006250280.1|639401_640361_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.2	5.1e-44
638801:638874	attR	TAAAAAAGCCTTGAAACATTGATTTTCAAGGCTTTTTAGGTATCGGTTGAACCGTATAGGATTATAATTTGGTG	NA	NA	NA	NA
WP_015484067.1|640363_640576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253765.1|640526_640820_+	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_006250278.1|640837_641140_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	38.7	3.5e-07
WP_006250894.1|641111_641402_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_006250276.1|641539_642079_-	HAD-IIIA family hydrolase	NA	A0A222YVZ6	Synechococcus_phage	34.8	3.1e-06
>prophage 3
NZ_CP017530	Mannheimia haemolytica strain 1532 chromosome, complete genome	2644838	1075324	1082268	2644838	tail	Mannheimia_phage(60.0%)	9	NA	NA
WP_006250049.1|1075324_1076623_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	2.7e-72
WP_006250050.1|1077001_1077295_-	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	97.9	2.2e-46
WP_015484247.1|1077438_1077828_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247810.1|1077799_1078099_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_006247808.1|1078275_1078962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253310.1|1079072_1079684_-	hypothetical protein	NA	A0A0M3LQG1	Mannheimia_phage	61.4	7.7e-54
WP_006247807.1|1079732_1080359_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	82.3	5.8e-89
WP_006247806.1|1080580_1081300_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006253312.1|1081557_1082268_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	40.0	2.2e-20
>prophage 4
NZ_CP017530	Mannheimia haemolytica strain 1532 chromosome, complete genome	2644838	1085501	1095818	2644838		Mannheimia_phage(50.0%)	14	NA	NA
WP_006247798.1|1085501_1085876_+	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	98.4	1.1e-66
WP_006253314.1|1085883_1086051_+	DNA cytosine methyltransferase	NA	A0A0M3LNT4	Mannheimia_phage	76.8	4.4e-20
WP_006253316.1|1086131_1086455_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006247795.1|1088564_1089158_-	N-6-adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	75.5	8.8e-87
WP_006247794.1|1089168_1090215_-	hypothetical protein	NA	M4SQA9	Psychrobacter_phage	52.6	1.1e-23
WP_006247793.1|1090211_1090895_-	hypothetical protein	NA	A0A2I7RHG4	Vibrio_phage	51.3	4.7e-52
WP_006247792.1|1090952_1091141_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	62.1	1.3e-12
WP_006247791.1|1091265_1091922_+	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	42.5	4.1e-37
WP_006247790.1|1091933_1092308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247789.1|1092459_1093197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253352.1|1093232_1093829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249220.1|1094474_1094660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249219.1|1094643_1094841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249218.1|1094843_1095818_+	single-stranded DNA-binding protein	NA	A0A1S5NNJ1	Burkholderia_phage	44.6	8.9e-36
>prophage 5
NZ_CP017530	Mannheimia haemolytica strain 1532 chromosome, complete genome	2644838	1214679	1265271	2644838	integrase,transposase,tRNA	Mannheimia_phage(37.5%)	43	1239862:1239880	1263675:1263693
WP_006253505.1|1214679_1215096_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006253506.1|1215142_1216279_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_006248098.1|1217842_1220479_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	35.9	4.3e-141
WP_006248099.1|1220610_1223043_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	A0A172JHT4	Bacillus_phage	32.1	6.6e-104
WP_006248100.1|1223095_1224058_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_006253504.1|1224154_1225918_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_006248102.1|1226181_1228470_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_006248103.1|1228600_1229194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006253505.1|1229255_1229672_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_006253506.1|1229718_1230855_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	57.5	4.2e-122
WP_134983790.1|1231013_1231475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248107.1|1233457_1234135_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_031192850.1|1234156_1235938_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_006248109.1|1235947_1236811_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_006253509.1|1236810_1237485_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_006248111.1|1237511_1238432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134916814.1|1238432_1238726_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_006248113.1|1238828_1239842_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
1239862:1239880	attL	AAATTTGACCGCTTGTTTA	NA	NA	NA	NA
WP_006248114.1|1239908_1240202_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_006248118.1|1241811_1243287_+	ribonuclease G	NA	NA	NA	NA	NA
WP_006248119.1|1243440_1244943_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.7	1.3e-86
WP_006248812.1|1245020_1246094_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006248814.1|1246361_1247045_+	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_006248815.1|1247081_1247921_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_006248816.1|1247990_1248392_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_006253512.1|1248828_1250361_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_006248819.1|1250586_1251339_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248820.1|1251350_1252541_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_006248821.1|1252542_1253349_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_006253513.1|1253403_1254810_+	YdgA family protein	NA	NA	NA	NA	NA
WP_020910232.1|1254876_1255917_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006253274.1|1256054_1256699_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	83.6	1.2e-97
WP_006250074.1|1257034_1257454_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	50.4	1.1e-27
WP_006250075.1|1257492_1257675_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	51.7	3.6e-07
WP_006250077.1|1257806_1258304_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	97.9	1.6e-44
WP_006248823.1|1258296_1258677_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_006248824.1|1258751_1259435_-	hypothetical protein	NA	K7PKK1	Enterobacteria_phage	31.6	2.8e-20
WP_006248825.1|1259565_1259766_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006247808.1|1260167_1260854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006247810.1|1261030_1261330_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015484247.1|1261301_1261691_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_006247812.1|1261834_1262128_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	99.0	5.7e-47
WP_006247813.1|1262412_1265271_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.6	8.0e-69
1263675:1263693	attR	AAATTTGACCGCTTGTTTA	NA	NA	NA	NA
>prophage 6
NZ_CP017530	Mannheimia haemolytica strain 1532 chromosome, complete genome	2644838	1270844	1366767	2644838	tail,tRNA,integrase,transposase,terminase,protease	Mannheimia_phage(88.75%)	113	1262011:1262029	1278780:1278798
1262011:1262029	attL	AGCCAAAGCGATTACTGAT	NA	NA	NA	NA
WP_006247822.1|1270844_1271885_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	100.0	8.5e-202
WP_006247823.1|1271906_1272128_-	DUF4224 domain-containing protein	NA	A0A0M3LQA2	Mannheimia_phage	100.0	1.3e-35
WP_006253376.1|1272177_1272561_-	hypothetical protein	NA	A0A0M3LPT1	Mannheimia_phage	99.2	2.0e-68
WP_006253375.1|1273078_1273780_-	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	100.0	4.2e-136
WP_006247827.1|1274324_1274540_+	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	100.0	1.6e-30
WP_006253371.1|1275001_1275190_+	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	100.0	4.5e-29
WP_006250263.1|1275193_1275658_-	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_006250262.1|1275641_1275845_-	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250261.1|1275841_1276369_-	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250260.1|1276446_1276899_-	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250258.1|1277108_1277744_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250257.1|1277740_1278535_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006253370.1|1278575_1279526_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
1278780:1278798	attR	ATCAGTAATCGCTTTGGCT	NA	NA	NA	NA
WP_006250256.1|1279538_1279751_-	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006250255.1|1279884_1280364_-	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250254.1|1280360_1280720_-	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250253.1|1280723_1281230_-	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250251.1|1281798_1282035_-	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250250.1|1282416_1282647_-	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250986.1|1282938_1283214_+	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006253368.1|1283222_1283528_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_147036291.1|1283665_1284706_-|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_020824298.1|1284815_1285313_-	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	100.0	2.4e-45
WP_006250079.1|1285728_1286388_-	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006250080.1|1286517_1286724_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006253537.1|1286744_1287005_+	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250084.1|1287313_1288183_+	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006250085.1|1288179_1289541_+	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250086.1|1289537_1290074_+	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250088.1|1290164_1290380_+	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250089.1|1290363_1290870_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250090.1|1290919_1291132_+	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250091.1|1291177_1291372_+	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_020824299.1|1291499_1292069_+	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	95.8	8.7e-100
WP_006250094.1|1292058_1292532_+	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_006251707.1|1292851_1293037_+	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250098.1|1293375_1293621_+	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006250099.1|1293613_1294183_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250100.1|1294155_1294506_+	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250104.1|1295075_1295600_+|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_015484276.1|1295583_1296804_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LQ32	Mannheimia_phage	100.0	8.3e-241
WP_147036293.1|1296800_1298177_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	99.8	9.6e-262
WP_015587047.1|1298130_1299069_+	hypothetical protein	NA	A0A0M3LQH2	Mannheimia_phage	100.0	2.6e-170
WP_015587048.1|1299055_1300426_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	100.0	1.2e-243
WP_006251230.1|1300418_1300853_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	100.0	8.7e-76
WP_006251229.1|1300867_1301857_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	100.0	8.6e-188
WP_147036295.1|1301868_1302201_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	100.0	4.7e-21
WP_006251227.1|1302203_1302581_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	100.0	7.3e-63
WP_006251226.1|1302580_1302925_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	100.0	2.2e-61
WP_006251225.1|1302926_1303295_+	hypothetical protein	NA	A0A0M3LSU9	Mannheimia_phage	100.0	4.8e-59
WP_147036296.1|1303291_1303672_+	hypothetical protein	NA	A0A0M3LTB0	Mannheimia_phage	99.2	2.1e-65
WP_006251223.1|1303675_1304158_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	100.0	2.3e-85
WP_006251222.1|1304197_1304614_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0M3LQH7	Mannheimia_phage	100.0	4.3e-72
WP_006251221.1|1304669_1304846_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	100.0	3.3e-26
WP_006251220.1|1304941_1305613_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	100.0	2.8e-121
WP_020824316.1|1305627_1305861_-	hypothetical protein	NA	A0A0M3LQZ8	Mannheimia_phage	100.0	7.0e-40
WP_006251218.1|1306029_1306488_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	100.0	1.2e-78
WP_006251216.1|1307032_1309528_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	100.0	0.0e+00
WP_006251215.1|1309531_1309861_+|tail	phage tail protein	tail	A0A0M3LSV3	Mannheimia_phage	100.0	1.4e-57
WP_006251214.1|1309860_1310331_+|tail	phage minor tail protein L	tail	A0A0M3LTB9	Mannheimia_phage	100.0	4.2e-84
WP_006251213.1|1310338_1311055_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	100.0	4.2e-136
WP_021265346.1|1311058_1311790_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	99.6	9.3e-147
WP_020824196.1|1312058_1312649_+|tail	tail assembly protein	tail	A0A0M3LQ39	Mannheimia_phage	100.0	1.8e-103
WP_147036298.1|1312651_1316377_+|tail	phage tail protein	tail	A0A0M3LQG1	Mannheimia_phage	98.2	0.0e+00
WP_147036300.1|1316373_1319367_+	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	98.8	0.0e+00
WP_100067196.1|1319366_1319810_+	hypothetical protein	NA	A0A0M3LS02	Mannheimia_phage	99.3	4.7e-77
WP_006250517.1|1319810_1320410_+	hypothetical protein	NA	A0A0M3LR33	Mannheimia_phage	100.0	7.5e-110
WP_015484180.1|1320524_1320818_+	hypothetical protein	NA	A0A0M3LSV5	Mannheimia_phage	100.0	1.2e-47
WP_006249172.1|1321364_1321883_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_015484183.1|1321952_1322543_-	hypothetical protein	NA	A0A0M3LPE1	Mannheimia_phage	100.0	3.7e-101
WP_006249380.1|1322962_1324510_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_006249381.1|1324506_1325106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249382.1|1325117_1325936_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_015484184.1|1325971_1326244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015484185.1|1326240_1326591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006253556.1|1326601_1327795_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_080628642.1|1327808_1328654_-	EfeM/EfeO family lipoprotein	NA	NA	NA	NA	NA
WP_006249376.1|1328816_1329053_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_006249374.1|1329291_1331310_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_006249373.1|1331312_1331723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249372.1|1331943_1333032_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_015484189.1|1333050_1334016_-	asparaginase	NA	NA	NA	NA	NA
WP_006249370.1|1334030_1334528_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_006249369.1|1334701_1335346_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_006251052.1|1335345_1335753_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	40.7	1.7e-20
WP_006249035.1|1335949_1336909_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006249034.1|1336988_1337249_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_006249033.1|1337298_1338189_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249032.1|1338318_1340925_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.0	3.1e-91
WP_006249031.1|1340974_1341913_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	28.6	6.6e-28
WP_147036302.1|1341926_1343003_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006249029.1|1343033_1343789_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006249028.1|1343940_1344150_+	alternative ribosome-rescue factor A	NA	NA	NA	NA	NA
WP_006249027.1|1344198_1344921_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_006249026.1|1344968_1346156_-	ROK family protein	NA	NA	NA	NA	NA
WP_006249025.1|1346289_1347408_+	ribonuclease D	NA	NA	NA	NA	NA
WP_006249024.1|1347464_1347947_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_006249023.1|1347957_1350618_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	44.0	1.6e-79
WP_006249022.1|1350769_1351609_+	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	37.0	1.3e-35
WP_006249021.1|1351697_1352780_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.7	6.5e-80
WP_006249020.1|1352866_1353559_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_006249019.1|1353575_1354385_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_006249018.1|1354483_1355035_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_006249017.1|1355178_1356876_+	solute:sodium symporter family transporter	NA	NA	NA	NA	NA
WP_006249016.1|1357022_1358471_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	27.1	7.1e-13
WP_006249015.1|1358560_1359679_+	anaerobic sulfatase maturase	NA	A0A1B2IB49	Erwinia_phage	28.2	1.3e-06
WP_006249014.1|1359769_1360351_-	thymidine kinase	NA	A0A2H4YFP5	Citrobacter_phage	52.1	5.6e-54
WP_006249013.1|1360406_1360625_-	cell division protein ZapB	NA	NA	NA	NA	NA
WP_006249011.1|1361916_1362240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249010.1|1362455_1363778_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_006253552.1|1363893_1364079_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_006253551.1|1364207_1365524_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_015586954.1|1365726_1366767_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
>prophage 7
NZ_CP017530	Mannheimia haemolytica strain 1532 chromosome, complete genome	2644838	1492251	1662225	2644838	head,plate,tail,holin,tRNA,integrase,transposase,terminase,portal,capsid	Mannheimia_phage(83.33%)	182	1658615:1658640	1667651:1667676
WP_006249335.1|1492251_1494639_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.4	4.7e-06
WP_006249336.1|1494686_1495673_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	7.1e-33
WP_006249338.1|1495901_1496561_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006249339.1|1496620_1497946_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_006249340.1|1498046_1498799_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_147036306.1|1498798_1499704_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_006249342.1|1499712_1500276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249343.1|1500275_1501052_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_006249344.1|1504641_1505037_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_006251543.1|1505053_1505482_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_006248128.1|1505780_1506176_+	YhcB family protein	NA	NA	NA	NA	NA
WP_006248129.1|1506336_1507908_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_006248130.1|1507924_1508236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248131.1|1508357_1509029_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_006248132.1|1509149_1510613_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.9	3.9e-96
WP_006248133.1|1510840_1514008_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.2	2.9e-51
WP_006248134.1|1514021_1515227_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006248135.1|1515257_1515830_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006248136.1|1516068_1516290_+	DUF1414 domain-containing protein	NA	NA	NA	NA	NA
WP_006253659.1|1516294_1518028_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_015484232.1|1518094_1518796_-	MFS transporter	NA	NA	NA	NA	NA
WP_006251537.1|1518792_1519173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248138.1|1519214_1523675_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_006248139.1|1523850_1524567_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_006248140.1|1524615_1525959_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_006248141.1|1526223_1527111_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	5.6e-61
WP_006248142.1|1527246_1527432_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.4e-12
WP_006248143.1|1527521_1530149_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.1	4.6e-79
WP_006248145.1|1530343_1530769_-	universal stress protein	NA	NA	NA	NA	NA
WP_006251533.1|1530999_1531773_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_006248147.1|1531916_1532708_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006248148.1|1532760_1533057_-	hypothetical protein	NA	A0A2R2X2B2	Escherichia_phage	42.3	2.1e-12
WP_006248149.1|1533081_1533360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248151.1|1533519_1535496_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_147036308.1|1535587_1536388_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.1	4.0e-10
WP_006248168.1|1537070_1537283_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	100.0	4.9e-32
WP_006248169.1|1537406_1538093_+	helix-turn-helix domain-containing protein	NA	A0A0M3LPF9	Mannheimia_phage	100.0	7.0e-128
WP_006248170.1|1538096_1538615_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	100.0	2.5e-93
WP_006253662.1|1538632_1539043_+	hypothetical protein	NA	A0A0M3LP57	Mannheimia_phage	100.0	5.5e-72
WP_006248172.1|1539142_1539403_+	excalibur calcium-binding domain-containing protein	NA	Q19UP2	Mannheimia_phage	100.0	2.2e-34
WP_006248173.1|1539437_1540244_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	100.0	2.3e-154
WP_006248174.1|1540426_1541665_-	phage late control D family protein	NA	Q19UP4	Mannheimia_phage	100.0	7.7e-218
WP_147036310.1|1541664_1542102_-|tail	phage tail protein	tail	Q19UP5	Mannheimia_phage	99.3	3.7e-74
WP_006253663.1|1542103_1542451_-	hypothetical protein	NA	R9QBV4	Mannheimia_phage	100.0	4.0e-55
WP_075270712.1|1542514_1542631_-|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	97.4	5.0e-15
WP_006248177.1|1542654_1542969_-|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	100.0	3.8e-49
WP_006248178.1|1543047_1543554_-|tail	phage major tail tube protein	tail	Q19UP8	Mannheimia_phage	100.0	1.7e-91
WP_006248179.1|1543562_1544744_-|tail	phage tail sheath protein	tail	Q19UP9	Mannheimia_phage	100.0	5.2e-224
WP_006248181.1|1545121_1545364_-	hypothetical protein	NA	Q19UQ2	Mannheimia_phage	100.0	1.7e-44
WP_147036312.1|1545364_1547644_-|tail	phage tail protein	tail	Q19UW4	Mannheimia_virus	99.9	0.0e+00
WP_006248185.1|1547646_1548279_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	100.0	1.0e-101
WP_006248186.1|1548265_1549183_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	100.0	6.2e-164
WP_006248187.1|1549179_1549515_-	hypothetical protein	NA	Q19UQ6	Mannheimia_phage	100.0	7.7e-56
WP_006248188.1|1549514_1550120_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	100.0	9.3e-84
WP_006250779.1|1550248_1550536_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	100.0	1.6e-46
WP_006248190.1|1550769_1553682_-	hypothetical protein	NA	Q19UR0	Mannheimia_phage	100.0	0.0e+00
WP_006248191.1|1553720_1553999_+	hypothetical protein	NA	Q19UR1	Mannheimia_phage	100.0	2.6e-33
WP_006248192.1|1554049_1554508_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	100.0	2.0e-78
WP_006248193.1|1554500_1554986_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	100.0	1.5e-89
WP_006248194.1|1554982_1555204_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	100.0	3.4e-36
WP_006248210.1|1555352_1555808_-	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	100.0	1.4e-71
WP_006250773.1|1555804_1556371_-	lysozyme	NA	Q19UR6	Mannheimia_phage	100.0	2.3e-105
WP_006250772.1|1556363_1556570_-|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_006250771.1|1556575_1556788_-|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006248195.1|1556784_1557300_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250770.1|1557411_1558101_-|terminase	terminase endonuclease subunit	terminase	Q19US0	Mannheimia_phage	100.0	2.2e-121
WP_006248197.1|1558110_1559139_-|capsid	phage major capsid protein, P2 family	capsid	Q19UT3	Mannheimia_phage	100.0	2.7e-192
WP_006248198.1|1559152_1559980_-|capsid	GPO family capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	100.0	4.7e-139
WP_006250768.1|1560093_1561932_+|terminase	terminase ATPase subunit family protein	terminase	R9QCL2	Mannheimia_phage	100.0	0.0e+00
WP_006248200.1|1561940_1562981_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	100.0	1.4e-199
WP_006248201.1|1563756_1564761_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_006248202.1|1564985_1565381_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_006248203.1|1565467_1566550_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_006248204.1|1566679_1566910_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_006248205.1|1566918_1567971_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_006248206.1|1568041_1568935_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006248207.1|1568921_1569887_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006253548.1|1569889_1571641_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006248209.1|1571633_1572593_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006249151.1|1572901_1573483_+	D-sedoheptulose 7-phosphate isomerase	NA	NA	NA	NA	NA
WP_006249152.1|1573523_1573976_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_006249153.1|1573979_1574300_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_006249154.1|1574296_1574896_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	27.5	2.6e-09
WP_006249155.1|1574938_1575457_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015587056.1|1575507_1577199_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_006249157.1|1577201_1578020_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_031192872.1|1578107_1578956_-	OmpA family protein	NA	NA	NA	NA	NA
WP_006249159.1|1579083_1580805_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.9e-65
WP_006249160.1|1580889_1581573_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_006249161.1|1581582_1583112_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	47.9	1.7e-17
WP_095578364.1|1583336_1584083_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L0W2	Tupanvirus	35.9	1.4e-17
WP_006249163.1|1584247_1587061_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_006249164.1|1587163_1588393_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_006249165.1|1588685_1589846_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_006249166.1|1589854_1590724_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_006249167.1|1590794_1592240_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_006249168.1|1592344_1593331_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_006249169.1|1593321_1593960_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_006249171.1|1595143_1595734_+	hypothetical protein	NA	A0A0M3LTC6	Mannheimia_phage	100.0	3.8e-98
WP_006249172.1|1595803_1596322_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	100.0	7.7e-95
WP_006249173.1|1596468_1596780_-	hypothetical protein	NA	A0A0M3LSF7	Mannheimia_phage	100.0	5.0e-49
WP_006253545.1|1597155_1597449_-	hypothetical protein	NA	A0A0M3LR47	Mannheimia_phage	100.0	3.4e-47
WP_147036314.1|1597571_1600898_-	DUF1983 domain-containing protein	NA	A0A0M3LR06	Mannheimia_phage	98.4	0.0e+00
WP_147036316.1|1600894_1604629_-|tail	phage tail protein	tail	A0A0M3LQG1	Mannheimia_phage	99.7	0.0e+00
WP_147036318.1|1604638_1605268_-|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	94.7	9.9e-105
WP_147036320.1|1605536_1606268_-|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	95.9	1.4e-142
WP_147036322.1|1606271_1606988_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	98.7	4.0e-134
WP_006253542.1|1606995_1610022_-	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	100.0	0.0e+00
WP_006253540.1|1610085_1610778_-	hypothetical protein	NA	A0A0M3LQM1	Mannheimia_phage	96.1	5.5e-48
WP_006253539.1|1610864_1611188_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	100.0	2.5e-59
WP_006250119.1|1611189_1611516_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	100.0	7.5e-56
WP_006250118.1|1611530_1611932_-	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	100.0	6.6e-70
WP_006250117.1|1612021_1613044_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	100.0	3.7e-186
WP_006250116.1|1613053_1613446_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	100.0	9.3e-69
WP_006250115.1|1613445_1613859_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	100.0	1.9e-72
WP_147036324.1|1613851_1614223_-	hypothetical protein	NA	A0A0M3LT14	Mannheimia_phage	99.2	6.3e-67
WP_006250113.1|1614222_1614660_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	100.0	3.0e-76
WP_006250112.1|1614649_1615000_-	hypothetical protein	NA	A0A0M3LS62	Mannheimia_phage	100.0	4.6e-59
WP_006250111.1|1615059_1616007_-	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	100.0	4.7e-175
WP_006250110.1|1616072_1616807_-	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	100.0	1.7e-124
WP_006250109.1|1616924_1617338_-	HD domain-containing protein	NA	A0A0M3LQS1	Mannheimia_phage	100.0	2.3e-73
WP_006250108.1|1617338_1617557_-	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	100.0	2.6e-36
WP_006250107.1|1617556_1619218_-	hypothetical protein	NA	A0A0M3LQ07	Mannheimia_phage	100.0	4.6e-311
WP_006250106.1|1619165_1620569_-	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	100.0	3.3e-265
WP_006250105.1|1620581_1621814_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LPI9	Mannheimia_phage	99.8	8.1e-244
WP_006250104.1|1621797_1622322_-|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	100.0	1.7e-89
WP_020824300.1|1622713_1622947_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	87.8	1.2e-31
WP_006250100.1|1622891_1623242_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	100.0	1.1e-28
WP_006250099.1|1623214_1623784_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	100.0	1.5e-107
WP_006250098.1|1623776_1624022_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	100.0	3.1e-38
WP_006251707.1|1624360_1624546_-	hypothetical protein	NA	A0A0M3LQD0	Mannheimia_phage	100.0	5.2e-30
WP_006250094.1|1624865_1625339_-	hypothetical protein	NA	A0A0M3LPW4	Mannheimia_phage	100.0	1.6e-83
WP_020824299.1|1625328_1625898_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	95.8	8.7e-100
WP_006250091.1|1626025_1626220_-	hypothetical protein	NA	A0A0M3LSN2	Mannheimia_phage	100.0	4.6e-29
WP_006250090.1|1626265_1626478_-	hypothetical protein	NA	A0A0M3LQX8	Mannheimia_phage	100.0	8.3e-32
WP_006250089.1|1626527_1627034_-	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	100.0	7.7e-92
WP_006250088.1|1627017_1627233_-	hypothetical protein	NA	A0A0M3LR43	Mannheimia_phage	100.0	7.2e-39
WP_006250086.1|1627323_1627860_-	DNA methyltransferase	NA	A0A0M3LPV8	Mannheimia_phage	100.0	2.2e-105
WP_006250085.1|1627856_1629218_-	DNA helicase	NA	A0A0M3LQC0	Mannheimia_phage	100.0	7.1e-257
WP_006250084.1|1629214_1630084_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	100.0	1.8e-165
WP_006253537.1|1630392_1630653_-	hypothetical protein	NA	A0A0M3LTF5	Mannheimia_phage	100.0	3.3e-38
WP_006250080.1|1630673_1630880_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	100.0	4.8e-32
WP_006250079.1|1631009_1631669_+	LexA family transcriptional regulator	NA	A0A0M3LSL8	Mannheimia_phage	100.0	1.2e-124
WP_006248823.1|1631719_1632100_+	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	100.0	1.6e-73
WP_020824298.1|1632092_1632590_+	hypothetical protein	NA	A0A0M3LR76	Mannheimia_phage	100.0	2.4e-45
WP_147036291.1|1632699_1633740_+|transposase	IS481 family transposase	transposase	A0A0M3LQ52	Mannheimia_phage	99.7	3.2e-201
WP_006253368.1|1633877_1634183_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	100.0	6.6e-54
WP_006250986.1|1634191_1634467_-	plasmid maintenance system killer	NA	A0A0M3LQB1	Mannheimia_phage	100.0	1.7e-48
WP_006250250.1|1634758_1634989_+	hypothetical protein	NA	A0A0M3LQL0	Mannheimia_phage	100.0	6.5e-38
WP_006250251.1|1635370_1635607_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	100.0	2.1e-36
WP_006250253.1|1636175_1636682_+	hypothetical protein	NA	A0A0M3LTE5	Mannheimia_phage	100.0	5.7e-95
WP_006250254.1|1636685_1637045_+	hypothetical protein	NA	A0A0M3LSX3	Mannheimia_phage	100.0	4.5e-62
WP_006250255.1|1637041_1637521_+	hypothetical protein	NA	A0A0M3LSK4	Mannheimia_phage	100.0	2.4e-79
WP_006250256.1|1637654_1637867_+	hypothetical protein	NA	A0A0M3LQW3	Mannheimia_phage	100.0	5.8e-33
WP_006253370.1|1637879_1638830_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	100.0	3.1e-158
WP_006250257.1|1638870_1639665_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	100.0	5.4e-148
WP_006250258.1|1639661_1640297_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	100.0	3.8e-120
WP_006250260.1|1640506_1640959_+	hypothetical protein	NA	A0A0M3LPG0	Mannheimia_phage	100.0	4.8e-85
WP_006250261.1|1641036_1641564_+	DUF551 domain-containing protein	NA	A0A0M3LQK2	Mannheimia_phage	100.0	1.7e-86
WP_006250262.1|1641560_1641764_+	hypothetical protein	NA	A0A0M3LPT5	Mannheimia_phage	100.0	1.0e-31
WP_006250263.1|1641747_1642212_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	100.0	5.3e-87
WP_020824296.1|1642711_1643203_+	class I SAM-dependent methyltransferase	NA	A0A0M3LQH0	Mannheimia_phage	100.0	5.4e-98
WP_015484286.1|1643229_1643487_+	hypothetical protein	NA	A0A0M3LQR4	Mannheimia_phage	100.0	1.2e-40
WP_015484287.1|1643483_1644473_-|integrase	site-specific integrase	integrase	A0A0M3LQN1	Mannheimia_phage	100.0	7.6e-184
WP_006249379.1|1644945_1646349_+|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.7	6.9e-82
WP_006249378.1|1646448_1647441_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_006253558.1|1647494_1648064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250738.1|1648230_1648797_+	elongation factor P	NA	NA	NA	NA	NA
WP_006250739.1|1648863_1649754_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250301.1|1649860_1650436_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_006250302.1|1650486_1650930_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006250304.1|1651090_1652761_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	77.5	3.6e-255
WP_006253559.1|1653027_1653993_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_006250748.1|1654154_1655495_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_006249037.1|1655687_1656029_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_006249038.1|1656095_1657097_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	46.5	5.3e-76
WP_006249039.1|1657177_1657564_+	RidA family protein	NA	NA	NA	NA	NA
WP_006249040.1|1657595_1658333_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
1658615:1658640	attL	ATGATCCCTAAAATGATCCCTATTTT	NA	NA	NA	NA
WP_006250224.1|1658704_1659919_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.5	6.2e-55
WP_006250227.1|1660388_1660595_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	35.0	1.7e-05
WP_006250228.1|1660604_1661264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006250229.1|1661274_1662225_+|capsid	phage capsid protein	capsid	E5G6M6	Salmonella_phage	37.1	4.0e-49
1667651:1667676	attR	ATGATCCCTAAAATGATCCCTATTTT	NA	NA	NA	NA
>prophage 8
NZ_CP017530	Mannheimia haemolytica strain 1532 chromosome, complete genome	2644838	1828585	1835370	2644838		Organic_Lake_phycodnavirus(16.67%)	9	NA	NA
WP_006248955.1|1828585_1829638_-	rod shape-determining protein	NA	F2Y2E1	Organic_Lake_phycodnavirus	22.1	1.2e-06
WP_006248954.1|1829752_1830382_-	amino acid transporter	NA	NA	NA	NA	NA
WP_147036330.1|1830485_1831133_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.6	6.1e-33
WP_006248952.1|1831147_1831729_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	38.4	5.9e-27
WP_006248951.1|1831806_1831962_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_006248950.1|1832090_1832693_-	DedA family protein	NA	NA	NA	NA	NA
WP_006248949.1|1832694_1833714_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.9	1.9e-33
WP_006248948.1|1833849_1834578_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	H9YRL8	environmental_Halophage	29.1	7.1e-22
WP_006253612.1|1834587_1835370_-	alpha/beta fold hydrolase	NA	G1DB77	Mycobacterium_phage	36.4	1.3e-05
>prophage 9
NZ_CP017530	Mannheimia haemolytica strain 1532 chromosome, complete genome	2644838	1935233	1991198	2644838	integrase,transposase	Mannheimia_phage(26.67%)	60	1928195:1928210	1950748:1950763
1928195:1928210	attL	TATATTTTTGGCTAAA	NA	NA	NA	NA
WP_006248370.1|1935233_1935998_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_147036334.1|1936151_1938125_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006248367.1|1938628_1939129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248366.1|1939140_1939398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248364.1|1939557_1939800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248363.1|1939876_1940074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248362.1|1940160_1941135_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	33.6	7.8e-40
WP_006248360.1|1941910_1942687_-	hypothetical protein	NA	A0A0S2MUV7	Bacillus_phage	33.5	2.4e-12
WP_006248359.1|1942683_1942890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248357.1|1943055_1943310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049800970.1|1943548_1943803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248354.1|1944139_1944691_+	hypothetical protein	NA	A0A0A8WFI2	Clostridium_phage	39.3	5.8e-16
WP_021265545.1|1944760_1944991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015484352.1|1945089_1946130_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	95.7	1.1e-193
WP_006253296.1|1946164_1946470_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_006253295.1|1946531_1948514_-	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_006248352.1|1948514_1950683_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0D3MSW0	Lactococcus_phage	45.2	1.5e-62
WP_075270679.1|1950827_1951037_-	hypothetical protein	NA	NA	NA	NA	NA
1950748:1950763	attR	TATATTTTTGGCTAAA	NA	NA	NA	NA
WP_075270676.1|1951293_1952361_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_015587043.1|1952508_1953549_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.1	4.8e-197
WP_006252258.1|1953702_1954476_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_006248318.1|1954624_1958821_+	autotransporter domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.0	8.1e-94
WP_006248319.1|1958875_1959970_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_006248320.1|1960056_1960326_+	DUF1040 family protein	NA	NA	NA	NA	NA
WP_006248321.1|1960389_1961028_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015484370.1|1961111_1961888_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015484369.1|1961897_1962152_+	luciferase	NA	NA	NA	NA	NA
WP_006252261.1|1962153_1962447_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_015586954.1|1962513_1963554_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	100.0	1.9e-201
WP_015587024.1|1963552_1964284_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006248322.1|1964601_1965156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248324.1|1965423_1965654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248326.1|1965774_1966092_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006248329.1|1966589_1966847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248332.1|1967281_1968370_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	54.3	6.1e-110
WP_006248333.1|1968434_1968866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248334.1|1968869_1970972_-	integrating conjugative element protein	NA	B4UTQ6	Rhizobium_phage	46.7	5.6e-27
WP_006253298.1|1970998_1971277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248336.1|1972245_1972677_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_032845458.1|1972694_1973687_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.6	1.8e-12
WP_005719386.1|1973683_1974673_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.5e-22
WP_006248338.1|1975664_1976306_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_006248339.1|1976323_1977079_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_005719377.1|1977082_1977730_-	DUF452 family protein	NA	NA	NA	NA	NA
WP_005719374.1|1977726_1978890_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_006248340.1|1978886_1980188_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.5e-17
WP_005719369.1|1980329_1981217_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_006248341.1|1981241_1981796_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005719365.1|1981855_1982179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719361.1|1982202_1983306_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.9e-63
WP_015484362.1|1984534_1985182_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_006248344.1|1985205_1985613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248345.1|1985710_1986061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248346.1|1986151_1986514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248347.1|1986626_1986887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044000240.1|1986976_1988236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006248349.1|1988177_1989014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006248350.1|1989117_1989582_-	ArdC family protein	NA	NA	NA	NA	NA
WP_006253302.1|1989790_1990054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147036304.1|1990157_1991198_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	96.0	1.3e-194
>prophage 10
NZ_CP017530	Mannheimia haemolytica strain 1532 chromosome, complete genome	2644838	2247335	2327883	2644838	head,plate,tail,tRNA,transposase,protease	Mannheimia_phage(15.91%)	88	NA	NA
WP_006249053.1|2247335_2248583_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.4	1.3e-119
WP_006249052.1|2248621_2249374_+	Fic family protein	NA	NA	NA	NA	NA
WP_006249051.1|2249409_2249739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249050.1|2249742_2249925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249049.1|2250059_2250464_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006249048.1|2250465_2251467_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249047.1|2251444_2251606_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_006249046.1|2251693_2252710_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.9	7.2e-89
WP_006249045.1|2252769_2253930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249044.1|2253978_2254761_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_006249043.1|2254808_2256695_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006249042.1|2256684_2257008_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_006253677.1|2256991_2257327_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006249330.1|2257507_2258476_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006249329.1|2258472_2259210_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	8.0e-13
WP_006253678.1|2259477_2260113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006251873.1|2260115_2260850_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_032850044.1|2260873_2262235_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006250042.1|2262333_2264337_-	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.3	1.5e-16
WP_006250041.1|2264444_2268161_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	70.0	1.3e-18
WP_006250039.1|2268326_2269610_+	MFS transporter	NA	NA	NA	NA	NA
WP_006250037.1|2269953_2270622_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.0e-10
WP_005624547.1|2270618_2271500_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015484414.1|2271499_2272315_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_015484415.1|2272311_2273448_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.8e-19
WP_006253680.1|2273475_2273874_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_006253681.1|2273908_2275612_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_006250036.1|2275723_2276368_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	36.6	6.5e-11
WP_006250035.1|2276429_2277245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006250034.1|2277434_2277650_+	YdcH family protein	NA	NA	NA	NA	NA
WP_006250033.1|2277708_2278866_-	chorismate mutase	NA	NA	NA	NA	NA
WP_006250032.1|2278987_2281054_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.8	1.2e-50
WP_006250031.1|2281184_2281925_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	4.2e-22
WP_006250030.1|2282173_2283199_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	54.3	1.3e-90
WP_006249872.1|2283433_2285758_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.4e-159
WP_006249873.1|2285847_2286672_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_006253683.1|2286872_2287367_+	DedA family protein	NA	NA	NA	NA	NA
WP_006253684.1|2287420_2288290_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_006253685.1|2288377_2289460_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_006249627.1|2289582_2290494_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_006249628.1|2290648_2292415_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	25.5	1.0e-13
WP_006249629.1|2292734_2295173_+	S6 family igA-specific metalloendopeptidase	NA	Q9LA58	Enterobacterial_phage	33.7	6.0e-49
WP_006249630.1|2295209_2295998_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	68.3	2.5e-105
WP_147036337.1|2296050_2296233_-	adhesin	NA	NA	NA	NA	NA
WP_006249632.1|2296401_2297106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249634.1|2297272_2297560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249635.1|2297559_2297835_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	73.5	5.4e-31
WP_006249636.1|2297818_2298421_-	hypothetical protein	NA	A0A0R6PC75	Moraxella_phage	31.4	5.0e-05
WP_006249637.1|2298421_2300701_-|tail	tail fiber protein	tail	A0A0R6PHL4	Moraxella_phage	33.3	1.4e-18
WP_006249638.1|2300710_2301277_-|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	48.7	2.8e-42
WP_006249639.1|2301269_2302373_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	37.3	9.4e-58
WP_147036339.1|2302382_2304713_-|tail	phage tail tape measure protein	tail	S5MBW5	Brevibacillus_phage	23.8	2.1e-19
WP_006249646.1|2304760_2305063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080542703.1|2305041_2305194_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_006249647.1|2305190_2305505_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_006249648.1|2305600_2306116_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	25.3	4.6e-07
WP_006249649.1|2306126_2307512_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	43.3	3.2e-95
WP_006249650.1|2307596_2308094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249651.1|2308099_2308534_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	40.7	7.7e-16
WP_006249652.1|2308533_2308815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249653.1|2308883_2309810_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	48.7	5.4e-75
WP_006249654.1|2309840_2310956_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	38.4	2.3e-64
WP_006249655.1|2311190_2311655_-	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	35.2	1.6e-14
WP_006249656.1|2311718_2312063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249658.1|2312264_2313542_-|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	48.6	1.3e-55
WP_006249659.1|2313534_2314989_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	46.8	4.8e-118
WP_006249661.1|2315107_2316664_-	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	60.2	1.4e-160
WP_006249662.1|2316663_2317236_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	45.5	8.0e-37
WP_006249663.1|2317258_2317555_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.9	3.6e-25
WP_006249664.1|2317556_2317892_-	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
WP_015484419.1|2318070_2318418_-	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	60.9	3.4e-30
WP_006249667.1|2318411_2318681_-	DUF2644 domain-containing protein	NA	NA	NA	NA	NA
WP_006249668.1|2318683_2319193_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	66.2	1.1e-56
WP_006249669.1|2319328_2319688_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	45.1	1.1e-23
WP_006249670.1|2319852_2320386_-	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	53.7	5.0e-41
WP_006249671.1|2320372_2320918_-	DUF1018 domain-containing protein	NA	A0A2I7S9B8	Vibrio_phage	33.2	7.5e-16
WP_006249672.1|2321036_2321324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249673.1|2321372_2321762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249674.1|2321778_2321961_-	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	81.7	1.1e-19
WP_051133738.1|2321970_2322189_-	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	85.0	1.1e-10
WP_006249676.1|2322310_2322604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249677.1|2322587_2322824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006249678.1|2322835_2323150_-	hypothetical protein	NA	F6MII9	Haemophilus_phage	61.5	1.6e-26
WP_006249679.1|2323152_2324094_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.4	1.3e-63
WP_006253638.1|2324125_2324614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006249681.1|2324793_2326764_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	44.1	4.3e-146
WP_006253637.1|2326773_2326992_-	transcriptional regulator	NA	A0A0M3LPY8	Mannheimia_phage	71.8	1.1e-21
WP_006249683.1|2327205_2327883_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LP76	Mannheimia_phage	36.6	6.2e-36
